ID: 1098342958

View in Genome Browser
Species Human (GRCh38)
Location 12:69470561-69470583
Sequence CCGCGGGCCCGCGTCGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098342944_1098342958 29 Left 1098342944 12:69470509-69470531 CCTCTCAGCACCTGGGCGGACGG 0: 1
1: 0
2: 1
3: 7
4: 116
Right 1098342958 12:69470561-69470583 CCGCGGGCCCGCGTCGGAGCTGG 0: 1
1: 0
2: 2
3: 9
4: 139
1098342943_1098342958 30 Left 1098342943 12:69470508-69470530 CCCTCTCAGCACCTGGGCGGACG 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1098342958 12:69470561-69470583 CCGCGGGCCCGCGTCGGAGCTGG 0: 1
1: 0
2: 2
3: 9
4: 139
1098342947_1098342958 19 Left 1098342947 12:69470519-69470541 CCTGGGCGGACGGTGAGTGGCTA 0: 1
1: 0
2: 0
3: 4
4: 38
Right 1098342958 12:69470561-69470583 CCGCGGGCCCGCGTCGGAGCTGG 0: 1
1: 0
2: 2
3: 9
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098342958 Original CRISPR CCGCGGGCCCGCGTCGGAGC TGG Intronic
900162055 1:1228494-1228516 ACGCGGAGCCGCGGCGGAGCCGG - Exonic
900166584 1:1246464-1246486 TCGCGGGGCAGCTTCGGAGCTGG - Intronic
900237594 1:1600123-1600145 GCGCGGGGGCGGGTCGGAGCGGG - Intergenic
903652453 1:24930200-24930222 CCGCGGGCGAGCTTCGGGGCGGG - Intronic
903907460 1:26696676-26696698 CGGCGGGCCCGGCGCGGAGCCGG + Exonic
907540880 1:55214901-55214923 CCGCGGGCCCCCGCCGGGCCCGG + Exonic
908703858 1:66930148-66930170 CAGCGAGCACGCGCCGGAGCAGG - Intronic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
1064274202 10:13891779-13891801 CCGAGGGCCCGCGGCGGGGGCGG - Intronic
1071309369 10:84328532-84328554 GCACGGGCCCGCGGCGGGGCGGG + Intergenic
1077049549 11:560678-560700 CCGCGGGCAGGCGTCGGGGTAGG - Exonic
1077368701 11:2171723-2171745 CCGCAGGGCCGTGTCTGAGCTGG - Exonic
1078266282 11:9758299-9758321 CCGCGCGCCCGGGTCGGGGCTGG - Intergenic
1083436321 11:62646151-62646173 CCGCGGCCCCTCGGCTGAGCTGG - Intronic
1083644919 11:64166408-64166430 GCTCGGCCCCGCGGCGGAGCAGG + Intergenic
1084030798 11:66479680-66479702 CCGCGGGCCCGCCTCTGCTCTGG + Intergenic
1084295735 11:68212876-68212898 CCGCCGGGCAGCGTCGGGGCCGG - Intronic
1084310205 11:68312473-68312495 CCGCGGGCGCCCCCCGGAGCCGG - Intergenic
1085332912 11:75668061-75668083 CGGCGGGCCCCGGCCGGAGCGGG - Exonic
1086424760 11:86672350-86672372 ACGCGGTCCCGCTGCGGAGCAGG + Exonic
1087038070 11:93773791-93773813 GCCCGGGCCAGCGTCGGGGCAGG + Intronic
1090780272 11:130001896-130001918 CCGTGGCACCGCGTCGGGGCTGG - Intronic
1096791393 12:54047350-54047372 CCGCGGGGCCGCTGCAGAGCCGG + Intronic
1098275685 12:68808787-68808809 CTGCGGGGCCGCTTCGGCGCGGG + Intronic
1098342958 12:69470561-69470583 CCGCGGGCCCGCGTCGGAGCTGG + Intronic
1101254715 12:102965750-102965772 TCCCGGGCCCGCGGGGGAGCAGG - Intergenic
1101612355 12:106303137-106303159 CTGCCGTCCCGCGTGGGAGCGGG + Intronic
1103595457 12:122022286-122022308 CCCGGGGCCCGCGGCGGGGCTGG - Intronic
