ID: 1098350782

View in Genome Browser
Species Human (GRCh38)
Location 12:69557618-69557640
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 740
Summary {0: 4, 1: 15, 2: 38, 3: 155, 4: 528}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900179942 1:1306653-1306675 GTGGGTGTGCACGCGCGCGCTGG - Intronic
900180390 1:1308574-1308596 GGCCGCGTCCGCGCGCGCGCAGG + Exonic
900190088 1:1349530-1349552 GAGCGCGGGCCCGCGCGCGGGGG - Intergenic
900345365 1:2207958-2207980 GTGCGCGCGCGCATGCGTGCAGG + Intronic
900374806 1:2348712-2348734 GTGCGTGTGCGTGCCCGCGCAGG - Intronic
901361388 1:8703506-8703528 GTGTGTGCGCGCGCCCGCGGCGG - Intronic
901641433 1:10694890-10694912 GCGAGCGCGCGCGCGGCCGCCGG - Intronic
901660147 1:10794197-10794219 GTGCGCGCGCGCGCGCGTCGTGG + Intronic
901762663 1:11480664-11480686 GTGTGTGTGCACGCGCGCGCTGG - Intronic
901905022 1:12400951-12400973 GTGTGTGTGTGCGCGCGCGCAGG - Intronic
901934451 1:12618042-12618064 GAGCGAGCGAGCGCGCGCGAGGG - Intergenic
902451434 1:16499166-16499188 GTGCGCGCGTGCGCGGGGGCTGG - Intergenic
902501446 1:16914148-16914170 GGGGGCGCGCGCGTGCGCGGGGG + Intronic
902501448 1:16914152-16914174 GCGCGCGCGTGCGCGGGGGCGGG + Intronic
903263384 1:22142992-22143014 GTGGGCGCCCGCGGGCGGGCCGG + Intronic
903389480 1:22953857-22953879 GTGCGCGCGCGCCTGGCCGCGGG - Exonic
903514725 1:23902785-23902807 CTGCGCGGGCGCGGGCGCGGGGG + Intronic
904160432 1:28518636-28518658 GTGCGCGCGGCCGCCCGGGCGGG + Intronic
904181347 1:28668856-28668878 GTGGGCGCGCGGGCGCGGGGTGG + Intronic
904563391 1:31413318-31413340 CGGCGCGCGCGGGCGGGCGCCGG - Intronic
904837733 1:33349842-33349864 GGTTGCGCGCGCGCGCGCGGCGG + Intronic
905137059 1:35808131-35808153 GAGCCAGCGCGCGCGCCCGCCGG - Intergenic
905231833 1:36519249-36519271 GTGCGCGCGCGCTCACGTGCAGG + Intergenic
905337449 1:37255314-37255336 ATGTGCGCGCGCGCTCTCGCTGG + Intergenic
905626271 1:39492095-39492117 GTCTGGGCGCGCGCGAGCGCCGG + Exonic
905670625 1:39788360-39788382 GTCTGGGCGCGCGCGAGCGCCGG - Exonic
906140362 1:43530831-43530853 GGGCGCGGGCGCGAGCGCGAGGG + Intronic
906204333 1:43979171-43979193 GGCCGCGGGGGCGCGCGCGCGGG + Intronic
906204336 1:43979179-43979201 GGGCGCGCGCGCGGGCGCGCGGG + Intronic
906204337 1:43979183-43979205 GCGCGCGCGGGCGCGCGGGCCGG + Intronic
907526476 1:55056863-55056885 GTGCGTGCGCGCGCGCGCGTTGG + Intronic
908131969 1:61082966-61082988 GTGTGCGCGCGTGTGCCCGCGGG + Intronic
909622375 1:77683047-77683069 GTGCGCGCGCACGTGTGCGCGGG - Intronic
910533951 1:88275030-88275052 GCGCGCGCGCGCGCGCGCCTGGG + Intergenic
912556455 1:110519734-110519756 GTGTGTGTGCGCGCGCACGCTGG + Intergenic
912684243 1:111749444-111749466 GTGCGCGCGCGCGCGTGCTAGGG + Intronic
913323519 1:117606609-117606631 GTGCGCGCCCGCGGGAGCGCCGG - Intronic
914869118 1:151458807-151458829 GAGTGCGCGCGCGCGCGCCGCGG + Intronic
915818781 1:158999084-158999106 GTGTGCGCGCGCACGCACGCAGG - Intergenic
916651666 1:166839609-166839631 GTGCGCGCGGGCGGGGGCGGCGG + Intronic
917565382 1:176207269-176207291 GTGCGCGCGCGCGCGAGCGGCGG + Exonic
918048348 1:180954409-180954431 GTACGCGTGCGCGCGTGTGCTGG - Intergenic
918205157 1:182301793-182301815 GTGTGCGCGCGCGTGCATGCTGG - Intergenic
918601977 1:186375145-186375167 GCTCGCGCGCGCCCGCCCGCCGG + Exonic
919930009 1:202215015-202215037 GTGTGTGCGCGCGCGCGCGTTGG + Intronic
920278839 1:204828599-204828621 GGGCGCGGGGGCGCGCACGCAGG + Intergenic
920367699 1:205456798-205456820 GTGCGGGCGTGAGCGCGCGCGGG - Intergenic
920524997 1:206659793-206659815 GTGTGTGCGCGCGCACGCACCGG - Intronic
920600601 1:207320872-207320894 GCGCGCGCGCGCGCGCGCCTCGG - Intergenic
920660569 1:207911052-207911074 GTCCGCAGGGGCGCGCGCGCAGG - Exonic
921138655 1:212285378-212285400 GTGCGCGTGTGCGCGCGCCAGGG - Intergenic
921708025 1:218346041-218346063 GTGTGTGCGTGTGCGCGCGCTGG - Intergenic
922577049 1:226667852-226667874 GTGCGCGCGCGCGTGCGAAGTGG + Intronic
922817256 1:228458676-228458698 GTGTGTGTGCGCGCGCGCGCCGG + Exonic
