ID: 1098320731

View in Genome Browser
Species Human (GRCh38)
Location 12:69240222-69240244
Sequence CGTGAACGCGGCCTTCCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 24}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098320731_1098320737 9 Left 1098320731 12:69240222-69240244 CCTCATGGAAGGCCGCGTTCACG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1098320737 12:69240254-69240276 ATCCCGCGCGCCCAGTCCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 96
1098320731_1098320738 10 Left 1098320731 12:69240222-69240244 CCTCATGGAAGGCCGCGTTCACG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1098320738 12:69240255-69240277 TCCCGCGCGCCCAGTCCCCGGGG 0: 1
1: 0
2: 0
3: 14
4: 121
1098320731_1098320744 24 Left 1098320731 12:69240222-69240244 CCTCATGGAAGGCCGCGTTCACG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1098320744 12:69240269-69240291 TCCCCGGGGCTCTCCTTCTCGGG 0: 1
1: 0
2: 0
3: 25
4: 232
1098320731_1098320736 8 Left 1098320731 12:69240222-69240244 CCTCATGGAAGGCCGCGTTCACG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1098320736 12:69240253-69240275 TATCCCGCGCGCCCAGTCCCCGG 0: 1
1: 0
2: 1
3: 2
4: 73
1098320731_1098320743 23 Left 1098320731 12:69240222-69240244 CCTCATGGAAGGCCGCGTTCACG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1098320743 12:69240268-69240290 GTCCCCGGGGCTCTCCTTCTCGG 0: 1
1: 0
2: 0
3: 9
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098320731 Original CRISPR CGTGAACGCGGCCTTCCATG AGG (reversed) Intronic