ID: 1098348190

View in Genome Browser
Species Human (GRCh38)
Location 12:69528171-69528193
Sequence CCTTTTAAACATTCTATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 275}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098348190_1098348196 -2 Left 1098348190 12:69528171-69528193 CCAGCCATAGAATGTTTAAAAGG 0: 1
1: 0
2: 0
3: 26
4: 275
Right 1098348196 12:69528192-69528214 GGCAGAGGAGGGCTTAGCCTAGG 0: 1
1: 0
2: 1
3: 27
4: 381
1098348190_1098348198 0 Left 1098348190 12:69528171-69528193 CCAGCCATAGAATGTTTAAAAGG 0: 1
1: 0
2: 0
3: 26
4: 275
Right 1098348198 12:69528194-69528216 CAGAGGAGGGCTTAGCCTAGGGG 0: 1
1: 0
2: 1
3: 11
4: 149
1098348190_1098348199 1 Left 1098348190 12:69528171-69528193 CCAGCCATAGAATGTTTAAAAGG 0: 1
1: 0
2: 0
3: 26
4: 275
Right 1098348199 12:69528195-69528217 AGAGGAGGGCTTAGCCTAGGGGG 0: 1
1: 0
2: 1
3: 24
4: 208
1098348190_1098348197 -1 Left 1098348190 12:69528171-69528193 CCAGCCATAGAATGTTTAAAAGG 0: 1
1: 0
2: 0
3: 26
4: 275
Right 1098348197 12:69528193-69528215 GCAGAGGAGGGCTTAGCCTAGGG 0: 1
1: 0
2: 0
3: 12
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098348190 Original CRISPR CCTTTTAAACATTCTATGGC TGG (reversed) Intronic
901796020 1:11680290-11680312 ACTTTTAAAAATTCTTTGGTCGG - Intronic
904019004 1:27447867-27447889 CCTTTTTAACTTTCAAGGGCTGG - Intronic
904137425 1:28324455-28324477 ACTTTTAAATATTCTAGGCCAGG + Intergenic
904224696 1:29006531-29006553 CTTTTAAAAAATTCTTTGGCCGG - Intronic
907535595 1:55152744-55152766 CCTTTTAAAATTTCTAAAGCTGG + Intronic
911339522 1:96619724-96619746 CCTTTTGAACATTCCATGCTTGG + Intergenic
911928026 1:103861672-103861694 CCTTTTAAACAATGTATGAATGG + Intergenic
912791280 1:112653672-112653694 CCTTTTAGACAGGCTATGCCTGG + Intronic
916149169 1:161769439-161769461 TCTGTTGTACATTCTATGGCAGG + Intronic
917568592 1:176238273-176238295 CCTATTTGACATTGTATGGCAGG - Intergenic
917763875 1:178197016-178197038 CCTATTAAACATGCTAAGCCAGG + Intronic
917831826 1:178898253-178898275 CCTTTCAAAGATTCTATCACTGG - Intronic
918468263 1:184843840-184843862 CCTGTAAAACATTATATGGTGGG - Intronic
918627884 1:186679578-186679600 CGTTTTATCCATTCTAAGGCAGG - Intronic
919054039 1:192546696-192546718 CCTTATACACATTCTTTGGCAGG + Intergenic
920799156 1:209171409-209171431 CCATTTAAACAGTCTATCCCTGG + Intergenic
922082387 1:222309622-222309644 CATTTTACACATTCAATGACTGG - Intergenic
923643463 1:235790851-235790873 GCATTTAAACATTCTGTGACAGG + Intronic
924822409 1:247505972-247505994 CTTTTTAAACTTTCTTTAGCTGG - Intergenic
1063020540 10:2122710-2122732 CCTTTTAACCATTCTAAATCTGG + Intergenic
1064401853 10:15028110-15028132 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1064488689 10:15826216-15826238 CCTTAAAACCATTCGATGGCTGG - Intronic
1064827498 10:19421538-19421560 GCTTTTAAACATTCTCTAACTGG - Intronic
