ID: 1098324214

View in Genome Browser
Species Human (GRCh38)
Location 12:69284235-69284257
Sequence TGAATCATTTGAGCTGCAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098324209_1098324214 -7 Left 1098324209 12:69284219-69284241 CCGCCGCCGCTGCCGCTGAATCA No data
Right 1098324214 12:69284235-69284257 TGAATCATTTGAGCTGCAGCGGG No data
1098324206_1098324214 18 Left 1098324206 12:69284194-69284216 CCAATAGAAAAATGGTCAACTCG No data
Right 1098324214 12:69284235-69284257 TGAATCATTTGAGCTGCAGCGGG No data
1098324205_1098324214 19 Left 1098324205 12:69284193-69284215 CCCAATAGAAAAATGGTCAACTC No data
Right 1098324214 12:69284235-69284257 TGAATCATTTGAGCTGCAGCGGG No data
1098324210_1098324214 -10 Left 1098324210 12:69284222-69284244 CCGCCGCTGCCGCTGAATCATTT No data
Right 1098324214 12:69284235-69284257 TGAATCATTTGAGCTGCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098324214 Original CRISPR TGAATCATTTGAGCTGCAGC GGG Intergenic
No off target data available for this crispr