ID: 1098335078

View in Genome Browser
Species Human (GRCh38)
Location 12:69395850-69395872
Sequence AACTCGGATAAATAACATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098335074_1098335078 4 Left 1098335074 12:69395823-69395845 CCTTGCTCTTCAGTGCATTGTCC No data
Right 1098335078 12:69395850-69395872 AACTCGGATAAATAACATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098335078 Original CRISPR AACTCGGATAAATAACATTA TGG Intergenic
No off target data available for this crispr