922831531 1:228556784-228556806 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922832009 1:228608738-228608760 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922832570 1:228610979-228611001 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922833130 1:228613220-228613242 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922833691 1:228615461-228615483 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922834250 1:228617702-228617724 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922835359 1:228622158-228622180 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922835918 1:228624378-228624400 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922836477 1:228626620-228626642 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922837035 1:228628859-228628881 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922837594 1:228631101-228631123 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922838153 1:228633342-228633364 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922838712 1:228635581-228635603 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922839270 1:228637807-228637829 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922840392 1:228642279-228642301 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922958556 1:229625813-229625835 GCGCGCGCGCGGGCGGGCGGGGG - Intronic
922958558 1:229625815-229625837 GCGCGCGCGCGCGGGCGGGCGGG - Intronic
922958560 1:229625819-229625841 AGGCGCGCGCGCGCGCGGGCGGG - Intronic
923191709 1:231626668-231626690 GCGCGCGCGCGCGCGCGTCAGGG + Intronic
923506591 1:234610241-234610263 GAGCGCGCGCGCGGGAGGGCGGG - Intergenic
923783228 1:237043291-237043313 TTGCGTGTGTGCGCGCGCGCGGG + Intronic
923783230 1:237043297-237043319 GTGTGCGCGCGCGCGGGTGGTGG + Intronic
924524609 1:244835306-244835328 GTGCGTGTGAGCACGCGCGCCGG + Exonic
1063624804 10:7679005-7679027 GTGCGCGCGCGCGCGGAGGGAGG - Intergenic
1063624806 10:7679009-7679031 GTGTGTGCGCGCGCGCGCGGAGG - Intergenic
1065025065 10:21534017-21534039 GGGCGCGGGGGCGCGCACGCGGG - Intergenic
1065099906 10:22321894-22321916 GGGCGCGCGCTCGCGGGCGCGGG - Intronic
1065214697 10:23438876-23438898 GCGCGCGAGCGCGCGCGGGCGGG - Intergenic
1065214699 10:23438880-23438902 CTCGGCGCGCGAGCGCGCGCGGG - Intergenic
1066022876 10:31319942-31319964 GCGCGCGTGTGCGCGGGCGCCGG + Intronic
1067453767 10:46398358-46398380 GCGCGCGGGGGCGGGCGCGCGGG + Intergenic
1067513044 10:46911378-46911400 GTGCGCAGGCTCGCGGGCGCAGG + Intronic
1067583460 10:47461388-47461410 GCGCGCGGGGGCGGGCGCGCGGG - Intronic
1067633464 10:47986736-47986758 GCGCGCGGGGGCGGGCGCGCGGG - Intergenic
1067649209 10:48140464-48140486 GTGCGCAGGCTCGCGGGCGCAGG - Intergenic
1068545078 10:58335444-58335466 GGGCCCGCGCGCGTTCGCGCCGG + Intronic
1068660916 10:59622577-59622599 GTGTGTGTGTGCGCGCGCGCGGG - Intergenic
1069913597 10:71774032-71774054 GTGCGCGCGCGCATGCACTCAGG - Intronic
1070257770 10:74826039-74826061 GCGGGCGGGCGCGCGCGGGCGGG - Intronic
1070257772 10:74826043-74826065 GGGCGCGGGCGGGCGCGCGCGGG - Intronic
1070329652 10:75408277-75408299 GTGCGCGCGCTGGCCCGCGCGGG + Intergenic
1070769164 10:79072259-79072281 GTGCGTGCGCGCGTGCGTGAGGG - Intronic
1071997569 10:91163012-91163034 GTGCGCGAGCGCGCGCGCGTGGG - Intronic
1072169888 10:92848745-92848767 GTGCGCGCGGGGGCGGGCGGGGG + Intronic
1072881254 10:99232196-99232218 GTGTATGCGCGCGCGCGCGTTGG - Intronic
1072994194 10:100228970-100228992 GCGCGCGCGCGCGCGCTTGGAGG - Intronic
1073062045 10:100738994-100739016 GTCCGCGTGCGCGCGCGCGACGG - Intronic
1073326219 10:102645196-102645218 GTGTGTGCGCGCGCGCGCGTAGG - Intronic
1073432295 10:103494299-103494321 GTGTGCGAGTGTGCGCGCGCGGG - Exonic
1073463755 10:103681757-103681779 GTGTGTGCGCGCGCGCGCGCGGG - Intronic
1073577827 10:104640537-104640559 GCGTGCGCGTGCGTGCGCGCAGG - Intergenic
1074465707 10:113679658-113679680 GTGCGCGTTCTCCCGCGCGCGGG + Intronic
1074810204 10:117096994-117097016 GTGCGCGCGCGTGCGCGCTTGGG - Intronic
1077053162 11:576727-576749 GCGGGCGGGCGCGCGCGCGCTGG + Intronic
1077201508 11:1309691-1309713 GCGCGCGTGCGCGCGAGAGCCGG - Intergenic
1077214620 11:1390237-1390259 GGGCGCCCGGGCGCGCGGGCAGG - Intronic
1077250053 11:1556986-1557008 GTGCGCGGGGGAGCGCGCGGGGG + Exonic
1077505853 11:2929686-2929708 GTGCGGGCGAGCGCCCGGGCGGG - Intergenic
1079798162 11:24833695-24833717 GTGTGCGCGCGCGCGGTGGCAGG - Intronic
1079798163 11:24833699-24833721 GTGTGTGTGCGCGCGCGCGGTGG - Intronic
1081528275 11:43942074-43942096 GTGCGCGCGCGCGCCTGCGGAGG + Intronic
1081574540 11:44310815-44310837 GCGCCCGCGAGCTCGCGCGCAGG - Intergenic
1082959571 11:58905788-58905810 GGGCGCACGCGCTCGCGGGCGGG - Intronic
