ID: 1098343410

View in Genome Browser
Species Human (GRCh38)
Location 12:69474450-69474472
Sequence TGGCATCTGTTTAAAACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 368}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098343408_1098343410 25 Left 1098343408 12:69474402-69474424 CCAAGGGAGAATGTAGAGGGGAA 0: 1
1: 0
2: 7
3: 28
4: 271
Right 1098343410 12:69474450-69474472 TGGCATCTGTTTAAAACAGAAGG 0: 1
1: 0
2: 4
3: 38
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098343410 Original CRISPR TGGCATCTGTTTAAAACAGA AGG Intronic
900508725 1:3045575-3045597 TGGCATCTTCTTCAAATAGAAGG + Intergenic
900879059 1:5367454-5367476 TGGCTGCTGTTGGAAACAGAAGG - Intergenic
901157911 1:7152807-7152829 TGGCATCTGTATGAACCAGAGGG + Intronic
902145678 1:14396860-14396882 TGGAATCTGTCTTAAAAAGATGG - Intergenic
902418937 1:16262336-16262358 TTGAATTTGTTTAAAGCAGATGG + Intronic
904863084 1:33554488-33554510 TGGCATCTTCTTCAAATAGAAGG - Intronic
905144271 1:35875146-35875168 TGGCATCTTCTTCCAACAGAAGG - Intronic
905260949 1:36718719-36718741 TGGCATCTTCTTCCAACAGAAGG + Intergenic
905751228 1:40466269-40466291 TGGCAGCTGTTAAACAGAGACGG - Intergenic
906756432 1:48320940-48320962 TGTCATCAGTTTAAAACAAAGGG + Intronic
907365235 1:53953261-53953283 TGCCATCTGTATAACAAAGACGG - Intronic
908376716 1:63549990-63550012 TGGCATTTCTTCAAAACACAAGG - Intronic
908695923 1:66841676-66841698 TGGCATATGTAGAAAAGAGATGG - Intronic
909701584 1:78530371-78530393 TAGCATCTTTTTAAAAAAGTAGG - Intronic
909844097 1:80368695-80368717 TGGCATCTTCTTCCAACAGAAGG - Intergenic
909916055 1:81320961-81320983 TGGCATCTGTTTCCAATATAAGG + Intronic
910275523 1:85445478-85445500 TGGCATCAATTTAGGACAGACGG + Intronic
910731581 1:90403274-90403296 GGGCAGCTGTTTAAAACTGCAGG - Intergenic
911648452 1:100360259-100360281 TGTCATGTGTTCAAAACAGAAGG - Intronic
912316648 1:108673154-108673176 TGTCATCTGTTTAAAATAATGGG + Intergenic
912509395 1:110178118-110178140 TGTAATCTGTTAAAAACAGTTGG - Intronic
914696856 1:150091055-150091077 TGGTGTCAGTTTAACACAGAAGG - Intronic
914997774 1:152559850-152559872 TGGGCTGTGTGTAAAACAGATGG + Intronic
915002074 1:152602791-152602813 TGGGCTGTGTGTAAAACAGATGG - Intergenic
916341611 1:163743082-163743104 TGTCATCAGTTTAAAATAGTGGG - Intergenic
916420713 1:164635300-164635322 TGGTATCTGTTTTAAAAAGTGGG + Intronic
916728282 1:167543416-167543438 TGAAATCTGTTTCACACAGATGG - Intronic
917087059 1:171314246-171314268 TGGCTTTTGTTTTAAACTGAGGG + Exonic
917112120 1:171559251-171559273 TGGCATCTCCTTCCAACAGAAGG - Intronic
917115414 1:171598396-171598418 TGGCATCTGCTTCCAATAGAAGG - Intergenic
917185238 1:172346597-172346619 AGACTTCTGTTTTAAACAGAAGG + Intronic
917375436 1:174348216-174348238 TGTCATCAGTTTAAAATAGTGGG - Intronic
917788025 1:178480375-178480397 TGGCTTCAATTTAAAGCAGAAGG + Intergenic
919390969 1:196985392-196985414 TGGAGTCTTTTTAAAACAGCTGG + Intronic
919487822 1:198165811-198165833 TGGCATCTTTTTCAAATAGAAGG + Intronic
922635130 1:227160897-227160919 TGGAATCTGTGTAAATCAAAAGG - Intronic
922823352 1:228500107-228500129 TGGCATCTGCTTCTAATAGAAGG + Intergenic
923280917 1:232442055-232442077 TGGGATCTGGTTTAACCAGAGGG + Intronic
923716284 1:236427263-236427285 TGGCATCTGGTAAAATCAGAAGG - Intronic
923886395 1:238162406-238162428 TGGCATCAGTTTAAAATAATGGG - Intergenic
924168671 1:241313278-241313300 TGGCATCTTTTTCCAACAGAAGG - Intronic
924441993 1:244093924-244093946 TAGCATCTATCTAAAGCAGATGG - Intergenic
924495787 1:244587263-244587285 TTGAATCTGTTAAAAAGAGAAGG + Intronic
924499798 1:244626517-244626539 TGGCATCTTCTTCCAACAGAAGG + Intronic
924556662 1:245124623-245124645 AGGCTTTTGTTTAAAATAGATGG + Intronic
