ID: 1098334774

View in Genome Browser
Species Human (GRCh38)
Location 12:69391809-69391831
Sequence GCCAACTCCTCAAGTAGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098334774_1098334777 20 Left 1098334774 12:69391809-69391831 CCCATTCTACTTGAGGAGTTGGC 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1098334777 12:69391852-69391874 TCAGCTGCCCACGAATGTATTGG 0: 1
1: 0
2: 0
3: 7
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098334774 Original CRISPR GCCAACTCCTCAAGTAGAAT GGG (reversed) Intergenic
903023840 1:20413065-20413087 TCCAATTCTTCAAGTGGAATTGG - Intergenic
903621743 1:24703177-24703199 TCCAACCCCTCAAGTCAAATGGG + Intergenic
904954749 1:34273549-34273571 GCCAATTCCTCATGTAGTTTGGG + Intergenic
908511924 1:64856569-64856591 GCCTCCTCCTGAAGTGGAATTGG - Intronic
915437652 1:155920868-155920890 ACAAAGTCCTCAAGGAGAATGGG - Intronic
916159232 1:161891695-161891717 GCCAACTCCTGAAGGCAAATGGG - Intronic
916366050 1:164028987-164029009 GCCAAATAGTCAAGTTGAATAGG + Intergenic
917434599 1:175007475-175007497 GCCAACTCCTTTTGTAGAATAGG + Intronic
918069422 1:181124089-181124111 ACCAAATAATCAAGTAGAATCGG + Intergenic
918099108 1:181358089-181358111 GACAACTCCTGCAGGAGAATGGG + Intergenic
919731444 1:200916029-200916051 GCCAGCTCCTCAAGCTGAAGAGG - Intergenic
923729149 1:236533696-236533718 GCCAACTCTTTAAGCAGAAAAGG + Intronic
1068445286 10:57114046-57114068 TCCAAGACCCCAAGTAGAATAGG - Intergenic
1073256848 10:102157770-102157792 CCAAACTCCTCAAGCAGAATGGG - Intronic
1073961306 10:108932644-108932666 TCAAACTCCTCATGTAGAACAGG + Intergenic
1077593699 11:3513490-3513512 CCAAATTCCTCAAGTAGAAAGGG - Intergenic
1077678550 11:4219168-4219190 GCAAACTCCTCAAGGGGAATCGG + Intergenic
1077687953 11:4315571-4315593 GCAAACTCCTCAAGGGGAATCGG + Intergenic
1086503160 11:87474120-87474142 GGGAGCTCCTCAAGCAGAATAGG - Intergenic
1088721393 11:112595188-112595210 GACAACTCCTGAAATAGAGTGGG - Intergenic
1094065662 12:26358515-26358537 GCCAGCTCTTCAGGCAGAATGGG - Intronic
1095610910 12:44127089-44127111 GCTACCTCATCAAGTAGAAATGG - Intronic
1096370354 12:51064132-51064154 GCCCACTGTTCAAGTAGGATGGG + Exonic
1096395038 12:51259555-51259577 GCCAACTACTCACAAAGAATGGG + Intronic
1098334774 12:69391809-69391831 GCCAACTCCTCAAGTAGAATGGG - Intergenic
1105889575 13:24672876-24672898 GCCAGCTCCTAAAGTGGACTTGG - Intergenic
1106165551 13:27242613-27242635 CCCAACTCCTCATTTAGTATTGG + Intergenic
1115228368 14:31129223-31129245 GCAGGCTCCTCAAGTAGAAAAGG - Exonic
1120386658 14:83855036-83855058 GACAACTCCACAATTATAATTGG - Intergenic
1121261727 14:92571227-92571249 GGCAACTCCTGAACCAGAATAGG - Intronic
1126678397 15:51181610-51181632 GATCACTCCTCAAGTGGAATAGG + Intergenic
1130673429 15:85932342-85932364 CCCAACCCCTCAAATAGGATAGG + Intergenic
1131889094 15:96952588-96952610 GCCCACTTCCCAAGAAGAATGGG - Intergenic
1146399718 17:32493469-32493491 GCCAACGCCTCAGGTGGAGTGGG - Exonic
1147546318 17:41404722-41404744 ACCAGCTCCTAAAGTAGATTTGG + Intergenic
1150429382 17:65103032-65103054 CCCCACTCTTCAAGTAGAATCGG - Intergenic
1151181821 17:72334687-72334709 GCCATGTGCTCAAGTGGAATGGG + Intergenic
1153585157 18:6613472-6613494 GCAAACTCCCCAAGAAGAAAAGG + Intergenic
1159716652 18:71832509-71832531 GCCTATTCCCCCAGTAGAATTGG - Intergenic
1161188144 19:2936852-2936874 GCCAAATTCTCAAGTAGATGAGG - Intronic
925694966 2:6566933-6566955 GCCAACTCATGAGGTAGAAGGGG + Intergenic
933878221 2:86641570-86641592 GACAAATCCACAAGTTGAATTGG - Intronic
933896932 2:86819936-86819958 TCCAACTCATCCAGGAGAATTGG - Intronic
934777181 2:96946931-96946953 GCCAACTCCTGAAGCAGAAGAGG + Intronic
936881501 2:117257052-117257074 GCAAACTCTTCAAATAGAAAGGG + Intergenic
940551095 2:155157749-155157771 GCCCCCTCCTCAACCAGAATAGG + Intergenic