1065709311 10:28500176-28500198 CCTTTTAAACTCTTTAAGGCCGG + Intergenic
1066269323 10:33807005-33807027 GCTTTTAAACAATCTGAGGCAGG + Intergenic
1067004122 10:42645428-42645450 CCTTTTAAGCAGTCAGTGGCCGG - Intergenic
1068143123 10:53030132-53030154 CCTTTTAAACTCTTTAAGGCGGG + Intergenic
1072507857 10:96087757-96087779 ACTTTTTAACATTTTATTGCAGG - Intergenic
1073805162 10:107089900-107089922 CCTTTTAAAAATTGTAATGCTGG - Intronic
1073993674 10:109292244-109292266 CCCTTTTAAGATTCTCTGGCCGG - Intergenic
1076668973 10:132108705-132108727 CATTTAAAACATTCAATGCCAGG + Intronic
1078071281 11:8113199-8113221 TCTTTTAAGCATTCAGTGGCTGG - Intronic
1079650257 11:22919706-22919728 CCTTTTAAACTCTTTAAGGCAGG + Intergenic
1079659006 11:23017425-23017447 CCTTTGAAATATTATATGGAAGG - Intergenic
1080266695 11:30408649-30408671 CCTTTTAATCATTCTTTGTCTGG - Intronic
1082946831 11:58770459-58770481 ACTTTTAAACATTTTAAGGCAGG - Intergenic
1083249082 11:61453455-61453477 CTTTTTAAAAATTCAAGGGCCGG - Intronic
1084284643 11:68123022-68123044 CCTTTCAAACATCCAGTGGCCGG - Intergenic
1086057462 11:82663654-82663676 CCTTTTCATCACTGTATGGCAGG + Intergenic
1086110332 11:83192341-83192363 CCTTTTAAGCAATTTGTGGCGGG - Intergenic
1086844479 11:91731175-91731197 CCTTTTAAACTCTTTAAGGCGGG + Intergenic
1087088270 11:94242187-94242209 CCTTTTCAAGATTCTAAGGCAGG - Intergenic
1088077162 11:105864428-105864450 CCTTTTAAAAATGCTTTGGTTGG - Intronic
1088951030 11:114570102-114570124 ACTTTTAAACATCTTAAGGCGGG - Intergenic
1089079514 11:115764128-115764150 CCTTTTTAAGCTTCTGTGGCTGG - Intergenic
1089548470 11:119250184-119250206 CCTTTTAAACCTTGTGAGGCAGG + Intronic
1089728883 11:120508023-120508045 CTTTTTAAAAAATCTCTGGCCGG - Intergenic
1090133658 11:124171589-124171611 CCTTTGAGAGATTCTATAGCTGG - Intergenic
1091542821 12:1477824-1477846 GTTTTTAAACTTTCTATGCCTGG + Intronic
1092536442 12:9392516-9392538 CCTTTTAAGCATTTCATGGGTGG - Intergenic
1093619166 12:21266367-21266389 CCTTTTAATCAGTCTCTGGAAGG - Exonic
1094240455 12:28216937-28216959 AATTTTAAACATTCTCTGACAGG - Intronic
1094240594 12:28218906-28218928 AGTTTTAAACATTCTCTGACAGG + Intronic
1094705575 12:32911310-32911332 CCTTTTAAAAATTCTAGGCCGGG + Intergenic
1098232832 12:68390382-68390404 CCTTAAAAACATTATGTGGCCGG + Intergenic
1098348190 12:69528171-69528193 CCTTTTAAACATTCTATGGCTGG - Intronic
1098956220 12:76692609-76692631 CCTTTTAAACTCTTTAAGGCAGG + Intergenic
1098956953 12:76697513-76697535 CCTTTTAAACTCTTTAAGGCAGG + Intergenic
1099622829 12:85025976-85025998 CCTTTTAGACATTCCATGGAAGG - Intronic
1101161696 12:101984048-101984070 CATTTTAAAAGTTCTATGGAAGG + Intronic
1101332359 12:103767652-103767674 CATCTTCAACATTCTTTGGCAGG - Intergenic
1103575390 12:121873520-121873542 CCTTAAAATCATTTTATGGCCGG + Intergenic