924572413 1:245249063-245249085 TGGCAGCTGTCTATAACAGGTGG + Intronic
1063788603 10:9413473-9413495 TGGCATCTTTTTACAATAGAAGG - Intergenic
1063876751 10:10486821-10486843 TGACATGTGTTAAAAGCAGAAGG + Intergenic
1064192025 10:13215043-13215065 TGGCATCTTCTTCCAACAGAAGG - Intergenic
1064328348 10:14371825-14371847 TGGCATCTGTTGGGCACAGAAGG - Intronic
1064950006 10:20837645-20837667 TGGCATCTTTTTCCAATAGAAGG - Intronic
1065817846 10:29498244-29498266 TTTCATCTTTTTAATACAGACGG - Intronic
1066686810 10:37989206-37989228 TTTCATATGTTTTAAACAGAAGG - Intergenic
1067165351 10:43862565-43862587 TGGCATTCGTTTCAAGCAGATGG + Intergenic
1067333037 10:45339333-45339355 TGGCATGTGCATAAGACAGATGG + Intergenic
1067706707 10:48611730-48611752 TGGCATCTGCTCAGAACAGTGGG - Intronic
1068081449 10:52322837-52322859 TGGCATCTTCTTCCAACAGAAGG - Intergenic
1068547772 10:58370102-58370124 TGGCAACTTATAAAAACAGAGGG - Exonic
1069212147 10:65775457-65775479 TGTCATGTGCTTAAAACATAAGG + Intergenic
1070657062 10:78278876-78278898 TGGGAGGTATTTAAAACAGAGGG - Intergenic
1071084690 10:81856006-81856028 TTGCATCTGTTTCAAATTGAAGG - Intergenic
1071614920 10:87066553-87066575 TGGCAAGTGTTTGGAACAGAAGG - Intronic
1073496460 10:103895981-103896003 TACCATCTGTGTGAAACAGAAGG + Intronic
1073598936 10:104827726-104827748 TGGCATCTTCTTCCAACAGAAGG + Intronic
1073637181 10:105211350-105211372 TGGAGTCTGTTTATAACAAATGG + Intronic
1074046864 10:109847295-109847317 GGGCCTCTGTTTTAAAAAGAAGG + Intergenic
1075188202 10:120282402-120282424 TGGCATCTTCATACAACAGATGG + Intergenic
1075193391 10:120332203-120332225 TGGCATCTCCTTTCAACAGAAGG - Intergenic
1079799900 11:24855394-24855416 AGGCATATGTTTAACCCAGAGGG + Intronic
1080563961 11:33491152-33491174 AGTCATCTGTTTAAAACACATGG - Intergenic
1082646014 11:55726597-55726619 TTGCAACTGTGTAAAGCAGAGGG - Intergenic
1083047454 11:59749565-59749587 TGGCATGTGTTTAGAGCAGCGGG - Intronic
1083784755 11:64937665-64937687 TGGCTTCTGTTTAAAGCATTTGG + Intronic
1085211104 11:74779501-74779523 TTGCATTTGTTTAAGACAGTCGG + Intronic
1085367122 11:75959258-75959280 TGGCATCTTATTTCAACAGAAGG + Intronic
1086012978 11:82127674-82127696 TGGAATTTCTTTAAAAAAGAAGG - Intergenic
1088788125 11:113200974-113200996 TGTCATCTGTGAAAATCAGAGGG - Intronic
1090210142 11:124914504-124914526 TGTCATCAGTTTAAAACAACAGG - Intergenic
1090222092 11:125035791-125035813 TGTCATCAGTTTAAAACAACAGG - Intronic
1090269766 11:125378037-125378059 GGGCATCTGTTTACCGCAGATGG - Intronic
1091411528 12:243411-243433 TGTTATGTGTTTAAAACATATGG + Intronic
1091818964 12:3460129-3460151 TCGCTTATGTGTAAAACAGAGGG - Intronic
1092142373 12:6192715-6192737 ATGCATCTGTTTAAAAGAGTTGG - Intergenic
1092681138 12:10982345-10982367 TGGCCTCTGTCAAAACCAGATGG + Intronic
1092966105 12:13644620-13644642 TGGCATCTTTTTCCAATAGAAGG + Intronic
1094697911 12:32839972-32839994 TGGCATCTGGTGAGATCAGAAGG - Intronic
1095339471 12:41072138-41072160 TGACAACAGTTTAAAACTGATGG - Exonic
1096944206 12:55386127-55386149 TTGCATCTGGTTACAGCAGAGGG - Intergenic
1098167195 12:67710680-67710702 TGGAACCTGTGAAAAACAGACGG + Intergenic
1098333506 12:69378588-69378610 TGTCATCAGTTTAAAACAACGGG - Intronic
1098343410 12:69474450-69474472 TGGCATCTGTTTAAAACAGAAGG + Intronic
1098476978 12:70916292-70916314 TGGCATCTTCTAGAAACAGAAGG + Intronic
1098504139 12:71229230-71229252 TGTCATCAGTTTAAAACAATGGG + Intronic
1099422624 12:82481555-82481577 TGACAACTGTTTAAAACATAGGG - Intergenic
1099466253 12:82991597-82991619 TGACATCTCTTTAAAATATATGG + Intronic
1099637883 12:85238828-85238850 TGTCATCTGTGAAAATCAGATGG - Intronic
1100044419 12:90361272-90361294 TGGCATCTGTTAGAGACTGAAGG + Intergenic
