ID: 1098312098

View in Genome Browser
Species Human (GRCh38)
Location 12:69158668-69158690
Sequence GACTCATACAGTAATAATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098312096_1098312098 -5 Left 1098312096 12:69158650-69158672 CCAAGTAACATACTCCACGACTC No data
Right 1098312098 12:69158668-69158690 GACTCATACAGTAATAATTCTGG No data
1098312095_1098312098 14 Left 1098312095 12:69158631-69158653 CCTTGAAAGGTGTGTCTATCCAA No data
Right 1098312098 12:69158668-69158690 GACTCATACAGTAATAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098312098 Original CRISPR GACTCATACAGTAATAATTC TGG Intergenic
No off target data available for this crispr