1105247307 13:18665526-18665548 CCGAGGCCCCGCGGCGCAGCAGG - Intergenic
1105593316 13:21813596-21813618 CAGCGGGCCCAGGTCGGATCTGG - Intergenic
1112344367 13:98577320-98577342 CCGCGGGCGGGCGGCGGGGCCGG + Intronic
1114270610 14:21098196-21098218 CAGCGCGCCCGGCTCGGAGCAGG - Intronic
1122464889 14:101925276-101925298 CCGGGGCGCCGCGTCGGGGCCGG + Exonic
1122888511 14:104722228-104722250 CCACGGGCCCGGGTAGGGGCAGG - Intronic
1124743132 15:32315373-32315395 CCTCGGGGCCGCGCCGGGGCCGG - Intergenic
1125196821 15:37056831-37056853 CCGCGGGAGCGGTTCGGAGCTGG - Intronic
1128743662 15:70099210-70099232 CCGCGAGCCCGCGCGCGAGCCGG + Intergenic
1129612218 15:77070419-77070441 CCGCGGGGACGCTGCGGAGCCGG - Intronic
1129817237 15:78565694-78565716 CCGCGGTCCCGCGCGGGCGCGGG + Exonic
1132365128 15:101251573-101251595 CGGCGGGCCCGCGGCGGCGGCGG - Exonic
1132683297 16:1152626-1152648 ACGCGGGCCCGGGTCGGCGGAGG - Intergenic
1132683301 16:1152635-1152657 ACCCGGGCCCGCGTCGTAGTGGG + Intergenic
1132885336 16:2179812-2179834 CCGCCGACCGGCCTCGGAGCAGG - Exonic
1132934965 16:2475426-2475448 CCGCGGGCCAGCGACCGGGCGGG - Intronic
1135296454 16:21283697-21283719 CCGGGGGCGCGCGGAGGAGCCGG - Intronic
1135969188 16:27060064-27060086 CTGCAGGCCCGCTTCGGGGCAGG + Intergenic
1136498795 16:30659535-30659557 CCGCGGCCCCGGGTCCGGGCTGG + Exonic
1136535057 16:30894198-30894220 GGGCGGGCCCGGGTCGGGGCGGG - Exonic
1136779097 16:32885945-32885967 CCGCGGGCCCCGGTCGGGGCCGG - Intergenic
1136891520 16:33975573-33975595 CCGCGGGCCCCGGCCGGGGCCGG + Intergenic
1203081512 16_KI270728v1_random:1148033-1148055 CCGCGGGCCCCGGCCGGGGCCGG - Intergenic
1143247813 17:5500824-5500846 CCGCGGGCCCAGGTCGGCGTCGG - Intronic
1143831627 17:9656513-9656535 CCGAGGGCCGGTGTCGGAGAAGG + Exonic
1145077509 17:19867855-19867877 GCGCGGGGCCGCGGCGGTGCGGG - Exonic
1147336710 17:39730541-39730563 CCGCGGGCACGTGACGGGGCGGG + Exonic
1147879746 17:43646073-43646095 CCGGGGGTCCGCGTCCGATCCGG + Intronic
1148486664 17:47995278-47995300 CAGCTGGCCGGCGTGGGAGCCGG + Intergenic
1148744402 17:49910366-49910388 CCGCGGTGCCGCGTTTGAGCCGG + Intergenic
1151780295 17:76240724-76240746 CCGGGTGCCCGCGGCGGGGCGGG + Intergenic
1152383195 17:79952788-79952810 CCGCAGGCCGGCGTCGGAGCTGG + Exonic
1152654407 17:81513165-81513187 GGGCGGGGCCGCGCCGGAGCTGG + Intronic
1152817855 17:82418719-82418741 TCGCGGGACCGCGGCGGCGCAGG + Exonic
1152864902 17:82716720-82716742 CCGCGGACCCGCCCCGGATCTGG - Exonic
1154441532 18:14393595-14393617 CCGAGGCCCCGCGGCGCAGCAGG + Intergenic
1158404301 18:57147352-57147374 CCGCTGGCCCGGGTCGAGGCCGG - Exonic
1160566303 18:79788468-79788490 CCTGCGGCCCGCGGCGGAGCGGG - Intergenic
1160613871 18:80109483-80109505 GCGCGGGCCCGCGCCGGGCCGGG - Intronic
1160691051 19:460840-460862 CCGCGGCCCGGCGGCGGCGCGGG - Exonic
1161531404 19:4792157-4792179 CCGAGGCCCCGCGGCGCAGCAGG - Exonic
