ID: 1098342956

View in Genome Browser
Species Human (GRCh38)
Location 12:69470555-69470577
Sequence GGACGGCCGCGGGCCCGCGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 102}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098342947_1098342956 13 Left 1098342947 12:69470519-69470541 CCTGGGCGGACGGTGAGTGGCTA 0: 1
1: 0
2: 0
3: 4
4: 38
Right 1098342956 12:69470555-69470577 GGACGGCCGCGGGCCCGCGTCGG 0: 1
1: 0
2: 0
3: 13
4: 102
1098342944_1098342956 23 Left 1098342944 12:69470509-69470531 CCTCTCAGCACCTGGGCGGACGG 0: 1
1: 0
2: 1
3: 7
4: 116
Right 1098342956 12:69470555-69470577 GGACGGCCGCGGGCCCGCGTCGG 0: 1
1: 0
2: 0
3: 13
4: 102
1098342943_1098342956 24 Left 1098342943 12:69470508-69470530 CCCTCTCAGCACCTGGGCGGACG 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1098342956 12:69470555-69470577 GGACGGCCGCGGGCCCGCGTCGG 0: 1
1: 0
2: 0
3: 13
4: 102
1098342940_1098342956 30 Left 1098342940 12:69470502-69470524 CCTGCTCCCTCTCAGCACCTGGG 0: 1
1: 1
2: 2
3: 68
4: 513
Right 1098342956 12:69470555-69470577 GGACGGCCGCGGGCCCGCGTCGG 0: 1
1: 0
2: 0
3: 13
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098342956 Original CRISPR GGACGGCCGCGGGCCCGCGT CGG Intronic