ID: 1098337722

View in Genome Browser
Species Human (GRCh38)
Location 12:69420869-69420891
Sequence TTCTGGATGCTGTACATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098337716_1098337722 20 Left 1098337716 12:69420826-69420848 CCAGTGCTCACCAATCTACTTTC No data
Right 1098337722 12:69420869-69420891 TTCTGGATGCTGTACATGGATGG No data
1098337714_1098337722 22 Left 1098337714 12:69420824-69420846 CCCCAGTGCTCACCAATCTACTT No data
Right 1098337722 12:69420869-69420891 TTCTGGATGCTGTACATGGATGG No data
1098337712_1098337722 27 Left 1098337712 12:69420819-69420841 CCAGCCCCCAGTGCTCACCAATC No data
Right 1098337722 12:69420869-69420891 TTCTGGATGCTGTACATGGATGG No data
1098337711_1098337722 28 Left 1098337711 12:69420818-69420840 CCCAGCCCCCAGTGCTCACCAAT No data
Right 1098337722 12:69420869-69420891 TTCTGGATGCTGTACATGGATGG No data
1098337717_1098337722 10 Left 1098337717 12:69420836-69420858 CCAATCTACTTTCTGTCTCCATG 0: 2
1: 69
2: 557
3: 1445
4: 2530
Right 1098337722 12:69420869-69420891 TTCTGGATGCTGTACATGGATGG No data
1098337713_1098337722 23 Left 1098337713 12:69420823-69420845 CCCCCAGTGCTCACCAATCTACT No data
Right 1098337722 12:69420869-69420891 TTCTGGATGCTGTACATGGATGG No data
1098337715_1098337722 21 Left 1098337715 12:69420825-69420847 CCCAGTGCTCACCAATCTACTTT No data
Right 1098337722 12:69420869-69420891 TTCTGGATGCTGTACATGGATGG No data
1098337719_1098337722 -8 Left 1098337719 12:69420854-69420876 CCATGAGTTTGCCTGTTCTGGAT No data
Right 1098337722 12:69420869-69420891 TTCTGGATGCTGTACATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098337722 Original CRISPR TTCTGGATGCTGTACATGGA TGG Intergenic
No off target data available for this crispr