1162079407 19:8209447-8209469 CCGAGGGCCGGCGGCGGGGCTGG - Exonic
1162398344 19:10430749-10430771 CCGCGGGCCCGGGGCTGGGCAGG + Intronic
1162925967 19:13930655-13930677 CCTCTGGCCCGCCCCGGAGCAGG + Exonic
1164648101 19:29873618-29873640 GCGCGGGGCCGGGTCGGAGCGGG - Intergenic
1165879466 19:39032173-39032195 CCGGGTCCCCGCGCCGGAGCCGG - Exonic
1166782695 19:45350712-45350734 CCGCCGCCTCGCCTCGGAGCCGG - Exonic
1166858030 19:45792822-45792844 CCGCTGGCCCGCGCCGGAAAAGG + Intergenic
1166975121 19:46601343-46601365 GCGCGGACGCGCGGCGGAGCTGG + Exonic
1167577691 19:50325666-50325688 CCGCGCGCCCGGCTCGGAGGGGG - Intronic
926251096 2:11155790-11155812 CCGCGCGCCGGCGTCGCAGCTGG + Intronic
932779181 2:74549338-74549360 CCGCGGGCGCCGGGCGGAGCAGG - Intronic
933752437 2:85611703-85611725 TTGCGGGGCCGCGTCGGCGCGGG + Exonic
940971992 2:159904838-159904860 CCTCGGCCCCGGGGCGGAGCGGG + Intergenic
949004325 2:241636892-241636914 CCGCAGGGCCGGGTCGGGGCGGG + Intronic
1172618701 20:36306388-36306410 CCGCGGGCCGGAGCCGGGGCGGG + Exonic
1172662120 20:36574675-36574697 TGGCGGGCCCGCGCGGGAGCTGG + Intronic
1175215809 20:57391306-57391328 CCGCGCGCCCGGGGCGGGGCGGG + Intergenic
1176454528 21:6897580-6897602 CCGAGGCCCCGCGGCGCAGCAGG - Intergenic
1176832701 21:13762628-13762650 CCGAGGCCCCGCGGCGCAGCAGG - Intergenic
1178561541 21:33643015-33643037 CCGCGGCCCCGCCGCCGAGCGGG + Intronic
1181175417 22:21032244-21032266 CCGCGGCTCTGCGTCGGGGCGGG + Intronic
1181269803 22:21652419-21652441 CCGGGGGCCCTCTTTGGAGCAGG + Intronic
1181813712 22:25421155-25421177 CCGCGGGCGCGCGTCCCATCCGG + Intergenic
1182236868 22:28883350-28883372 CCGCGGGCGGGGGGCGGAGCTGG + Intergenic
1183296637 22:37033707-37033729 GAGCGGGCCCGCCTCGAAGCAGG - Intergenic
1183401782 22:37609075-37609097 CCGCTGGACCGCGCCGGGGCCGG - Intronic
1183829385 22:40409780-40409802 CCTCGGGCCTGCGTCTGAGGTGG + Exonic
1185128479 22:49024682-49024704 CCGTGGTGCAGCGTCGGAGCTGG + Intergenic
950345347 3:12287893-12287915 CCGCCTGCCCGCGGCGGAGCCGG - Intronic
950729823 3:14947758-14947780 CCGCGGGCTCGCGGGGCAGCGGG - Intronic
950902876 3:16513259-16513281 CCCCTGGCCCGCGTCGGATGGGG - Intronic
950902993 3:16513695-16513717 CGGCGGGGGCGCGTCGGGGCTGG - Exonic
953526155 3:43691337-43691359 CCGCGGGCCGGCGACGGAGCTGG + Intronic
954540705 3:51391541-51391563 TCGCGGGCCCGCGCTGGAACCGG - Exonic
956168348 3:66413255-66413277 CTGTGGGCCAGCCTCGGAGCTGG - Intronic
961016979 3:123475970-123475992 CCGCTGGCCCGAGTGGGGGCAGG + Intergenic
968258149 3:197297890-197297912 CCGCGGGCCCCGGGCGGGGCGGG - Intronic
968582270 4:1400663-1400685 CAGCGGACCCTCGTCGGAGTCGG - Intergenic
986330621 5:6713928-6713950 GGGCGGGGCCGCGTCGGGGCGGG + Intergenic
987374014 5:17217833-17217855 CCCCGGGTCCGCGGCGGCGCGGG - Intronic
987374228 5:17218589-17218611 CCCCGGGCCCGGGCCGGGGCCGG - Intronic