1101180127 12:102207255-102207277 TGGCATATCATAAAAACAGAAGG - Intergenic
1102435133 12:112916886-112916908 AGGTAGGTGTTTAAAACAGATGG - Intronic
1103579484 12:121903632-121903654 TGTCACCAGTGTAAAACAGAAGG - Intronic
1103765035 12:123273697-123273719 TGGCATCATTTTAAAACTGTTGG + Intergenic
1104520684 12:129472136-129472158 TGGCATCTTCTTCCAACAGAAGG - Intronic
1104597601 12:130130753-130130775 TAGCAAGTGTTTAAAAGAGATGG + Intergenic
1105597631 13:21854284-21854306 TGGAAGCACTTTAAAACAGATGG - Intergenic
1105951996 13:25237204-25237226 TTGGATCAGTTAAAAACAGAGGG + Intergenic
1106752429 13:32788757-32788779 TTGCAACTGTTGAAAACAGGAGG + Intergenic
1107068795 13:36246762-36246784 TTGCATCTTTTTCCAACAGAAGG - Intronic
1107258687 13:38463480-38463502 TGGCAGCTGTGTAAATCAGCAGG + Intergenic
1108401086 13:50044136-50044158 TGGCATTTCTTCAAAACACAAGG + Intergenic
1109254651 13:60064306-60064328 TGGCATCTTTTTCAAATATAAGG + Intronic
1110925727 13:81149135-81149157 TTGCATTTGTTTATAACAAATGG - Intergenic
1111340792 13:86882849-86882871 TAACATCTGTTGAAATCAGAAGG + Intergenic
1113695087 13:112339881-112339903 TGGCATCTTCTTGCAACAGAAGG - Intergenic
1113979697 13:114264240-114264262 TGAGATCTGATTAATACAGAAGG + Intronic
1114782572 14:25554756-25554778 TGGCTTCTGTTCAATAGAGATGG + Intergenic
1115180609 14:30621786-30621808 TCGCATCTCTTTAAAAAAAAAGG - Intergenic
1115451707 14:33555419-33555441 TGGCGCCTGTTGAAAACAGTGGG + Intronic
1115468548 14:33743689-33743711 TGGCATCTTCTTCCAACAGAAGG + Intronic
1115486863 14:33918929-33918951 TGGCATCTTCTTCCAACAGAAGG - Intergenic
1115502647 14:34063117-34063139 TGGGATCTTTTGATAACAGATGG + Intronic
1116889344 14:50252193-50252215 TGTCATCAGTTTAAAATAGTGGG + Intronic
1117563880 14:56973792-56973814 TTGCATCAGTTTAAAACATCGGG - Intergenic
1117964576 14:61193691-61193713 GGTCATTTGTTTACAACAGAAGG + Intronic
1118124447 14:62884707-62884729 TGCCAGCTGTTAAAAAAAGAAGG + Intronic
1118527068 14:66657459-66657481 TGGCATCTTCTTACAGCAGAAGG - Intronic
1119075257 14:71631747-71631769 TGTCATTTTTTTAAAACAGTTGG + Intronic
1119222349 14:72919259-72919281 TTGCAAATGTTTAACACAGAGGG + Intergenic
1119569072 14:75654167-75654189 TGGCATCTGGGGAAAACAGGAGG - Intronic
1120741684 14:88115775-88115797 AGCCATCTGTTTAAGTCAGAAGG + Intergenic
1120812200 14:88815491-88815513 TGGCATCTGTTTAAATGCGTAGG - Intergenic
1121165626 14:91794358-91794380 TGGCATCTTCTTCCAACAGAAGG - Intronic
1121738250 14:96233908-96233930 AGGCATCTGTTTAAAAAATCAGG + Intronic
1121969263 14:98341621-98341643 TGGAGTATGATTAAAACAGATGG - Intergenic
1124083318 15:26521257-26521279 TGTAATCTGTTTCCAACAGAGGG - Intergenic
1124666009 15:31593502-31593524 TGGCCTATGTTTAAAACAACTGG + Intronic
1125266496 15:37887361-37887383 TTGGATCTCTTGAAAACAGATGG - Intergenic
1125418654 15:39479661-39479683 TGCCATCTGTTTTAAATAGCAGG - Intergenic
1125870559 15:43097499-43097521 TGGCATCTTCTTCCAACAGAAGG + Intronic
1126784892 15:52169720-52169742 TGGGATCTAATTAAAACAAAGGG + Intronic
1127098578 15:55538013-55538035 TGCTATATGTTTAAAACAGAGGG + Intergenic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1127757468 15:62106757-62106779 TGGCATCTTTTTCAAATAGAGGG - Intergenic
1128722628 15:69962232-69962254 TGGCATCTTCTTCCAACAGAAGG - Intergenic
1129887911 15:79051635-79051657 TGGTCTGTGTTTAAAACTGATGG + Intronic
1131527694 15:93165767-93165789 TGGCATTTGTTTAAATGAGGGGG - Intergenic
1133596627 16:7299964-7299986 TCACATTTGTTTAATACAGATGG - Intronic
1137804776 16:51294604-51294626 TGGCATCTTCTTACAATAGAAGG + Intergenic
1138626532 16:58256413-58256435 TGGCATCTGTTTAAAGCACAGGG + Intronic
1141561676 16:84872554-84872576 TTGCATATGTTTAAAGCAGGTGG + Intronic
