ID: 1098324213

View in Genome Browser
Species Human (GRCh38)
Location 12:69284234-69284256
Sequence CTGAATCATTTGAGCTGCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098324206_1098324213 17 Left 1098324206 12:69284194-69284216 CCAATAGAAAAATGGTCAACTCG No data
Right 1098324213 12:69284234-69284256 CTGAATCATTTGAGCTGCAGCGG No data
1098324209_1098324213 -8 Left 1098324209 12:69284219-69284241 CCGCCGCCGCTGCCGCTGAATCA No data
Right 1098324213 12:69284234-69284256 CTGAATCATTTGAGCTGCAGCGG No data
1098324205_1098324213 18 Left 1098324205 12:69284193-69284215 CCCAATAGAAAAATGGTCAACTC No data
Right 1098324213 12:69284234-69284256 CTGAATCATTTGAGCTGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098324213 Original CRISPR CTGAATCATTTGAGCTGCAG CGG Intergenic
No off target data available for this crispr