1105712741 13:23028851-23028873 CCTTTTAGTCCTTCTAGGGCCGG - Intergenic
1107490278 13:40874888-40874910 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1108114470 13:47111529-47111551 ACTTTTAAACATCTTAAGGCAGG + Intergenic
1108403599 13:50077639-50077661 ACTTTGAAACATTGTATGCCAGG - Intergenic
1108715282 13:53072563-53072585 CTTTCTAAAAATTTTATGGCTGG + Intergenic
1109121407 13:58462241-58462263 CCTTGTAAAGAGTCTAAGGCAGG + Intergenic
1109149789 13:58831530-58831552 TCTTTTAAACATTCTTTTACAGG + Intergenic
1109201612 13:59437560-59437582 TTTCTTAAACATTCTTTGGCAGG + Intergenic
1109473112 13:62837353-62837375 CCTTTGAAACATTTTATTCCAGG + Intergenic
1110799272 13:79676062-79676084 GCTTTTAAACATTCTTAGGCAGG + Intergenic
1111337158 13:86839450-86839472 CCTTTTAAACTCTTTAAGGCAGG - Intergenic
1114232834 14:20799711-20799733 CCTTTTAAGCATTTTGAGGCAGG - Intergenic
1114602526 14:23968210-23968232 CCTCTAGAGCATTCTATGGCAGG + Intronic
1114606895 14:24005336-24005358 CCTCTAGAGCATTCTATGGCAGG + Intronic
1114612202 14:24050309-24050331 CCTCTAGAGCATTCTATGGCAGG + Intergenic
1115096842 14:29647870-29647892 CCTTTTAAGCAGTTTATGGTGGG + Intronic
1115097191 14:29650653-29650675 CCTTTTAAGCAGTTTTTGGCAGG + Intronic
1117011827 14:51478679-51478701 CCTTTAAAAAATACTATTGCAGG + Intergenic
1120352885 14:83386042-83386064 CCTTTTAAACTCTTTAAGGCGGG + Intergenic
1121723057 14:96125236-96125258 CCTTTTAAACATTCTATCTACGG + Intergenic
1122034811 14:98939612-98939634 CCTTTTAAACATTACATAACTGG - Intergenic
1123223424 14:106877858-106877880 CCTTTTACACAGTCAGTGGCTGG - Intergenic
1123698202 15:22894634-22894656 CATTTTAAACATTCTAAGCAGGG - Intronic
1124399593 15:29336605-29336627 CTTTTAAAACATACTAAGGCTGG - Intronic
1124973294 15:34511417-34511439 GCCTTTAAACATTCTATGTAAGG - Intergenic
1125316509 15:38438023-38438045 ACTTTTAAACATCTTAAGGCAGG + Intergenic
1125410542 15:39401440-39401462 CCTTTTAAATATTCGATGACAGG + Intergenic
1126576551 15:50202881-50202903 CCTTTAAAATATTTTAGGGCTGG + Intronic
1128428014 15:67562589-67562611 CATTTGAAGCTTTCTATGGCTGG + Intronic
1128842590 15:70862276-70862298 GCTTTTAAAAATTCTGAGGCTGG + Intronic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1131370048 15:91872912-91872934 CCTGTTATACATTCCAGGGCTGG + Intronic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1133181280 16:4056548-4056570 CCTTTTAAATTTACTTTGGCTGG - Intronic
1134009837 16:10843720-10843742 CCCTTAAAACATTCCAAGGCTGG - Intergenic
1134233480 16:12447662-12447684 CCTTTTGAAAATTCCCTGGCTGG + Intronic
1135236412 16:20760421-20760443 ACTTTTAAACATCTTAAGGCAGG + Intronic
1135479681 16:22812943-22812965 TCATCTAGACATTCTATGGCTGG + Intergenic
1135937087 16:26790830-26790852 GCTTTTAAACTTTCTTTGGCAGG + Intergenic
1136514517 16:30760012-30760034 GCTATTAAACATTCTAAAGCAGG + Exonic