1083317871 11:61827724-61827746 GGGCGTGCGCGCACGCGCCCCGG + Intronic
1083448574 11:62727273-62727295 GTGCGTGCGCTCGCTCGCGCGGG - Exonic
1083574313 11:63778464-63778486 GTGTGTGTGTGCGCGCGCGCGGG + Intergenic
1084072356 11:66744715-66744737 GCGGGCGCAGGCGCGCGCGCGGG + Intronic
1084128982 11:67119128-67119150 GTGCGCGTTCACGCGCGCCCGGG + Intergenic
1084146153 11:67266429-67266451 GGGCGCGGGCGCGCGGGCGGCGG + Exonic
1084265727 11:68004199-68004221 GCGCGCGCGCGCGTGTGTGCAGG + Intronic
1085485646 11:76860880-76860902 GCGCGAGCGAGCGCGCGGGCTGG + Exonic
1086590481 11:88509178-88509200 GAGCGCGGCCGCGCGGGCGCCGG + Exonic
1087003831 11:93449027-93449049 GTGCGCGCGTGCGCGCTCCTCGG + Intergenic
1087141441 11:94768892-94768914 GCGCGCCCGCGCCCGCGCGCGGG + Intronic
1088820483 11:113452472-113452494 GCGCGCGCGCGCGCGCACATTGG + Intronic
1089572870 11:119422053-119422075 GTGCACCCGCGAGAGCGCGCAGG + Intronic
1089713690 11:120336385-120336407 GTCTGCGCGCGCGCCCGCGAGGG + Intergenic
1089977444 11:122744897-122744919 GTGCGCGCGCGCGCGCACTTGGG + Intronic
1090155812 11:124437670-124437692 GCGCGCGCGTGCGTGCGTGCTGG + Intergenic
1090185921 11:124739253-124739275 GTGTGCGTGCGTGAGCGCGCGGG + Intergenic
1091023852 11:132124617-132124639 GTGTGTGCGCGCGCACGCGCAGG + Intronic
1091023854 11:132124621-132124643 GTGCGCGCGCACGCGCAGGGCGG + Intronic
1092655044 12:10674872-10674894 GTGCGCGCGCGCGCGCGCGCGGG - Intergenic
1092843344 12:12562962-12562984 GGGGGCGGGCGCGCGGGCGCGGG - Intergenic
1092899369 12:13044371-13044393 GCGGGCGCGCGCACGCGCACCGG + Exonic
1092989452 12:13881018-13881040 GTGCGCGCACGCATGTGCGCAGG + Intronic
1093435323 12:19129669-19129691 GGGCGCGCGCGGGGGCGCGCCGG + Intergenic
1093547839 12:20369205-20369227 GTGTGTGCGCGCGCGCGCGTGGG + Intergenic
1093547840 12:20369209-20369231 GTGCGCGCGCGCGCGTGGGTCGG + Intergenic
1093728722 12:22544264-22544286 GAGCGCGCGGGGGCGCGCGCGGG + Intronic
1094041710 12:26126101-26126123 GGGCGAGCGCGCGCGCGCACGGG - Intronic
1094048572 12:26195331-26195353 GTGCGCGCGTGTGCGAGTGCGGG - Intronic
1095180863 12:39145230-39145252 GTGGGCGCGCGCTTTCGCGCCGG - Intergenic
1095799390 12:46256594-46256616 GTGCGCGCGCGCGCGCAAACTGG - Intronic
1096101296 12:48971832-48971854 GCGCGCGCGCGCGCGCTGGGAGG - Intergenic
1096101298 12:48971836-48971858 GCGCGCGCGCGCGCGCGCGCTGG - Intergenic
1096254956 12:50057347-50057369 GCGCGCGCGTGTGTGCGCGCAGG - Intergenic
1096255049 12:50057715-50057737 GTCCGCCCGCCCGCGCGCGCTGG - Exonic
1096481107 12:51941569-51941591 GTGTGTGCGCGCGCGCGCGTGGG - Intergenic
1096482395 12:51951536-51951558 GCGGGCGCCCGCGCGCGCCCCGG + Intergenic
1096482447 12:51951678-51951700 GGGGGCGCGCGCGCGCGCGCTGG + Intronic
1096994618 12:55830812-55830834 GCGCGCGCGCGTGCGCGCGGTGG - Intronic
1097218367 12:57431157-57431179 GAGTGCGAGTGCGCGCGCGCCGG - Intergenic
1097854880 12:64452050-64452072 GTGCGCACGCGCACCCGCACCGG + Exonic
1097989833 12:65823839-65823861 GTGCGCGCTCGCCCGCCCGCAGG + Intergenic
1098161067 12:67648731-67648753 GCGCGGGGGCGCGCGCGCGCGGG + Exonic
1098161069 12:67648737-67648759 GGGCGCGCGCGCGCGGGCCCGGG + Exonic
1098350782 12:69557618-69557640 GTGCGCGCGCGCGCGCGCGCAGG + Intronic
1099989784 12:89709397-89709419 GTGCGCGCGCGCGCGCGCGGAGG + Intergenic
1100613342 12:96210548-96210570 GTGTGCGTGCGCCCGCGCGCAGG - Intronic
1100869398 12:98894871-98894893 GGGGGCGCGCGCGCGGGCCCGGG - Intronic
1101354716 12:103966119-103966141 TGGCGCGCGCGCGCGCACGCAGG + Intronic
1101354718 12:103966121-103966143 GCGCGCGCGCGCGCACGCAGGGG + Intronic
1101640575 12:106583586-106583608 GTGTGCGTGCGCGCGCGCGAAGG + Intronic
1101641255 12:106586971-106586993 GTGTGTGTGTGCGCGCGCGCGGG + Intronic
1101641257 12:106586979-106587001 GTGCGCGCGCGCGGGCGAACGGG + Intronic
1102084397 12:110124285-110124307 CCGCGCGCGCGCGCACGAGCTGG - Intergenic
1102084399 12:110124286-110124308 CAGCTCGTGCGCGCGCGCGCGGG + Intergenic
1102955042 12:117053725-117053747 GTGCGCGCGCACGCGAGAGAGGG - Intronic
1103102288 12:118188950-118188972 GAGCGCGCACGCGCACGCGTGGG + Intronic
1103348348 12:120265742-120265764 GCGGGCGCGGGCGCGCGCGGCGG - Exonic
1103758817 12:123233134-123233156 GGGCGCGCGCGCGCTCCCTCGGG - Exonic
1103800359 12:123533755-123533777 GGGAGGGCGCGCGCGTGCGCAGG + Intergenic
1103856294 12:123973045-123973067 GCGAGCGGGAGCGCGCGCGCCGG + Intronic
