ID: 1098324216

View in Genome Browser
Species Human (GRCh38)
Location 12:69284244-69284266
Sequence TGAGCTGCAGCGGGCGGTTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098324210_1098324216 -1 Left 1098324210 12:69284222-69284244 CCGCCGCTGCCGCTGAATCATTT No data
Right 1098324216 12:69284244-69284266 TGAGCTGCAGCGGGCGGTTTCGG No data
1098324205_1098324216 28 Left 1098324205 12:69284193-69284215 CCCAATAGAAAAATGGTCAACTC No data
Right 1098324216 12:69284244-69284266 TGAGCTGCAGCGGGCGGTTTCGG No data
1098324211_1098324216 -4 Left 1098324211 12:69284225-69284247 CCGCTGCCGCTGAATCATTTGAG No data
Right 1098324216 12:69284244-69284266 TGAGCTGCAGCGGGCGGTTTCGG No data
1098324209_1098324216 2 Left 1098324209 12:69284219-69284241 CCGCCGCCGCTGCCGCTGAATCA No data
Right 1098324216 12:69284244-69284266 TGAGCTGCAGCGGGCGGTTTCGG No data
1098324212_1098324216 -10 Left 1098324212 12:69284231-69284253 CCGCTGAATCATTTGAGCTGCAG No data
Right 1098324216 12:69284244-69284266 TGAGCTGCAGCGGGCGGTTTCGG No data
1098324206_1098324216 27 Left 1098324206 12:69284194-69284216 CCAATAGAAAAATGGTCAACTCG No data
Right 1098324216 12:69284244-69284266 TGAGCTGCAGCGGGCGGTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098324216 Original CRISPR TGAGCTGCAGCGGGCGGTTT CGG Intergenic
No off target data available for this crispr