1137545650 16:49401395-49401417 CCTTTTAAAAATGCAATAGCCGG + Intergenic
1138782386 16:59804817-59804839 AATTTTAAGCATTTTATGGCAGG - Intergenic
1139110459 16:63884781-63884803 CCTACTAAACTATCTATGGCAGG - Intergenic
1139491867 16:67290472-67290494 ACTTTTAAGCATTCTTAGGCCGG - Intronic
1141692981 16:85606926-85606948 ACCTTTAAACTTTATATGGCGGG - Intergenic
1142833245 17:2565131-2565153 TATTTTAAACATTCCAAGGCCGG + Intergenic
1148462381 17:47846147-47846169 CCTAATGAACATGCTATGGCAGG + Exonic
1149760973 17:59229657-59229679 CTTTTTAAAAAATTTATGGCTGG - Intronic
1150358973 17:64512869-64512891 CTTGTTAAACATACTATAGCAGG + Intronic
1152042583 17:77914200-77914222 CTTTTAAAACCTTCGATGGCTGG - Intergenic
1153174129 18:2351493-2351515 CCTTTTAAACTCTTTAAGGCGGG + Intergenic
1154050404 18:10950761-10950783 CCGTTTAAACAGTGTAAGGCCGG - Intronic
1156719220 18:40049436-40049458 CCTTTTAAACATTCCATCAGGGG - Intergenic
1157217956 18:45801438-45801460 GCTTTTAAACATTTGATGGAGGG + Intergenic
1157890360 18:51409894-51409916 CCTTTTCCACTTACTATGGCAGG + Intergenic
1158882967 18:61798761-61798783 CCTTTGAAAAATTCTACTGCAGG + Intergenic
1159981281 18:74783843-74783865 CCTTTTAAAAATTCTTTGAGAGG + Intronic
1163709373 19:18837050-18837072 CCTTTTAAAAAAAGTATGGCAGG - Intronic
1164120955 19:22264705-22264727 CTTTTTATACATTCTATGAATGG + Intergenic
1165510372 19:36263375-36263397 CCTTTTAAACAGTAAATTGCTGG + Intergenic
1166012560 19:39953431-39953453 CCTCCTAAACATTCAATGACAGG - Intergenic
1168439980 19:56356282-56356304 CCTTTTAAACAATCAGTGGTGGG + Intronic
925894094 2:8457875-8457897 CCTTTTAAGAATGCTATCGCTGG - Intergenic
926909554 2:17838745-17838767 TCTTTTAAATATTTTATGACAGG + Intergenic
930002985 2:46873713-46873735 CCTTTTAAACCTTCAATGATGGG - Intergenic
934020622 2:87947873-87947895 CCTTTTAAACTCTTTAAGGCAGG - Intergenic
934543824 2:95198151-95198173 TCTTTCAAACATCCTTTGGCTGG + Intergenic
937237268 2:120438392-120438414 CCTCTTAAACATGGTGTGGCTGG + Intergenic
938624811 2:133096588-133096610 ACCTTTAAATATTCTGTGGCAGG + Intronic
939519531 2:143212396-143212418 CCTATTTAACATTAAATGGCTGG - Intronic
941383768 2:164827946-164827968 TCTTTCAAAAATACTATGGCAGG + Intronic
941644636 2:168026820-168026842 CATTTAACACATTCTATGTCAGG + Intronic
941975109 2:171395437-171395459 CCTTATAAACAGTATATTGCTGG - Intronic
944146158 2:196509593-196509615 GATTTTAAACATTGTATGTCAGG + Intronic
945522791 2:210848943-210848965 CATTTAAAATATTCTATGCCTGG - Intergenic
946786502 2:223251001-223251023 TATTCTAGACATTCTATGGCAGG + Intergenic
947354329 2:229276372-229276394 CATCTTAATCATTATATGGCTGG - Intergenic
948564400 2:238874628-238874650 CCTTTTCAACGTGCTATGTCTGG - Intronic
1169905581 20:10600096-10600118 CCTTTTTATCATTTTATGGGAGG - Intronic
1170179554 20:13514294-13514316 CCAGTAAAACATTCTAGGGCTGG + Intronic