1103856369 12:123973246-123973268 GAGCGCGCGCGCGCGCGGCTCGG + Exonic
1103940983 12:124501035-124501057 GTGCGCGCGCGCTCGTGCCGTGG - Intronic
1103971728 12:124676810-124676832 GTGTGTGCGCGTGCACGCGCGGG + Intergenic
1104049527 12:125186365-125186387 GTGAGCGAGCGAGCGAGCGCCGG - Intergenic
1104568285 12:129903899-129903921 GCTCGGGCGCGCGCGCGCTCCGG + Intergenic
1104697077 12:130871940-130871962 GCGTGCGTGCGCGCACGCGCGGG + Exonic
1104961407 12:132490089-132490111 GGGCGCGCGGGCGCCCGCGGCGG + Exonic
1106340127 13:28819830-28819852 GGGCGGGCAGGCGCGCGCGCAGG + Intergenic
1106735672 13:32586294-32586316 GTGCGCGCGCGCGGACGGGGCGG + Intergenic
1107027184 13:35814254-35814276 GTGCGTGTGTGCGCGCGTGCAGG - Intronic
1107359462 13:39603140-39603162 CTGTGGGCGCGCGCGGGCGCCGG + Exonic
1107359464 13:39603142-39603164 GTGGGCGCGCGCGGGCGCCGGGG + Exonic
1107654058 13:42574149-42574171 GGGCGCGCGGGCGAGCGGGCAGG - Exonic
1107770931 13:43786983-43787005 GTGCGCGCGCGCCCACGGGGTGG + Intergenic
1108530891 13:51326038-51326060 GTGTGTGCGCGCGCGCACGTGGG + Intergenic
1108530892 13:51326042-51326064 GTGCGCGCGCGCACGTGGGTTGG + Intergenic
1108541951 13:51453249-51453271 GTGCGCGCGAGCGGGCGGGCGGG + Intronic
1110922491 13:81106116-81106138 GTGTGCGCGCGTGCGCGCACAGG - Intergenic
1111183990 13:84705235-84705257 GCGCGCGCGCGCGTGCGTGTTGG + Intergenic
1112507039 13:99981601-99981623 GTGCGCGCGCGGGTGCGCGCAGG + Intergenic
1112509429 13:99997064-99997086 GTGTGCGCGCGCGCGCCCCTGGG + Intergenic
1113517387 13:110914378-110914400 GCGCGCGCGCGCGCTCGCACAGG + Intronic
1113737709 13:112690157-112690179 GGGGCCGCGCGCGCGCGCTCTGG - Intergenic
1116186787 14:41608215-41608237 GTGCAAGTGCGCGCGCGCCCGGG + Exonic
1117721910 14:58637226-58637248 GTGCGCGCGCGTGCGCGCTTTGG - Intronic
1118323157 14:64765036-64765058 GTGTGTGCGCGCGCGCGCGCGGG + Intronic
1118323159 14:64765042-64765064 GCGCGCGCGCGCGCGGGTGGTGG + Intronic
1119325275 14:73756296-73756318 GCGCGCGCGCGTGCGCGCTGAGG + Intronic
1119539316 14:75428253-75428275 GTGGGTGCGAGGGCGCGCGCTGG + Intronic
1120834582 14:89028021-89028043 GTGTGCGCGCGCGCGCGGACAGG - Intergenic
1120881059 14:89416120-89416142 GCGTGCGCGCGCGCGCGTGCTGG - Intronic
1121253097 14:92513946-92513968 GTCCCCGCGCGCGGGCGCCCCGG - Exonic
1122265916 14:100546761-100546783 GTGCGCGCGCGCGCGCGCGCCGG - Intronic
1122275120 14:100587200-100587222 GGGCGCGGGCGCGGGCGCGGAGG - Intronic
1122940273 14:104978115-104978137 CTACGCGCGAGGGCGCGCGCCGG - Intronic
1122993334 14:105249105-105249127 GTGGGCGCGCGCGGGCGCGGGGG - Intronic
1122993336 14:105249107-105249129 GCGTGGGCGCGCGCGGGCGCGGG - Intronic
1124109527 15:26773150-26773172 GAGCGCGCGCGGGCGCGGGGCGG + Intronic
1124696927 15:31870932-31870954 GAGCGGGCTCGCGGGCGCGCGGG - Intergenic
1125201017 15:37100746-37100768 GCGCGCGCGCGCGCGCGAACAGG + Intronic
1125201111 15:37101355-37101377 GCGCGCGCGCACGGGCGCGCGGG - Intergenic
1126393923 15:48191615-48191637 GTGTGCGCGCGCGCGTTTGCAGG - Exonic
1126766478 15:52016049-52016071 GCGCGCGCGCGCGCGCGCGATGG - Intronic
1127415135 15:58749925-58749947 GGGCGCGCGCATGCGCGCGGGGG + Exonic
1127931642 15:63600982-63601004 GCGCGCGCGGGCGCGGGGGCTGG - Intronic
1127931643 15:63600986-63601008 GCGGGCGCGCGCGGGCGCGGGGG - Intronic
1127931645 15:63600988-63601010 CGGCGGGCGCGCGCGGGCGCGGG - Intronic
1128791140 15:70434715-70434737 GTGTGCGCGCGCGCGCGCGCGGG - Intergenic
1129503207 15:76059798-76059820 GGGCGCGCGCGCGCGGCCGGCGG + Intergenic
1129644848 15:77420259-77420281 GTGAGCACGCGCGCGCTCACGGG + Intergenic
1130348117 15:83067287-83067309 GTGCGGGGGCGCGCGCGGTCAGG - Exonic
1130849322 15:87778448-87778470 GCGCGCGCGCGCGTGCACACAGG - Intergenic
1131263627 15:90902988-90903010 GTGCGCGCGCGGGAGGGCTCCGG + Exonic
1132055548 15:98648510-98648532 TCGCGCGCGCGCGCGCGCCCTGG - Intergenic
1132527717 16:425898-425920 CGGCGCGGGCGGGCGCGCGCGGG - Exonic
1133020201 16:2963807-2963829 GTGCGAGCGCGTGCGTGCACTGG + Intergenic
1133218441 16:4307596-4307618 GTGACCTCGCGGGCGCGCGCCGG - Intergenic
1136399876 16:30011447-30011469 GTGGCCGCGCGCGCGGGCGGGGG - Intronic
1137261207 16:46831273-46831295 GCGCGTGCGCGAGCTCGCGCGGG + Exonic
1138229076 16:55324624-55324646 GAGAGTGCGCGCGCGCGCACGGG + Exonic
1138229077 16:55324628-55324650 GTGCGCGCGCGCGCACGGGCTGG + Exonic
