ID: 1098319843

View in Genome Browser
Species Human (GRCh38)
Location 12:69232225-69232247
Sequence ATGTCCAGATAGAAGTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098319838_1098319843 16 Left 1098319838 12:69232186-69232208 CCTCTGCCTAGATTTCAGAGGAT 0: 701
1: 1268
2: 1602
3: 1586
4: 1189
Right 1098319843 12:69232225-69232247 ATGTCCAGATAGAAGTCTGCTGG No data
1098319839_1098319843 10 Left 1098319839 12:69232192-69232214 CCTAGATTTCAGAGGATGTACGG 0: 45
1: 1299
2: 2289
3: 1783
4: 1070
Right 1098319843 12:69232225-69232247 ATGTCCAGATAGAAGTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098319843 Original CRISPR ATGTCCAGATAGAAGTCTGC TGG Intergenic
No off target data available for this crispr