1171324466 20:24279028-24279050 CCAATTAAACATTCTAGGTCAGG + Intergenic
1173346033 20:42200990-42201012 CCTTTTATACTTCCTCTGGCAGG - Intronic
1173746727 20:45443179-45443201 CATTTTAAGAATTCTCTGGCTGG + Intergenic
1174726370 20:52866791-52866813 CATTTTAAACATTTTATGCACGG - Intergenic
1176346111 21:5749296-5749318 CCTTTTAAGCATTTCATGGGTGG + Intergenic
1176352925 21:5869880-5869902 CCTTTTAAGCATTTCATGGGTGG + Intergenic
1176418183 21:6491899-6491921 CCTTTAAAACAGTCTAGAGCTGG - Intergenic
1176498716 21:7575159-7575181 CCTTTTAAGCATTTCATGGGTGG - Intergenic
1176516477 21:7788160-7788182 TGTTTTAAACATTTTTTGGCTGG + Intergenic
1176540432 21:8147366-8147388 CCTTTTAAGCATTTCATGGGTGG + Intergenic
1176559383 21:8330411-8330433 CCTTTTAAGCATTTCATGGGTGG + Intergenic
1177675975 21:24299359-24299381 GCTTTTAAATATTCTAGGACAGG + Intergenic
1178338382 21:31764393-31764415 TCTATTTGACATTCTATGGCGGG - Intergenic
1178615228 21:34127129-34127151 ACTTTTAAAGATTTTATTGCTGG + Intronic
1178650505 21:34418172-34418194 TGTTTTAAACATTTTTTGGCTGG + Intergenic
1179462153 21:41543642-41543664 TCTTTTAAACAGCATATGGCTGG - Intergenic
1179522077 21:41952355-41952377 CCTTCAAAATATTCCATGGCGGG - Intronic
1179693676 21:43100221-43100243 CCTTTAAAACAGTCTAGAGCTGG - Intronic
1182371057 22:29811221-29811243 CCTTTTAAAAAATTTAAGGCTGG - Intronic
1183030969 22:35104214-35104236 GCTTTTTAAAGTTCTATGGCCGG + Intergenic
1183084737 22:35479765-35479787 CCTTTTAAACTCTTTAAGGCGGG + Intergenic
1184464830 22:44662746-44662768 CATTTTAAGCACTCTATGGAAGG + Intergenic
1184848592 22:47104392-47104414 CCTTTTAAAGATTCAATAGATGG + Intronic
1203245375 22_KI270733v1_random:63793-63815 CCTTTTAAGCATTTCATGGGTGG + Intergenic
949643539 3:6067228-6067250 CCTTTTAAACTCTTTAAGGCGGG - Intergenic
950646412 3:14379775-14379797 CTTTTTAAAAAGTCTATGTCAGG + Intergenic
951379184 3:21962149-21962171 CCTCTTAAACATTTTCTGTCTGG - Intronic
952567708 3:34679414-34679436 ACTTTTAAACATCTTAAGGCAGG - Intergenic
953665042 3:44919391-44919413 CCTTTTGAAGATTGTAGGGCAGG - Intronic
954521233 3:51228464-51228486 CCTTTTAAACAGAATATGGTGGG - Intronic
957445158 3:80307459-80307481 CCTTTTAAACTCTTTAAGGCGGG - Intergenic
958110550 3:89137964-89137986 CCTATTAAAAATCCTATTGCTGG - Intronic
959609232 3:108275760-108275782 CCTTTTAAACCCTTTAAGGCGGG + Intergenic
959830261 3:110853323-110853345 CTTTTTTAAAAATCTATGGCTGG + Intergenic
960652966 3:119971909-119971931 CCTTATAAAAATTTTATTGCAGG - Intronic
960853328 3:122078135-122078157 CCTTTTACTCATTCTCTGGCCGG - Intronic
961245110 3:125444782-125444804 CCTTTTGAAAATTGTATTGCTGG - Intergenic
961918530 3:130402107-130402129 CCTTTCAAACTTTCTAAAGCAGG - Intronic
962246033 3:133794369-133794391 CCATTTAAACATTTTATAGAGGG + Intronic
962409034 3:135125304-135125326 GCTTCTAAAGATTCTATGTCAGG - Intronic