1138478063 16:57283809-57283831 GTGGGCGCCCGCGCGGGAGCCGG - Intronic
1138539852 16:57681374-57681396 GTGCGCGCGTGCGTGCGCGCAGG + Intronic
1138956860 16:61981682-61981704 GCGCGCGCGCGCGTGCGCTTGGG + Intronic
1139468273 16:67165427-67165449 GTGTGCGCGCGCTGGAGCGCAGG + Intronic
1139472241 16:67184447-67184469 GCCCGCGCCCGCGCTCGCGCCGG - Exonic
1140225123 16:73070909-73070931 GCGCGCGCGCGCGCGCAAGACGG - Intergenic
1140462248 16:75148961-75148983 TCCCGCGCGCGCGCGCCCGCCGG - Intronic
1141068473 16:80932556-80932578 GGCCGCGCGCGCGCACACGCCGG + Intergenic
1141116613 16:81315018-81315040 GGCCGGGCGGGCGCGCGCGCAGG + Exonic
1141647277 16:85374540-85374562 GTGTGCGCGCGCGCGTGCACAGG + Intergenic
1141990212 16:87604985-87605007 GTGTGTGTGCGCGCGCGTGCAGG + Intronic
1141990213 16:87604991-87605013 GTGCGCGCGCGTGCAGGCACAGG + Intronic
1142509640 17:385755-385777 GTGCGCGCCGGGGCGGGCGCTGG + Intronic
1142704226 17:1684402-1684424 GTGCGCGCGCGCAGGCGGGTGGG - Intronic
1142704230 17:1684410-1684432 GGGCGGGTGTGCGCGCGCGCAGG - Intronic
1143102603 17:4512638-4512660 GTGTGTGCGTGCGCGCGCACGGG + Intronic
1143172864 17:4940045-4940067 CTGCGCGCCTGCGCCCGCGCCGG - Exonic
1143183492 17:4997906-4997928 GGACGCGCGAGCGCGCGCGGAGG - Intergenic
1144172837 17:12676232-12676254 GTGTGTGTGCGTGCGCGCGCAGG - Intronic
1144757146 17:17686601-17686623 GTGTGTGTGCACGCGCGCGCCGG + Intronic
1144764059 17:17723516-17723538 GTAAGAGTGCGCGCGCGCGCAGG - Intronic
1145963865 17:28903095-28903117 GTGCGCGTGCGGGTGCGCGCCGG + Intergenic
1146033919 17:29390225-29390247 GCGCGCGCGCGCGCCCTCACAGG - Intergenic
1146053316 17:29568695-29568717 GGGCGCGCGCGCTCCCTCGCTGG + Exonic
1146601968 17:34225231-34225253 GTGCGCGCGTGCGCGCGTGTTGG - Intergenic
1147139487 17:38453453-38453475 GTGTGTGTGCGCGCGCGCGCTGG + Intronic
1147139488 17:38453457-38453479 GTGTGCGCGCGCGCGCTGGAAGG + Intronic
1147150428 17:38510793-38510815 CTGTGCGCCCGCGCGCCCGCAGG - Exonic
1147168667 17:38605879-38605901 GTGTGGGTGAGCGCGCGCGCGGG + Exonic
1147168671 17:38605947-38605969 GTGTCTGCGCGCGCGCGGGCCGG + Intergenic
1147168673 17:38605953-38605975 GCGCGCGCGCGGGCCGGCGCGGG + Intergenic
1147742747 17:42678130-42678152 ACGCGCGCGCGCGCCCGCGGAGG - Intergenic
1147864956 17:43545977-43545999 GTGTACGCGCGCGCGCGCGGAGG + Intronic
1147884505 17:43675728-43675750 GTGTGCACGCGCGCGCATGCAGG + Intergenic
1148284058 17:46372676-46372698 GGGCGCGCGCGCGGGCTCGGCGG - Intergenic
1148306279 17:46590597-46590619 GGGCGCGCGCGCGGGCTCGGCGG - Intergenic
1148388681 17:47254380-47254402 GTGAGAGCGTGCGCGCGCGCGGG + Intronic
1148563406 17:48619262-48619284 GTGTGTGTGCGCGCGCGCGCAGG + Intronic
1148781521 17:50124748-50124770 GCGCGCGCGTGCACGCGTGCAGG - Intronic
1148818258 17:50346071-50346093 GCGAGCGCGCGCACGGGCGCGGG - Exonic
1149512662 17:57256339-57256361 GTGTGCGCGCGCGGGCAGGCGGG + Intronic
1149512664 17:57256341-57256363 GTGCGCGCGCGGGCAGGCGGGGG + Intronic
1150643390 17:66964402-66964424 GAGAGAGCGCGCGCGGGCGCGGG + Intergenic
1150643392 17:66964406-66964428 GAGCGCGCGCGGGCGCGGGGAGG + Intergenic
1151490923 17:74432023-74432045 GTGTGCGCGCGCCCGCATGCGGG + Exonic
1151490925 17:74432025-74432047 GTGCGCGCGCCCGCATGCGGGGG + Exonic
1152034746 17:77865212-77865234 GTGCGCCCGCGCGTGTGCGTGGG - Intergenic
1152797630 17:82315952-82315974 GTGCGCGTGTGCGCGTGTGCAGG - Intronic
1153457515 18:5296220-5296242 GCGCGTGCGCGCGCGTGCGCAGG - Intronic
1153688628 18:7568726-7568748 GTGTGCCTGCACGCGCGCGCGGG + Intronic
1153688630 18:7568728-7568750 GTGCCTGCACGCGCGCGCGGGGG + Intronic
1153923166 18:9809050-9809072 GTGTGTGCGCGCGCACGCGTGGG + Intronic
1154940912 18:21111858-21111880 CAGAGTGCGCGCGCGCGCGCGGG - Intergenic
1154954285 18:21240558-21240580 GTGCGCGCGCGCGCGCGGGCGGG - Intergenic
1154954287 18:21240562-21240584 GTGTGTGCGCGCGCGCGCGCGGG - Intergenic
1155392166 18:25349781-25349803 GTGCGCCCGCCCGGGCCCGCTGG - Intronic
1156099776 18:33578854-33578876 GTGTGTGCGTGCGCGCGCGGAGG + Intronic
1156321138 18:36024149-36024171 GTGCACGCGCACGCGCGTGATGG + Intronic
1157263888 18:46200084-46200106 GTGTGTGTGCGCGCGCGTGCTGG + Intronic
1157384229 18:47248078-47248100 GTGGGCGCGGGCGCGGGGGCGGG - Intronic
1157384233 18:47248084-47248106 GTGGGCGTGGGCGCGGGCGCGGG - Intronic
1158427474 18:57352713-57352735 GTGAGCGCGCGCGCGTGTGGCGG - Exonic
