ID: 1098342958

View in Genome Browser
Species Human (GRCh38)
Location 12:69470561-69470583
Sequence CCGCGGGCCCGCGTCGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098342944_1098342958 29 Left 1098342944 12:69470509-69470531 CCTCTCAGCACCTGGGCGGACGG 0: 1
1: 0
2: 1
3: 7
4: 116
Right 1098342958 12:69470561-69470583 CCGCGGGCCCGCGTCGGAGCTGG 0: 1
1: 0
2: 2
3: 9
4: 139
1098342947_1098342958 19 Left 1098342947 12:69470519-69470541 CCTGGGCGGACGGTGAGTGGCTA 0: 1
1: 0
2: 0
3: 4
4: 38
Right 1098342958 12:69470561-69470583 CCGCGGGCCCGCGTCGGAGCTGG 0: 1
1: 0
2: 2
3: 9
4: 139
1098342943_1098342958 30 Left 1098342943 12:69470508-69470530 CCCTCTCAGCACCTGGGCGGACG 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1098342958 12:69470561-69470583 CCGCGGGCCCGCGTCGGAGCTGG 0: 1
1: 0
2: 2
3: 9
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098342958 Original CRISPR CCGCGGGCCCGCGTCGGAGC TGG Intronic