963077548 3:141361267-141361289 CTTTTTAAACATTCTTTGTAAGG + Intronic
963461534 3:145619929-145619951 GCTTTTAAACATTCTTTTTCTGG - Intergenic
963882904 3:150547858-150547880 CCTTTTAAACAGTCTTTGCCTGG - Intronic
964604244 3:158542232-158542254 CCTTAAAAACATTATGTGGCTGG + Intronic
965675741 3:171194069-171194091 CCTTATAAACTTTATATGGTGGG + Intronic
967576891 3:191104968-191104990 CCTTTTAAACTCTTTAAGGCGGG + Intergenic
967622404 3:191649921-191649943 CCTTTTAAACTCTTTAAGGCAGG - Intergenic
970419922 4:15896511-15896533 CCTTTTAAAAAATTTAAGGCTGG + Intergenic
971980116 4:33741167-33741189 CCTTTTAAACTCTTTAAGGCAGG - Intergenic
972049833 4:34715643-34715665 CCTTTTAAACTCTTTAAGGCGGG - Intergenic
972880704 4:43418413-43418435 CCTTTTAAACTCTTTAAGGCAGG + Intergenic
974120641 4:57633895-57633917 CCTTCTAAAAGTCCTATGGCTGG - Intergenic
974994722 4:69140586-69140608 CCTTTTAAACTCTTTAAGGCGGG - Intronic
975001228 4:69224858-69224880 CCTTTTAAACTCTTTAAGGCGGG + Intergenic
975004209 4:69267426-69267448 CCTTTTAAACTCTTTAAGGCGGG - Intergenic
975539005 4:75484710-75484732 CTTTTTAAACATTTTATAGAAGG + Intronic
977281899 4:95050107-95050129 CTTTTTAAACCTTCTATGTTGGG - Intronic
977592688 4:98844055-98844077 TCTATTCAACATTCTATGGGAGG - Intergenic
977710377 4:100117455-100117477 GTATTAAAACATTCTATGGCTGG - Intergenic
978953325 4:114588313-114588335 ACTTTTAAACATCTTAAGGCGGG + Intergenic
978954325 4:114595959-114595981 ACTTTTAAACATTTTAAGGCAGG + Intergenic
980057070 4:128088374-128088396 CTTTATCAACATTCTTTGGCAGG + Intronic
980185974 4:129461883-129461905 CCTTTTAAACTCTTTAAGGCGGG + Intergenic
980571233 4:134622855-134622877 CCTTTTAAACTCTTTAAGGCGGG + Intergenic
980822035 4:138029873-138029895 CCTTTTAAATAATTTATGGTGGG + Intergenic
981233876 4:142391855-142391877 CCGTTTAAACATTTTATGAAGGG + Intronic
981506818 4:145510318-145510340 CCTTTTAAAAAATCTTTGGCGGG + Intronic
984185846 4:176542822-176542844 CCTTTTAAACATTCTGTTTAAGG + Intergenic
984290613 4:177789405-177789427 CCTTTTAAACATTTTAAGGTGGG - Intronic
984997699 4:185451672-185451694 CCTTATAAATATTCTTAGGCTGG + Intronic
987327058 5:16822343-16822365 ATTTTTAAACATTGTTTGGCTGG + Intronic
988216953 5:28287293-28287315 CCTTTTAAACTCTTTAAGGCGGG - Intergenic
992166281 5:74055128-74055150 CCTTTTCAGCATTCTAAGACTGG + Intergenic
993979459 5:94527388-94527410 CCTTTTAACTATTTTATGACTGG - Intronic
995419963 5:111953350-111953372 CCTTTTGAACACTCTATGCCTGG + Intronic
995747294 5:115417413-115417435 CTTTTCAAACATTCTATTTCTGG + Intergenic
997788514 5:136735975-136735997 CCTTTTAAACTCTTTAAGGCGGG - Intergenic
998732440 5:145095473-145095495 CTTGTTAAACATTTAATGGCTGG + Intergenic
1002765962 6:239191-239213 CCTGTTAGTCATTCTAGGGCTGG + Intergenic
1006615969 6:35327124-35327146 GCTTTTAAATATTCTATGGTGGG + Intergenic