1160024768 18:75208726-75208748 CTGTGCGCCCGAGCGCGCGCCGG + Intronic
1160204518 18:76822323-76822345 GGGCGCGGGCGCGGGCGCGGTGG - Intergenic
1160204582 18:76822520-76822542 GGGCGCGCACGCGCGGGCACCGG - Intergenic
1160429132 18:78799603-78799625 GTGCGCGCGCGCGTGTGCAGTGG - Intergenic
1160500708 18:79400119-79400141 CTGCGGTCGCGCGCGCGCGAGGG + Intronic
1160680340 19:409215-409237 GGGGGCGCGGGCGCGGGCGCGGG - Intergenic
1160714976 19:572462-572484 GAGCGTGTGCGCGCGTGCGCAGG + Intronic
1160714978 19:572466-572488 GTGTGCGCGCGTGCGCAGGCGGG + Intronic
1160736137 19:663198-663220 GTGAGCGTGCGCGGGCGCGTCGG - Exonic
1160853607 19:1206198-1206220 GTGCGGGCCCTCGCGGGCGCCGG + Intronic
1160858717 19:1228724-1228746 GTGCGCGAGCTCGCCCGGGCGGG - Exonic
1160873225 19:1286309-1286331 GTGAGCGCGGCCGCGCGCGGGGG + Intronic
1160896871 19:1407307-1407329 GCGTGCGTGCGCGCGCGTGCGGG - Intergenic
1160896932 19:1407538-1407560 GAGCGCGCCCGGGCGTGCGCAGG + Intergenic
1160967552 19:1753313-1753335 CTGCGCCCGCCCGCGCCCGCTGG - Exonic
1161006723 19:1940930-1940952 GTGGCCGCGAGGGCGCGCGCGGG - Intergenic
1161388089 19:4007599-4007621 GTGGCCGCGCGCGCCTGCGCAGG + Intergenic
1161572001 19:5035887-5035909 GCGCGCGCGCCTGCGCGCACAGG + Intronic
1161643068 19:5436358-5436380 GTGTGCGCGCGCGCGCGTGCGGG + Intergenic
1161643070 19:5436362-5436384 GCGCGCGCGCGCGTGCGGGGAGG + Intergenic
1161752555 19:6109034-6109056 GTGTGCGCCCGCGAGCGCGCTGG + Intronic
1161802574 19:6424365-6424387 TCACGTGCGCGCGCGCGCGCAGG - Intronic
1161802585 19:6424402-6424424 GCTCGCGCGCGCGCGCAGGCGGG - Intronic
1161802587 19:6424406-6424428 GCGCGCTCGCGCGCGCGCGCAGG - Intronic
1161840620 19:6678117-6678139 GGGCGGTCGCGCGCACGCGCAGG + Intronic
1162393827 19:10404892-10404914 GTCCGTGCGCGCGCGTGCCCGGG - Intronic
1162461762 19:10817821-10817843 GCGCGCGCACGCGTGCGTGCCGG + Intronic
1162485962 19:10960847-10960869 GGACGGGCGCGCACGCGCGCCGG + Intergenic
1162584514 19:11550920-11550942 GTGTGCACGCGCGCGCGCATTGG - Intergenic
1162742688 19:12782649-12782671 GTGCGCGCGTGCGTGGGCGGTGG + Intronic
1163369810 19:16895878-16895900 GCGCGCGCGCGCGCGCATACGGG - Intronic
1163390762 19:17028421-17028443 GTGTGTGCGTGCACGCGCGCAGG + Intergenic
1163804128 19:19385920-19385942 GGGGGTGCGCGTGCGCGCGCCGG - Exonic
1164658573 19:29942450-29942472 GAGGGCGGGCGCGCGGGCGCTGG + Exonic
1165080220 19:33302497-33302519 GTGCGCGGGCGCGGGCGAGCAGG - Exonic
1165349489 19:35268421-35268443 GGGCGGGCGCGCGCGAGCCCGGG - Intergenic
1165349924 19:35269726-35269748 GGGCGGGCGGGCGGGCGCGCCGG + Intronic
1165390161 19:35534182-35534204 GTGTGTGTGTGCGCGCGCGCGGG - Intronic
1165696730 19:37906694-37906716 GCGCGCGCGCGTTCTCGCGCCGG - Intergenic
1166107744 19:40605689-40605711 GTGAGCGCGCCCCCGCGCGGAGG - Intronic
1166126019 19:40715863-40715885 GTGTGTGTGCGCGCGCGCGTTGG + Intronic
1166304192 19:41928391-41928413 GAGCGCGGGCGGGCGCGCGCCGG + Intronic
1166754036 19:45179594-45179616 GAGCGCGCGGGGGCGGGCGCCGG - Exonic
1166780787 19:45341575-45341597 GTGTGCGCGCGCGCGTGTGGTGG + Intronic
1166802585 19:45467640-45467662 GCGCGCGCGCGAGCGAGCGAGGG + Intronic
1166975052 19:46601104-46601126 GCGAGCGCGCGCGCGCCCGGCGG + Intronic
1167018949 19:46860562-46860584 GGGCGAGCGCGCGTGCGCGGGGG - Intergenic
1167018951 19:46860564-46860586 ATGGGCGAGCGCGCGTGCGCGGG - Intergenic
1167079947 19:47271745-47271767 GCGCGCGCGCGCGCGCTAGAGGG + Exonic
1167156812 19:47743607-47743629 GTGTGCGCGCGCTCACGCACCGG + Intergenic
1168011638 19:53538090-53538112 GTGCGCGTGCGCATGCGCGCTGG + Intronic
1168076437 19:53982879-53982901 GCGCGCCCGCGCACGCGCCCCGG - Exonic
1168093729 19:54102675-54102697 CTGCGCGAGTGCGCACGCGCAGG + Exonic
1168336526 19:55600356-55600378 GTGCGCGCGCGCGGGGGCAACGG - Intronic
1168408021 19:56120862-56120884 GGGCGCGCGCGTGCGCGTGGCGG - Intronic
925532254 2:4877115-4877137 GTGTGTGCGCGCGCGCGCCTGGG - Intergenic
926020182 2:9487834-9487856 GCGCGCGCGCGCGCGCGCTGTGG + Intronic
926206527 2:10837916-10837938 GTGTGTGTGCGCGCGCACGCAGG + Intronic
926820053 2:16842052-16842074 GTGCGCGCGCGGACGCACACAGG - Intergenic
926923576 2:17963770-17963792 GTGCGCGCGCGCGCGCGTCCAGG + Intronic
929033709 2:37671803-37671825 GTGGCCGGGCGCGCGCGCGGGGG + Exonic
929313280 2:40450364-40450386 GTGTGTGCACGCGCGCGCGCTGG + Intronic
929313282 2:40450368-40450390 GTGCACGCGCGCGCGCTGGTGGG + Intronic