1146148382 17:30443475-30443497 TGGCATTTTTTAAAAACAGAAGG - Intronic
1150310835 17:64128626-64128648 TGGCATCTGTTCACAAACGAAGG - Intronic
1150509301 17:65732551-65732573 TGGCATCTTCTTCCAACAGAAGG + Intronic
1151377585 17:73701345-73701367 TGGCATCTTCTTCCAACAGAAGG + Intergenic
1153270581 18:3317214-3317236 TGGCATCTTCTTCCAACAGAAGG + Intergenic
1153588405 18:6647515-6647537 TGACATTTGTTTAAAACCGTAGG + Intergenic
1153739009 18:8103298-8103320 TGGCATCTGCTTCCAATAGAAGG + Intronic
1154128976 18:11719475-11719497 TGGCATTTTATTCAAACAGAGGG + Intronic
1156480648 18:37434469-37434491 TGGCCCCTGTCTAAAACAGGGGG + Intronic
1156572460 18:38273407-38273429 TGTCATCTGTTTAAAATAATGGG - Intergenic
1157224077 18:45847039-45847061 TGGCAGCTTTTTAAACCAGATGG - Intergenic
1159550685 18:69893231-69893253 TTGCAACTGTTCAAAACACATGG + Intronic
1159587709 18:70297117-70297139 TGCTATTTGTTTAAAAAAGAGGG - Intronic
1166949568 19:46417501-46417523 TTGCATTTGTTTAAAATAAATGG + Intergenic
1167021726 19:46881808-46881830 TGGCATCTTTTTCCAACATAAGG + Intergenic
925940913 2:8817104-8817126 TGGCATCTGGTTAAAGCATAAGG - Intronic
926229234 2:10990295-10990317 TGGCATCTTGTTTAAACAGATGG + Intergenic
926450029 2:12991861-12991883 TGGCATATTTATACAACAGAAGG - Intergenic
927107626 2:19841555-19841577 TGGAATCTGTTTAAATGAGCTGG + Intergenic
927381329 2:22482361-22482383 TGGCTTCTGTTTAAAATACGAGG - Intergenic
928293781 2:30063459-30063481 TGTCATCAGTTTAAAATAGTGGG + Intergenic
929529072 2:42734768-42734790 TGGCATCAGTTTAAAATAACAGG - Intronic
930535522 2:52641374-52641396 TGCCATCTTTCTAAAACTGAAGG + Intergenic
932697271 2:73967441-73967463 TGGCAGATGTTTACTACAGATGG + Intergenic
932889759 2:75582307-75582329 TGTCATCAGTTTAAAATAGTGGG + Intergenic
933332982 2:80918662-80918684 TGTCATCTGTTTAAAGTAGTGGG - Intergenic
936409660 2:112245782-112245804 TGGCATCTTTTTCCAACATAAGG - Intronic
936543164 2:113368549-113368571 AGGGATCTTTTTAAAATAGATGG - Intergenic
937649715 2:124306542-124306564 TGGCACCTGCTTCACACAGATGG + Intronic
938177672 2:129150879-129150901 TGTCATCACTTTAAAATAGAAGG - Intergenic
938737799 2:134202278-134202300 AGGCCTCTGATTAAATCAGAGGG + Intronic
939224861 2:139352341-139352363 TGACATCTGTTTGAAAAAAATGG - Intergenic
940855704 2:158727066-158727088 TGGCCACTCTTTAAAACATAAGG + Intergenic
941433942 2:165445063-165445085 TGGCATCTTCTTCCAACAGAAGG - Intergenic
941879716 2:170468848-170468870 TGGCAAATGTCTAAAACATAGGG + Intronic
942184563 2:173412514-173412536 TCCCATATGTTTAAAACAGAAGG - Intergenic
942281536 2:174369076-174369098 TGGCATCTTTTTCCAATAGAAGG + Intronic
942852547 2:180506678-180506700 TGGCACTTCTTTAAAAGAGAAGG + Intergenic
942941848 2:181627858-181627880 TGCCATCTGTTAAGAAAAGATGG - Intronic
943200311 2:184814734-184814756 TGGCATCTTTTTAAAACGTGGGG + Intronic
943529930 2:189066492-189066514 TGGCCCCTGTTAAAAACAGAAGG + Exonic
943531716 2:189090521-189090543 TGGCATCTTCTTCCAACAGAAGG - Intronic
943634246 2:190287851-190287873 TGGCTTTTGTTTAAAATCGAAGG - Intronic
944990281 2:205227904-205227926 TGTCATCAGTTTAAAATAGTGGG - Intronic
945320790 2:208420769-208420791 TGGAATCTGCATAAGACAGAGGG - Intronic
945939139 2:215930926-215930948 TGGCAAATTTTTAAAACAAAAGG - Intergenic
947020679 2:225672179-225672201 TGGCATCTTCTTCCAACAGAAGG + Intergenic
947439481 2:230106581-230106603 TGCCATCTGTTTAAAATAGTGGG - Intergenic
947555488 2:231089320-231089342 TGGCATCTTCTTCAAATAGAAGG - Intronic
948983021 2:241504501-241504523 TGGCTTCTCTTTAGAACACATGG - Intronic
1170210859 20:13845207-13845229 TGACCTCTGTTTAACACAGGAGG - Intergenic
1170362417 20:15560866-15560888 TGGTTTATGTCTAAAACAGAAGG + Intronic
1170403752 20:16014589-16014611 TGGCTTCTGTTGAACCCAGATGG - Intronic