1006849941 6:37091189-37091211 CCTTTTAAAAATTCAAAGGTTGG - Intergenic
1008826148 6:55696690-55696712 CCGGTTAAAAATTCTATGGTTGG - Intergenic
1009763704 6:68040408-68040430 CCTTTTAAACTCTTTAAGGCCGG + Intergenic
1009871026 6:69452151-69452173 CCTTGTAAACTTTTTAAGGCGGG - Intergenic
1010301053 6:74260113-74260135 TCTTGGAAACATTCTTTGGCAGG + Intergenic
1010805461 6:80230460-80230482 CCATGTAAACAAGCTATGGCTGG + Intronic
1011304957 6:85915767-85915789 TCATTTAAATGTTCTATGGCAGG - Intergenic
1012076553 6:94693931-94693953 CCTTTTTAATCATCTATGGCAGG + Intergenic
1012077096 6:94703147-94703169 ACTTTTAAACAGTCTCAGGCAGG - Intergenic
1012739700 6:103000658-103000680 CCTTTTAAACTTTTTAAGGTGGG + Intergenic
1012803093 6:103859239-103859261 CGTTATATACATTCTATTGCTGG - Intergenic
1013992459 6:116270123-116270145 CCTTGTAAACATTCTATTTCTGG + Intronic
1014033418 6:116737156-116737178 GCTTTTAAACTTTGTAAGGCAGG + Intronic
1014105587 6:117557375-117557397 CCTTTTAAACAACATATTGCTGG + Intronic
1014201859 6:118617588-118617610 CCTTTTAAACTCTTTAAGGCGGG - Intronic
1014203191 6:118626592-118626614 CCTTTTAAACTCTTTAAGGCGGG - Intronic
1014792134 6:125684695-125684717 CCTTCTTAACATAATATGGCTGG + Intergenic
1015506983 6:133998835-133998857 TCCTTTAAACATTTTGTGGCTGG - Intronic
1015548945 6:134392230-134392252 CCTTTGAAAGATTATATTGCAGG - Intergenic
1016972705 6:149779339-149779361 CCTTTTAAGCAGTTTGTGGCAGG - Intronic
1017378552 6:153799498-153799520 CCATTTAAACATTTTATGAAGGG - Intergenic
1017707810 6:157140054-157140076 CCTTTTATACATTCTATTTAAGG + Intronic
1017912877 6:158809686-158809708 CCTTGTATATATTTTATGGCTGG - Intronic
1020074056 7:5246071-5246093 CCTTTAAAACATACATTGGCAGG - Intergenic
1020431146 7:8117340-8117362 CCTCTTAACCATTCTGGGGCAGG - Intronic
1020966559 7:14877257-14877279 CTTTTGAAAAATTTTATGGCCGG + Intronic
1021043577 7:15893267-15893289 ACTTTAAAACATTTTATGGAAGG + Intergenic
1022448039 7:30485952-30485974 CTTTTTAACCTGTCTATGGCAGG + Intergenic
1022559407 7:31333744-31333766 CCAATGAAACATTCTGTGGCTGG - Intergenic
1023323054 7:39020978-39021000 TCTTTTAAACAGTCTCTGGCTGG + Intronic
1024599619 7:50969184-50969206 CCATTTAAACATTTTATGAAGGG + Intergenic
1024790156 7:52956837-52956859 CCTTTTAAACTTTTTAAGGTGGG - Intergenic
1027662553 7:81004801-81004823 CCTTTTCAATATTCTATGGAAGG + Intergenic
1030613773 7:111716784-111716806 CCTTTTAAAGAATCTTAGGCTGG + Intergenic
1032606285 7:133357875-133357897 ACTTTGAAACATTCTGTGGCAGG - Intronic
1033333588 7:140434619-140434641 CCATTTAAAAATTCTAGGCCGGG + Intergenic
1033509585 7:142041734-142041756 CCTTTCCAACATTCTTTGCCTGG + Intronic
1034314106 7:150113754-150113776 CTTTCTAAACAGTCTATGCCTGG + Intergenic
1034870214 7:154676781-154676803 CCTTTTAAGCATTTTGAGGCAGG + Intronic
1037960823 8:23096758-23096780 CCTTTTAAGCAGTTTGTGGCAGG + Intronic