929313570 2:40452149-40452171 GCGCGCGCGCGCCCGGGCCCCGG - Intronic
929313571 2:40452155-40452177 GGGGGAGCGCGCGCGCGCCCGGG - Intronic
929468619 2:42169313-42169335 CTGCGCGCGGGCGCGGGGGCGGG + Intergenic
929667815 2:43846975-43846997 GTGTGTGCACGCGCGCGTGCAGG - Intronic
929776644 2:44934626-44934648 AGGCGCGCGCGCGCGCTTGCGGG - Intergenic
929788674 2:45009126-45009148 GAGGGCGCGCGCGGGCGGGCGGG - Exonic
929974124 2:46616045-46616067 GCACACGCGCGCGCGCGCGTGGG + Intronic
929974126 2:46616051-46616073 GCGCGCGCGCGCGTGGGCGGAGG + Intronic
930158849 2:48132581-48132603 GTGCACGCGCGCGCACGCATAGG - Intergenic
930872694 2:56184420-56184442 GGGAGCGCGGGCGCGCGCGCGGG + Exonic
931649374 2:64454398-64454420 GGGCGCGCGCGCGCGCGCCCGGG - Exonic
931867127 2:66425559-66425581 GCGCGCGCGCGCGCGCGTTCCGG - Intergenic
932231368 2:70086955-70086977 GTGCGCGCGGGCGGGCACGTGGG - Intergenic
933817235 2:86077796-86077818 GTGTGTGCGCGCGCGCGTGCAGG - Intronic
935301661 2:101698144-101698166 GGGCCCGCGAGCGGGCGCGCGGG + Intronic
935408573 2:102735829-102735851 GTGTGCGCGCGCGCGTGTCCTGG - Intronic
935595359 2:104873518-104873540 GTGAGTGCGAGTGCGCGCGCGGG - Intergenic
936038143 2:109128963-109128985 GTGCGCGGGGGTGCGCGCGGAGG - Intergenic
937221744 2:120346066-120346088 GGGCGGGCGCGGGCGCGGGCGGG + Intergenic
938900482 2:135795030-135795052 GTGTGTGCGCGCGCGCGCGTGGG - Intronic
941020934 2:160407556-160407578 GCGGGCGCGGGCGCGGGCGCGGG + Intronic
941686920 2:168456651-168456673 GTGCGCGCGTGTGTGTGCGCAGG - Intronic
942034728 2:171999843-171999865 GGGAGCGCGCGTGCGCGCGCGGG - Exonic
942890327 2:180980477-180980499 GAGCGCGCACGGGAGCGCGCGGG + Intronic
942970680 2:181954297-181954319 GTGTGTGTGTGCGCGCGCGCGGG - Intronic
944242616 2:197500324-197500346 GGGCGAGCGCGCCTGCGCGCTGG + Exonic
944272946 2:197804370-197804392 GTTTGCACACGCGCGCGCGCGGG + Intergenic
944675548 2:202032656-202032678 GGGCGCTCGCGCGCGCTCTCTGG - Intergenic
944683637 2:202098818-202098840 GTGCACGCGCGCGCGCGCGCAGG + Intronic
945033357 2:205684937-205684959 GTGTGCGCGCTCGCGCGCTGGGG - Intronic
945033359 2:205684939-205684961 GTGTGTGCGCGCTCGCGCGCTGG - Intronic
945203696 2:207310047-207310069 GTGCGCGCGCGCGCGCACGCAGG - Intergenic
945699439 2:213151849-213151871 GCGCGTGTGCGCGCGCGCGCGGG + Intronic
945699440 2:213151853-213151875 GTGTGCGCGCGCGCGCGGGCTGG + Intronic
945699442 2:213151857-213151879 GCGCGCGCGCGCGGGCTGGCGGG + Intronic
947625290 2:231614816-231614838 GTGCGTGCGCGCGCGCGCGCGGG - Intergenic
948640453 2:239372479-239372501 GTGTGCGCGCGTGTGTGCGCGGG - Intronic
948910068 2:240998497-240998519 GTGGGAGGGCGCGGGCGCGCGGG - Intergenic
948910139 2:240998719-240998741 GGGAGCGCGGGCGCGCCCGCTGG - Intergenic
1168965444 20:1895386-1895408 GTGCGCGCTCGGGCGGGAGCAGG - Intronic
1169171725 20:3470942-3470964 GTACTCGCGCACGCGCGCGCCGG + Intergenic
1169758873 20:9069291-9069313 GTGCGCGCGCGCGCGCGTCCGGG - Intronic
1171237051 20:23535489-23535511 GTGTGTGTGTGCGCGCGCGCGGG - Intergenic
1172489224 20:35321286-35321308 GCGCGCGCGCGCGCACGCTCAGG + Intronic
1172526581 20:35603360-35603382 GTGCGCGCGTGTGCGTGTGCAGG - Intergenic
1173649049 20:44651552-44651574 GTGAGCGCGCGCGGGGGCTCCGG - Intronic
1173807477 20:45935135-45935157 TTTGGCGCGCGCGCGCGCGCCGG - Intronic
1173807494 20:45935192-45935214 GTGCGCGCGCGCGCGCGCGCTGG + Intronic
1173939117 20:46894935-46894957 GTGCGGGCGGGCGGGCGGGCCGG - Exonic
1174136474 20:48383777-48383799 GTGCACATGCGCGCGTGCGCTGG + Intergenic
1174467856 20:50731392-50731414 GTGAGCGCGCGCACGCGCCGCGG + Intergenic
1174467865 20:50731430-50731452 GTGCGCGCGCGCGGGCTCGCGGG + Intergenic
1174467867 20:50731432-50731454 GCGCGCGCGCGGGCTCGCGGGGG + Intergenic
1175808069 20:61841765-61841787 GTGCGCGCGTGCGCGCACCGTGG + Intronic
1175841312 20:62029469-62029491 GTGTGCGCGCGCGCGCACGTGGG - Intronic
1175856145 20:62122135-62122157 GAGCGCGCGTGCGCGTGGGCGGG - Intergenic
1175859549 20:62143095-62143117 GGGCGCCCGCGGGCGTGCGCGGG - Intronic
1175859792 20:62143925-62143947 GTCTGCGGGCGGGCGCGCGCGGG + Intronic
1175911504 20:62407314-62407336 GGGCGCGCGGGCGCGCGGGCAGG - Intergenic
1175911505 20:62407318-62407340 CGGCGGGCGCGCGGGCGCGCGGG - Intergenic
1176131731 20:63499201-63499223 GGGCGCGGACGCGCGCGGGCGGG + Exonic
1176178537 20:63739520-63739542 GGGCGCGCGGGCGCGCGAGGTGG + Intronic