988437578 5:31194026-31194048 CTGCGAGCCCGGGTCGGGGCGGG + Intronic
992663737 5:78985403-78985425 CCGGGGGCCCGGGTCGGAGGCGG - Exonic
995571795 5:113488739-113488761 TCCCGGGCCCGCGTCGTTGCCGG - Exonic
999462970 5:151772377-151772399 CCGCGGGCGCGTGGCGGAGAGGG - Intronic
1001382266 5:171312401-171312423 CCGCGGGCCAGCGCCGGGGCGGG + Intergenic
1001573801 5:172748622-172748644 CCGCGCGTCAGCGACGGAGCAGG - Intergenic
1002184362 5:177447269-177447291 CTGTGGGCCCGCGTCGGGGGAGG - Intronic
1002591057 5:180291934-180291956 GGGCGGGCCGGCGGCGGAGCCGG - Exonic
1006717527 6:36130256-36130278 GCGCGGGCCAGCGGCGGGGCTGG - Intronic
1011708432 6:90026693-90026715 CCGCGTGCCCTCTTAGGAGCTGG - Intronic
1016820662 6:148343127-148343149 GCCCGAGCCCGCGCCGGAGCCGG + Exonic
1019422876 7:959102-959124 CCGGGGTCCCGCGTCGGGTCTGG - Intronic
1019492866 7:1323245-1323267 CCGCGGGCCCGCGAGTGGGCAGG - Intergenic
1019562540 7:1665799-1665821 GCCCGAGCCCGAGTCGGAGCCGG + Intergenic
1021716986 7:23469749-23469771 CCGCGGGCCGGAGTGGGAGCCGG + Intronic
1022102313 7:27175748-27175770 CCTCCGGCCCCAGTCGGAGCTGG + Intronic
1024579826 7:50792971-50792993 CTGCGGGCGCGCGGCGGAGGCGG - Intronic
1028641139 7:93043497-93043519 CCGCAGCCCAGCGCCGGAGCCGG + Intergenic
1034223059 7:149460356-149460378 CCGAGCGGCGGCGTCGGAGCTGG + Intronic
1034418723 7:150978182-150978204 GCGCGGGGACGCGGCGGAGCGGG - Exonic
1034440516 7:151083446-151083468 CCGAGGGGCCGCGATGGAGCTGG - Intronic
1035212118 7:157336589-157336611 CCGCGGTCCTGCGGTGGAGCTGG - Intronic
1044734943 8:95269318-95269340 CCGCGAGCCCTCGTGGGCGCCGG - Intergenic
1047615436 8:126558574-126558596 CCACGCCCCCGCGCCGGAGCGGG + Intergenic
1048981101 8:139703726-139703748 CCGCGCGCCCGGGTGGGCGCTGG - Intergenic
1049249424 8:141580359-141580381 CCACGGGCCCGGCTCTGAGCCGG + Intergenic
1049442133 8:142614388-142614410 CTGCGGGCCGGCGGCGGGGCCGG + Exonic
1049517314 8:143067595-143067617 GCGAGGACCCGCGTCGGCGCTGG + Intergenic
1049665439 8:143840797-143840819 TCCCGGGCCCGCCTCGGCGCCGG + Exonic
1049792356 8:144477950-144477972 CCGCGGTGCCCCGTGGGAGCCGG - Intronic
1051170110 9:14313318-14313340 TCGCGGGGCGGCGTGGGAGCCGG - Intronic
1054835652 9:69672546-69672568 CCGCGAGCCCGCGGCGGCGGCGG + Intergenic
1058348980 9:103999353-103999375 CCGCGGGCCGGCGGGTGAGCTGG + Intergenic
1059145548 9:111896680-111896702 CCGCGCGCCCGCTGCGGCGCCGG - Intergenic
1061129783 9:128702528-128702550 CCGCGGGCGCGCGGCGGGGAAGG + Exonic
1061262686 9:129488695-129488717 CCGCAGGCCAGCGTCGGGGCCGG - Intergenic
1062462026 9:136666106-136666128 CCGCGGCCCCTCGTCCGACCCGG + Intronic
1185508228 X:644318-644340 CCGGGGGCGCGGGGCGGAGCAGG + Intronic
1186200033 X:7147851-7147873 CCGCGGGCCCATGTCCGGGCTGG - Intronic
1187888037 X:23907545-23907567 CCGCGGGGCCGGGACGCAGCCGG + Intronic
1200100693 X:153688103-153688125 CCGCGGGCCCCGGCCGGGGCGGG + Exonic