1038124758 8:24660575-24660597 CCTTTTAAAAAAAGTATGGCTGG - Intergenic
1040483988 8:47853265-47853287 CCTTTTAGACAGTCACTGGCTGG - Intronic
1040861247 8:52001536-52001558 CCTTTGAAACATTCTCTATCAGG - Intergenic
1041060228 8:54028230-54028252 ATTTTTAAAAATTCTTTGGCCGG + Intergenic
1041319117 8:56595247-56595269 ACTGTGAATCATTCTATGGCAGG - Intergenic
1041473344 8:58235379-58235401 ACTTTTAAACATCTTAAGGCAGG - Intergenic
1041993176 8:64019428-64019450 CTTTTTAAACATTTTTTGGGAGG - Intergenic
1045605982 8:103776461-103776483 CCTTCTGTACATTCTATGACAGG - Intronic
1045928435 8:107597575-107597597 CCTTTTAAACTCTTTAAGGCAGG + Intergenic
1046337820 8:112813267-112813289 CCTTTTAAACTCTTTAAGGCAGG + Intronic
1050707671 9:8421702-8421724 GCTTTTAAACATTTGATGGAGGG - Intronic
1050973111 9:11902257-11902279 ACTTTTAAAGATACTATAGCTGG + Intergenic
1052247139 9:26349356-26349378 CCTTTTAAACTCTTTAAGGCGGG - Intergenic
1053327615 9:37169763-37169785 CCTTTTGAAAATTTTTTGGCTGG + Intronic
1058054316 9:100434225-100434247 CCTTTGAAACAGTCTTTGGCTGG + Intronic
1203461712 Un_GL000220v1:46865-46887 CCTTTTAAGCATTTCATGGGTGG + Intergenic
1185859801 X:3566998-3567020 CCTTGTCTACATTCTATGGATGG - Intergenic
1185874459 X:3691135-3691157 CCTTTTAAGCAGTTTGTGGCGGG + Intronic
1187554129 X:20335067-20335089 CCCTGTAAACATTCTAAAGCCGG + Intergenic
1188349888 X:29115630-29115652 CCTTATAAAAAGTCTATTGCTGG + Intronic
1188557686 X:31430496-31430518 ACTTTTAAACCTTCTGTGGGTGG - Intronic
1188599977 X:31950878-31950900 TCTTTTAAACAAACTATGGTTGG + Intronic
1188749835 X:33891759-33891781 CCTTTTTAAAATTCTATTTCTGG + Intergenic
1188893482 X:35638074-35638096 CCTTTTTAATATTCTATGCCAGG - Intergenic
1190291509 X:48995889-48995911 CTTTTTAAAAGTTTTATGGCCGG - Intronic
1190948234 X:55116927-55116949 ACTTTTAAACATCTTAAGGCGGG - Intronic
1190951051 X:55143207-55143229 CCTTTTAAACTCTCTAAGGCAGG + Intronic
1193382298 X:80828890-80828912 TCTGTTCAACATTTTATGGCAGG + Intergenic
1193462294 X:81805925-81805947 CCTTTTAAACTTTTTAAGGCGGG + Intergenic
1193463020 X:81812006-81812028 CCTTTTAAACTTTTTAAGGCGGG + Intergenic
1197575903 X:128211093-128211115 CCTTTTAAACTCTGTAAGGCGGG - Intergenic
1198617134 X:138471363-138471385 TCTTTTAAATATACAATGGCTGG - Intergenic
1198727654 X:139693340-139693362 CCTTTTCAAAATTTTCTGGCAGG + Intronic
1199123899 X:144091256-144091278 CCTTTTAAACTCTTTAAGGCAGG + Intergenic
1201326785 Y:12769507-12769529 ACTTTTAAACATAGTATGGGAGG - Intronic
1201600312 Y:15721157-15721179 ACTTTTAAACATCTTAAGGCAGG - Intergenic
1201697347 Y:16840573-16840595 CCTTTCAAACATACTGTAGCAGG - Intergenic
1201749654 Y:17419074-17419096 CCTTTTAAACTCTTTAGGGCGGG + Intergenic
1201914042 Y:19163521-19163543 CCTTTTACACATTTGATGGTAGG + Intergenic
1202051885 Y:20789915-20789937 CCTTTTAAGCATTTTGAGGCAGG + Intergenic