947047252 2:226001833-226001855 ACCTACTTCTCAAGAAGAATAGG - Intergenic
1170173025 20:13436462-13436484 GCCAACTCCTGATCTAGAACAGG + Intronic
1177579951 21:23008469-23008491 GCTACCTCCTCAGGTTGAATTGG + Intergenic
949212639 3:1523927-1523949 GCCAAGTCCTTAGGTAGACTTGG - Intergenic
952937488 3:38411668-38411690 GTCAAATTCTCATGTAGAATAGG - Intronic
953438327 3:42897366-42897388 GCAACCTCCTCCAGTAGATTTGG + Intronic
954043619 3:47910064-47910086 TCCTACTCCTCAAGTAGTAAAGG - Intronic
954985386 3:54786087-54786109 CCTAACTCCTCAAATAGAAAGGG + Intronic
954995639 3:54878859-54878881 CCCAACTGCTCATGTACAATGGG - Intronic
957303388 3:78423199-78423221 GAACACTCCTCAAGAAGAATTGG + Intergenic
958840753 3:99201792-99201814 GGCAACTTTTCAAGTCGAATTGG - Intergenic
961014846 3:123459789-123459811 ACCAACTCCTCTAGTAGTCTGGG + Intergenic
961897488 3:130180806-130180828 CCAAATTCCTCAAGTAGAAAGGG - Intergenic
964603564 3:158531619-158531641 GAAAACTCCTTAAGTGGAATAGG - Intronic
967174043 3:186846554-186846576 GCCAACTCTTCCAGCAGAAAAGG - Intronic
969007657 4:4034378-4034400 CCAAATTCCTCAAGTAGAAAGGG - Intergenic
969745952 4:9071685-9071707 CCAAATTCCTCAAGTAGAAAGGG + Intergenic
971018804 4:22514726-22514748 GCCAACTGTTCAGCTAGAATTGG + Intronic
972230015 4:37061531-37061553 GTCAGCTCTTCAAGTAGAAATGG + Intergenic
972693309 4:41420522-41420544 GCCAACTCCTGAAATAAAGTTGG - Intronic
980940771 4:139272074-139272096 GCCTACACCTCAACTAGAGTGGG + Intronic
983811441 4:172067081-172067103 GCAAAATCCTCAAGCAGAAAAGG - Intronic
986519140 5:8594990-8595012 CCCCACTCCTCAACTAAAATTGG - Intergenic
986763918 5:10905843-10905865 AGCAACTCCTAAAGTAGAATAGG + Intergenic
989038275 5:37198366-37198388 GACAACACCTCAAGGAGAACTGG + Intronic
989620756 5:43381813-43381835 GACAATTCCTCAAGTGGACTTGG - Exonic
990291953 5:54361053-54361075 GCCAACTCCTGAACTAGGCTGGG - Intergenic
993336297 5:86663777-86663799 AACAACTCATCAAGTAAAATCGG - Intergenic
997647898 5:135493115-135493137 TCCACCTCCTCAGGCAGAATGGG + Intergenic
997704374 5:135932940-135932962 TCCAACTCCTAAAGCAGAACTGG - Intronic
1002605901 5:180382547-180382569 GCCAACACCACAACTAGAAGGGG + Intergenic
1004942625 6:20576715-20576737 GCTGACTCCTAAAGTACAATAGG - Intronic
1006221911 6:32498406-32498428 ACCACCTCCTCAATTATAATTGG + Intergenic
1007667445 6:43523608-43523630 GCCAAATCTCCAAGTAGAATGGG + Exonic
1012931564 6:105322708-105322730 GCCAACTGCTGATGTAGAACAGG + Intronic
1019202122 6:170326515-170326537 GCCAACCCCTCATGTATTATAGG - Intronic
1020328176 7:6992507-6992529 CCAAATTCCTCAAGTAGAAAGGG - Intergenic
1021374923 7:19895211-19895233 GCCAAGTCCCCAGGGAGAATGGG + Intergenic
1022262112 7:28716166-28716188 GCAATCTCCTGAACTAGAATAGG + Intronic
1037093720 8:14955830-14955852 GACAACTCATAAAGTAGAAGTGG - Intronic
1037114663 8:15209926-15209948 GCCATCTCCTAAAATATAATTGG - Intronic
1040058494 8:43083589-43083611 ACCTACTCCTCAACTAGAAAAGG + Intronic
1043573994 8:81636050-81636072 TCCAATTCCTCAAATAGGATGGG - Intergenic
1044447998 8:92300770-92300792 AACAACTCCTGCAGTAGAATGGG + Intergenic
1045442050 8:102223839-102223861 TCCAACTTATTAAGTAGAATAGG + Intronic
1047362331 8:124180379-124180401 GCCCACTCCTCAAGGATAAGTGG + Intergenic
1047481878 8:125291508-125291530 GCCAACTCTGCAAGCAGATTTGG + Intronic
1051669317 9:19494317-19494339 GCCATCTCCTTAAGGAGAAAGGG - Intergenic
1058398764 9:104588905-104588927 GCAAATTCATCAAGTAGAAGAGG + Intergenic
1192671223 X:73143978-73144000 GTCATCTCCTCAAGAAGAACAGG - Intergenic
1195431450 X:104794127-104794149 GCCCACTTCTCATGTAGCATAGG + Intronic
1195956664 X:110338438-110338460 GCAAAATCTTCAAGTAGAACTGG - Intronic
1196046455 X:111260897-111260919 TCCATCTCCCCAACTAGAATGGG + Intronic
1197713149 X:129686703-129686725 GCCAACTCCTCCAGTAGAGAGGG + Intergenic
1198590326 X:138173295-138173317 TCCAAATCTTCAAGTAAAATTGG - Intergenic