ID: 1098324206

View in Genome Browser
Species Human (GRCh38)
Location 12:69284194-69284216
Sequence CGAGTTGACCATTTTTCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098324206_1098324213 17 Left 1098324206 12:69284194-69284216 CCAATAGAAAAATGGTCAACTCG No data
Right 1098324213 12:69284234-69284256 CTGAATCATTTGAGCTGCAGCGG No data
1098324206_1098324216 27 Left 1098324206 12:69284194-69284216 CCAATAGAAAAATGGTCAACTCG No data
Right 1098324216 12:69284244-69284266 TGAGCTGCAGCGGGCGGTTTCGG No data
1098324206_1098324214 18 Left 1098324206 12:69284194-69284216 CCAATAGAAAAATGGTCAACTCG No data
Right 1098324214 12:69284235-69284257 TGAATCATTTGAGCTGCAGCGGG No data
1098324206_1098324215 21 Left 1098324206 12:69284194-69284216 CCAATAGAAAAATGGTCAACTCG No data
Right 1098324215 12:69284238-69284260 ATCATTTGAGCTGCAGCGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098324206 Original CRISPR CGAGTTGACCATTTTTCTAT TGG (reversed) Intergenic
No off target data available for this crispr