1170642758 20:18170233-18170255 TGGCATCTTCTTCAAATAGAAGG - Intronic
1173248246 20:41350602-41350624 TGGGAGCTGTTTAAACCAGGTGG + Intronic
1173772479 20:45674042-45674064 TGGCATCTTCTTCCAACAGAAGG + Intergenic
1174444641 20:50582474-50582496 TGGCATCTGAGTACATCAGATGG + Intronic
1174764938 20:53244653-53244675 TGACAAATGTTTAAAGCAGAAGG - Intronic
1175747796 20:61472594-61472616 TGTCATCAGTTTAAAATAGTGGG - Intronic
1177540138 21:22481840-22481862 TGGCATCTTCTTCCAACAGAAGG - Intergenic
1178967570 21:37136770-37136792 TGGCATCTTCTTCCAACAGAAGG - Intronic
1183277729 22:36911422-36911444 AGGCATCTGTTTCAAACTGGAGG + Intergenic
1183764482 22:39858928-39858950 TGGCATCTTTTTCCAACAAAAGG + Intronic
949984586 3:9530223-9530245 TGGCATCTTCTTCCAACAGAAGG + Intronic
950895651 3:16448322-16448344 ATGCATCTGTTTAAAACAAAAGG - Intronic
951242431 3:20302826-20302848 TTGCATCTGTTTAATATACAGGG + Intergenic
952368936 3:32700927-32700949 AGGCATCTTTTAAAAACAAATGG + Intronic
954469492 3:50679933-50679955 TCTCATCTGTTTAAAAAAGAGGG - Intronic
955604190 3:60682301-60682323 TGGCATCTTCTTCCAACAGAGGG - Intronic
956057647 3:65317620-65317642 TGGCAGCTTGTTAAAGCAGACGG - Intergenic
956805687 3:72808832-72808854 TAGCATCTCTTTAAAATAAAGGG - Intronic
957093646 3:75757200-75757222 TGGCATCTCCTTCTAACAGAAGG - Intronic
957296827 3:78343684-78343706 AGGCAACTGTTCAAAACAAAAGG - Intergenic
957782967 3:84843507-84843529 TGGCATCTTCTTCAAATAGAAGG - Intergenic
957928824 3:86850660-86850682 TGGCATCTTCTTCCAACAGAAGG - Intergenic
958844677 3:99252207-99252229 TGGCATCTTTTTCATACAAAGGG - Intergenic
958936159 3:100258183-100258205 TAGCATTTGTTAAAAAGAGATGG - Intergenic
959255208 3:104002127-104002149 TGACATGTGTTAAAAACAGTAGG + Intergenic
960002710 3:112749607-112749629 TGGGATCTGTTTGGAAAAGATGG - Intronic
960245703 3:115398255-115398277 TACCATCTCTTTAAAAGAGATGG + Intergenic
960549294 3:118955903-118955925 TGGCATTTTCTTCAAACAGAAGG + Intronic
962584561 3:136828949-136828971 TGTCATCAGTTTAAAATAGTGGG - Intronic
963946407 3:151150635-151150657 TGGCATCTTCTTCCAACAGAAGG + Intronic
964398776 3:156276502-156276524 TGGCATCTTCTTACAAAAGAAGG + Intronic
965384045 3:168024589-168024611 TGCCATCTGTTGGAAACAAAAGG + Exonic
965424471 3:168504639-168504661 TGGCATCTTTTTCTAAAAGAAGG + Intergenic
965514444 3:169605791-169605813 TGGCTTCTGTTTAAAAAAGTTGG - Intronic
965633067 3:170752932-170752954 TGGCATCTGTTCAGGAAAGAGGG - Intronic
965726171 3:171718932-171718954 AGGTATCTTTTTAAAACAGACGG - Intronic
966995778 3:185278719-185278741 TGGCATCTTCTTAAAATAGGAGG + Intronic
967399791 3:189048566-189048588 TGGCATCTTTTTCCAATAGAAGG + Intronic
968017057 3:195345890-195345912 TGCCATATATTTAACACAGATGG + Intronic
969959297 4:10927365-10927387 TTCCATCTGTTTAATACAAATGG - Intergenic
970776797 4:19684142-19684164 TGGCAACTATTTAAAACAAAAGG - Intergenic
971191009 4:24429259-24429281 TTGCATGTGTGTGAAACAGAGGG - Intergenic
974980294 4:68948112-68948134 TGGCATCTTCTTCCAACAGAAGG + Intronic
975413714 4:74084260-74084282 TGAGATCTGTTTAAAATAAATGG + Intergenic
975686455 4:76920539-76920561 TGGCATCTTCTTCCAACAGAAGG + Intergenic
976453717 4:85221436-85221458 TGTCATCAGTTTAAAACAATGGG - Intergenic
976842668 4:89450231-89450253 TGGTTTCTCTTTAAAACAGCAGG + Intergenic
977337810 4:95720212-95720234 TAGCATTTGAATAAAACAGATGG - Intergenic
977384833 4:96325665-96325687 TGGTATCTGCAGAAAACAGAGGG + Intergenic
977889247 4:102288992-102289014 TGGCATCTTCTTCCAACAGAAGG - Intronic
977981209 4:103324595-103324617 TGGCATCTTCTTCTAACAGAAGG + Intergenic
979305614 4:119139653-119139675 TGGCATCTGTTTAGAAATGCTGG + Intronic
979326686 4:119388662-119388684 TGGCATTTGTTTAAAATATAAGG - Intergenic
980146284 4:128988408-128988430 TGTCATCAGTTTAAAACAATTGG + Intronic
980719616 4:136677719-136677741 TGGCATCTTTTTCAAATACAAGG + Intergenic
982153469 4:152491139-152491161 TGGCATCTGATAAAAACAAGGGG - Intronic
982197389 4:152930056-152930078 AGGCATCTGTTTCACACAGTTGG - Intergenic
982247792 4:153371381-153371403 TGGCATCTTTTTCCAACAGAAGG + Intronic
982597900 4:157407943-157407965 TGGCCTGTGCATAAAACAGATGG - Intergenic
982716002 4:158808901-158808923 TGGCCACAGTGTAAAACAGACGG + Intronic
983073708 4:163299306-163299328 TGGCATCTTTTTTCAATAGAAGG + Intergenic
983244553 4:165273311-165273333 TGGCATTTGTTTAAAATATAAGG - Intronic
983594220 4:169448368-169448390 TGTCATCAGTTTAAAATAGTGGG + Intronic
984201691 4:176729257-176729279 TGGAAAATTTTTAAAACAGATGG - Intronic
985070306 4:186161028-186161050 TAGCATCTGATTATAACAAAAGG - Intronic
985168798 4:187126389-187126411 TTGCATTTCTTTAAAACACACGG - Intergenic
986525316 5:8667826-8667848 TGGTATCTGGTTAAAAAAGAAGG - Intergenic
987529428 5:19098272-19098294 TGGCATCTTTTTCCAATAGAAGG - Intergenic
987623222 5:20363681-20363703 TGGGATCTGTTGTAAACTGATGG - Intronic
989324634 5:40177554-40177576 TGGCATCTTTTTATAATGGAAGG + Intergenic
990191617 5:53266133-53266155 TAGCATTTGTTTTAAACACAGGG + Intergenic
990426078 5:55690529-55690551 TGACATCAGTGTTAAACAGATGG - Intronic
991729966 5:69576148-69576170 TGGCATCTCCTTCCAACAGAAGG - Intronic
991806400 5:70431291-70431313 TGGCATCTCCTTCCAACAGAAGG - Intergenic
991864988 5:71051715-71051737 TGGCATCTTCTTCCAACAGAAGG + Intronic
992271323 5:75066428-75066450 TGGCATCTTCTTCCAACAGAAGG - Intergenic
992820889 5:80494844-80494866 TGGCATCTTCTTACAATAGAAGG - Intronic
993010299 5:82474882-82474904 TGGCATGTGTTAAAAAATGAAGG - Intergenic
994010717 5:94899194-94899216 TGACATCTGTTTTATACTGATGG + Intronic
995079399 5:108030798-108030820 TGGCAGGTGTTTGAAAGAGATGG + Intronic
995505731 5:112859004-112859026 TGGCATCTTTTTCCAATAGAAGG + Intronic
995971682 5:117979494-117979516 TGTCATCAGTTTAAAATAGGTGG - Intergenic
996067373 5:119094144-119094166 TGGCATCTTCTTCCAACAGAAGG - Intronic
996072888 5:119154775-119154797 TGGCATCTTCTTCCAACAGAAGG - Intronic
996261700 5:121478961-121478983 TGTCATATGTTTATAACAGAAGG - Intergenic
996419166 5:123242623-123242645 TAGCAGCTGTTTTAAAAAGATGG - Intergenic
996482893 5:123995414-123995436 TGGCATCTTTTTCAAATAGATGG + Intergenic
996815865 5:127571835-127571857 TTTCATCTGTTTTAAACTGATGG - Intergenic
996933453 5:128919393-128919415 TGGCATTTTGTTAAAATAGAGGG - Intronic
998154591 5:139777351-139777373 TGGCATCTGTTTGCAACAAGAGG - Intergenic
999230660 5:150060019-150060041 TTCCATTTGTTTAAAACAGATGG + Intronic
999230661 5:150060021-150060043 AGCCATCTGTTTTAAACAAATGG - Intronic
1000129330 5:158280388-158280410 TGGCATCTTCTTCCAACAGAAGG - Intergenic
1000793284 5:165632978-165633000 TGGCATCTGTTAAAATGATAAGG - Intergenic
1000820706 5:165979700-165979722 GGACAACAGTTTAAAACAGAAGG - Intergenic
1000828396 5:166074273-166074295 AGGCATTTCTTTAAAACAGCAGG + Intergenic
1000831601 5:166108943-166108965 TGGCATCTTCTTCCAACAGAAGG + Intergenic
1003822937 6:9920415-9920437 TGGCATCTTCTTCCAACAGAAGG - Intronic
1004306001 6:14502420-14502442 TGGCATCTCTGCAACACAGAAGG + Intergenic
1004523015 6:16380177-16380199 TGGCTTCTGTTCTAAGCAGAGGG - Intronic
1005345123 6:24881771-24881793 TGGTGTCTGTTTAAATTAGAAGG + Intronic
1005759384 6:28953886-28953908 AGGTATTTTTTTAAAACAGACGG - Intergenic
1009387345 6:63101328-63101350 TGGCATCTTTTTCCAATAGAAGG + Intergenic
1009847137 6:69148349-69148371 TGTCATCAGTTTAAAACAATGGG - Intronic
1009984258 6:70764353-70764375 TGGCATCTTCTTCCAACAGAAGG - Intronic
1010769354 6:79811037-79811059 TGAAATCTGTTTAACCCAGATGG + Intergenic
1011359524 6:86508622-86508644 TGGCATCAGTTTAAAATAATGGG - Intergenic
1012472297 6:99585877-99585899 TGGCATCTTTTTCCAATAGAAGG + Intergenic
1012800625 6:103822387-103822409 TGTCATCAGTTTAAAACAATGGG + Intergenic
1013613287 6:111816190-111816212 TGGCATCTATTGAAAACAAAAGG + Intronic
1013651839 6:112202924-112202946 TGTCATCTGTTTGAAACAGCAGG - Intronic
1013753444 6:113433924-113433946 TGAATTCTGTTTATAACAGAAGG - Intergenic
1013823811 6:114186719-114186741 TGGCATCTTTTTCCAATAGAAGG - Intronic
1013943634 6:115695971-115695993 TGGCATCTTTTTTCAATAGATGG - Intergenic
1013962625 6:115918725-115918747 TTGCCTCTGTTAAAATCAGAAGG + Intergenic
1014710425 6:124800217-124800239 TGGCATCTCATAGAAACAGAAGG + Intronic
1014809903 6:125873404-125873426 TGATGTATGTTTAAAACAGATGG + Intronic
1015059857 6:128950144-128950166 TGGCATCTTTTTGAAACAGAGGG + Intronic
1015263929 6:131269917-131269939 TGAGATGTGTCTAAAACAGAGGG + Intronic
1015746469 6:136514982-136515004 TGGCATCTTCTTCCAACAGAAGG + Intronic
1016163091 6:140906605-140906627 TTGCATCTGCTTAAAATAGCAGG + Intergenic
1017285146 6:152666185-152666207 TGTCATCAATTTAAAATAGATGG - Intergenic
1018250533 6:161865466-161865488 TGGCATCTTTTTACAACAGAAGG + Intronic
1018530318 6:164756116-164756138 TGGCATCTTTTTGAAATATAAGG + Intergenic
1018818319 6:167352557-167352579 TGGCATCTTCTTCCAACAGAAGG - Intronic
1019066513 6:169304542-169304564 TGGCATCAGTTTAAAATAATTGG + Intergenic
1020219691 7:6226163-6226185 TGGCTTCCTTTTAAAACTGAAGG + Intronic
1021884645 7:25126494-25126516 TGTCATCAGTTTAAAACAATGGG - Intergenic
1022279865 7:28896712-28896734 TGGCATCTTTTTCCAACAGAAGG + Intergenic
1023514748 7:40990632-40990654 TGGCATCTTCTTCCAACAGAAGG + Intergenic
1026736251 7:72950437-72950459 TGGCATCTCTGTAAAATAGTAGG + Exonic
1026786590 7:73305340-73305362 TGGCATCTCTGTAAAATAGTAGG + Intronic
1027107480 7:75414625-75414647 TGGCATCTCTGTAAAATAGTAGG - Intergenic
1027405127 7:77852431-77852453 TGTCATCAGTTTAAAACAATGGG - Intronic
1027490345 7:78816435-78816457 TGGCATCTTCTTCAAATAGAAGG - Intronic
1027990124 7:85347812-85347834 GGGCATCTGTGAAAATCAGAGGG + Intergenic
1028403702 7:90453303-90453325 TGCCATCTGTATAAGGCAGAGGG + Intronic
1028408562 7:90502984-90503006 TGGCATCTTTTTCCAACAGAAGG + Intronic
1029594829 7:101531983-101532005 AGGCATCTGTTTAACAGTGATGG + Intronic
1031707608 7:125000706-125000728 TGGCATCTGTTTTTAAGAAAAGG + Intergenic
1031900006 7:127398335-127398357 TGGGATCTGCTTAGAATAGATGG - Intronic
1033376613 7:140767511-140767533 TGCCATCTCTTTAAGACAGTTGG - Intronic
1034404507 7:150893607-150893629 TGGCATCTTCTTCCAACAGAAGG - Intergenic
1039032779 8:33327967-33327989 TGGCCTCTGCTTATAATAGAAGG - Intergenic
1039390592 8:37177855-37177877 TTGCATCTGTTTTAATCAGGAGG + Intergenic
1040685768 8:49871001-49871023 TGGCATCTTCTTTCAACAGAAGG + Intergenic
1041292946 8:56324368-56324390 TCACATGTGTGTAAAACAGATGG + Intergenic
1041309679 8:56502719-56502741 CGGCTTCTGCTTCAAACAGAGGG + Intergenic
1041540917 8:58984041-58984063 TGACATTTGTTTAAAAAATATGG - Intronic
1041727514 8:61031837-61031859 TGGCATATGTTTTAAATAAAAGG + Intergenic
1041872435 8:62649877-62649899 TTGCAGTTGTTTAAAATAGATGG - Intronic
1042662955 8:71175930-71175952 TGACATATGTTTAAGAAAGATGG + Intergenic
1043687400 8:83105015-83105037 AGGCATCTGTTACAAACAGGTGG - Intergenic
1043914739 8:85908651-85908673 TGGCAGCTGTTTAAAAGAGAAGG - Intergenic
1044633268 8:94299306-94299328 TGGCATCTGCAGAAGACAGATGG - Intergenic
1045571528 8:103372495-103372517 TTGCTTCTGTTTAAACCAAATGG + Intronic
1046002293 8:108435531-108435553 TGGCATCTGGGTAAAAAAGGAGG + Intergenic
1047260518 8:123254781-123254803 TGGCATGTCTGTAAAATAGATGG + Exonic
1047425070 8:124737863-124737885 TGTCAACTGTTACAAACAGATGG - Intergenic
1047902010 8:129432724-129432746 TGTCATCTGTTTAAAATAATGGG + Intergenic
1047911082 8:129530030-129530052 TTGCAGCTTTTTAAAAGAGAAGG - Intergenic
1048853152 8:138663436-138663458 GGGCATCTTTTCAACACAGAAGG - Intronic
1048968008 8:139628067-139628089 TGGCCTCCGTTTGAGACAGATGG - Intronic
1050349542 9:4727301-4727323 TGGCATCTTTTTCCAATAGAAGG + Intronic
1050437214 9:5623813-5623835 TGGCATCTTATTCCAACAGATGG + Intergenic
1050592433 9:7174235-7174257 TGACATTTGTCAAAAACAGAGGG + Intergenic
1051326482 9:15976484-15976506 AGGCATCTTTTTAAAACTGTAGG - Intronic
1055181008 9:73386783-73386805 TGTCATCTGTTTAAAATAATGGG - Intergenic
1055402357 9:75937646-75937668 TGGCATCTTCTTTCAACAGAAGG + Intronic
1055611433 9:78030146-78030168 TGCTATCTGTTTTAAACAAAAGG + Intronic
1055677252 9:78676779-78676801 TGGAATCTGCTTAAAAGGGATGG - Intergenic
1056053347 9:82793606-82793628 TGGCATCTGCTTAAAGTAGAAGG + Intergenic
1056260648 9:84844529-84844551 TGTCAGCTGTTTATAACAGAAGG - Intronic
1058184746 9:101841114-101841136 TGACATCTGGTGAAATCAGAAGG - Intergenic
1058285798 9:103176613-103176635 TGGCATCTTTTTCCAATAGAAGG + Intergenic
1058920144 9:109606308-109606330 TGGCATCTTCTTCCAACAGAAGG - Intergenic
1059134075 9:111786793-111786815 TGGCATCTTCTTCTAACAGAAGG - Intronic
1060207051 9:121688309-121688331 TGACATCTGTTTCTAACACAAGG + Intronic
1061786689 9:133033221-133033243 TGGCATCTGTATAAACACGAGGG + Intronic
1188705340 X:33321724-33321746 TGGCATCTTCTTCAAATAGAAGG + Intronic
1188867771 X:35335036-35335058 TGGTATTTGTTGAAAATAGATGG - Intergenic
1189263648 X:39696565-39696587 TGGCATCTTTTTCCAATAGAAGG + Intergenic
1189827882 X:44938668-44938690 TGGCATCTTCTTCCAACAGAAGG - Intronic
1189923138 X:45923332-45923354 TGGCATCTTCTTCCAACAGAAGG - Intergenic
1190171918 X:48118025-48118047 TGGCATCTGCTTCCAATAGAAGG + Intergenic
1190587943 X:51965670-51965692 TGTCATCTGTTTAAAATAGTGGG - Intergenic
1191191804 X:57675831-57675853 TGACATCTGGTAACAACAGAGGG - Intergenic
1191786256 X:64919876-64919898 TGCCAGCTTGTTAAAACAGAAGG - Intronic
1191945411 X:66529182-66529204 TGTCATCAGCTTAAAAAAGAAGG - Intergenic
1192084500 X:68082851-68082873 TGGCATCTTCTTCCAACAGAAGG + Intronic
1192159407 X:68771879-68771901 TGGAATGTGTTTAATACAGTTGG - Intergenic
1192304192 X:69941995-69942017 TGCCATCAGTTTAAAATAAATGG - Intronic
1192970459 X:76222926-76222948 TTTCATCTGTTTTAAAAAGAGGG - Intergenic
1193652143 X:84149912-84149934 TGGCATCTTCTTCCAACAGAAGG + Intronic
1193874919 X:86850420-86850442 TGGCATCTAATTAAAACAAAAGG - Intergenic
1194587536 X:95754567-95754589 AGGCATTTGTTTAGAACAGCTGG - Intergenic
1194764267 X:97830811-97830833 GGGCATCTGGGTAAAAAAGATGG - Intergenic
1196199080 X:112865248-112865270 TGTCATCTGTTTTAAAAAGCAGG + Intergenic
1196333326 X:114498346-114498368 TGGCATCTCCTTCCAACAGAAGG + Intergenic
1197050832 X:122057480-122057502 TGGCTTCTGTTGAAAACTCAGGG + Intergenic
1197270041 X:124415320-124415342 TAGCATCTGTTGAAAGGAGAAGG - Intronic
1197354788 X:125424709-125424731 TGGCAGCTATTCAAAACAGTAGG - Intergenic
1197456321 X:126680200-126680222 TGGCATCTTCTTACAATAGAAGG + Intergenic
1197670422 X:129271156-129271178 TGTCATCAGTTTAAAACAATAGG - Intergenic
1199485358 X:148340996-148341018 TGTCATCAGTTTAAAACAATTGG + Intergenic
1201686673 Y:16712438-16712460 TGGCATGTGTTTAAAGGAAAGGG - Intergenic
1201851303 Y:18484128-18484150 TGGCTAATGTTTAAAAGAGATGG + Intergenic
1201882016 Y:18836251-18836273 TGGCTAATGTTTAAAAGAGATGG - Intergenic
1201920143 Y:19225334-19225356 TGGCATCTGATTAAACTAAAGGG - Intergenic