1176194556 20:63831256-63831278 GCGGGCGCGGGGGCGCGCGCCGG - Intergenic
1176194571 20:63831295-63831317 GGGCGCGCGCGCGCGGGCGGCGG - Intergenic
1176547891 21:8209278-8209300 GGGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176548953 21:8213385-8213407 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
1176550494 21:8218947-8218969 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1176550496 21:8218949-8218971 GCGCGCGCGCGTGCGTGCGGGGG + Intergenic
1176555787 21:8253491-8253513 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176556846 21:8257597-8257619 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
1176566819 21:8392289-8392311 TGGCGCCCGCGGGCGCGCGCAGG - Intergenic
1176566824 21:8392311-8392333 ATGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176567882 21:8396419-8396441 GGGCGGGCGCGCGTACGCGCGGG - Intergenic
1176569424 21:8401986-8402008 GCGCGCGCGCGCGCGCGTGCGGG + Intergenic
1176569426 21:8401988-8402010 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1176574724 21:8436525-8436547 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176575786 21:8440638-8440660 GGGCGGGCGCGCGTACGCGCGGG - Intergenic
1176577336 21:8446217-8446239 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1176577338 21:8446219-8446241 GCGCGCGCGCGTGCGTGCGGGGG + Intergenic
1176611338 21:8987818-8987840 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1177077013 21:16588646-16588668 GTGCGCGCGCGTGCTCGCTCGGG + Intergenic
1178021870 21:28417460-28417482 GTGTGTGTGTGCGCGCGCGCAGG + Intergenic
1178021871 21:28417468-28417490 GTGCGCGCGCGCAGGTGTGCAGG + Intergenic
1178708196 21:34890784-34890806 GCGCGCGCCCGCCCGCCCGCAGG + Intronic
1179150536 21:38805512-38805534 GTGCGCGCGAGTGTGCGCCCTGG - Exonic
1179444227 21:41420286-41420308 GGGGGCGCGGGCGCGGGCGCGGG + Intronic
1179444228 21:41420290-41420312 GCGCGGGCGCGGGCGCGGGCAGG + Intronic
1179569250 21:42268381-42268403 GTGTGTGTGCGCGCGCGCGCTGG + Intronic
1180949459 22:19714644-19714666 GCGCGCGCGGGCACGCGGGCAGG - Intronic
1181574892 22:23787365-23787387 GGGCGCGCGCGCGCGCGCTCGGG + Intronic
1182041635 22:27242811-27242833 GTGTGTGCGCGCGTGCGCGGGGG - Intergenic
1182041637 22:27242813-27242835 GTGTGTGTGCGCGCGTGCGCGGG - Intergenic
1182149504 22:28018287-28018309 GCGCGCGTGTGTGCGCGCGCGGG + Intronic
1182586298 22:31346016-31346038 GCGCGCGCGCGCCTGCGCGGCGG - Exonic
1183504736 22:38202713-38202735 GTGTCCGCGCGCGCGCTCCCTGG + Intronic
1184337509 22:43862426-43862448 GCGCGGGCGCGGGCGCGTGCGGG - Exonic
1184337511 22:43862436-43862458 GCGGGCGCGGGCGCGGGCGCGGG - Exonic
1184662491 22:45971850-45971872 GTGCCCGCGGGCCCTCGCGCTGG + Intronic
1185037912 22:48489404-48489426 GCGGGCGCGGGCGCGAGCGCGGG + Intergenic
1185255202 22:49827757-49827779 GCGCCCGCGCCCGCGCCCGCCGG - Intergenic
1185255204 22:49827760-49827782 GCGGGCGCGGGCGCGGGCGCGGG + Intergenic
1185349401 22:50326781-50326803 GCGCGAGCGCGGGCGCGGGCGGG - Intronic
1185349403 22:50326785-50326807 GCGGGCGCGAGCGCGGGCGCGGG - Intronic
1203252772 22_KI270733v1_random:125576-125598 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203253837 22_KI270733v1_random:129692-129714 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
1203255391 22_KI270733v1_random:135288-135310 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1203255393 22_KI270733v1_random:135290-135312 GCGCGCGCGCGTGCGTGCGGGGG + Intergenic
1203260828 22_KI270733v1_random:170662-170684 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203261893 22_KI270733v1_random:174771-174793 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
949089562 3:11434-11456 GAGGGCGCGCGCGCCGGCGCAGG + Intergenic
950534333 3:13570590-13570612 GTGCGCGGCCGCGTGCCCGCCGG + Exonic
950765419 3:15269660-15269682 GTGTGCGCGTGCATGCGCGCTGG - Intronic
951080323 3:18444838-18444860 GAGCGAGCGAGCGAGCGCGCGGG + Intronic
951110000 3:18792006-18792028 GTGTGCGCGCGCACGCACACAGG - Intergenic
951558860 3:23946027-23946049 GGGGGCGCGCGCGCGCGCGCTGG + Intronic
951558861 3:23946031-23946053 GCGCGCGCGCGCGCGCTGGCTGG + Intronic
953631993 3:44625733-44625755 GTGTGCGCGCGCGCGCGCAAAGG - Intronic
953925398 3:46980022-46980044 GCGCGCGGGCGCGCGCGCGCAGG + Intronic
954256661 3:49412060-49412082 GTGAGTGCGCGCGCGTGCGCGGG - Exonic
954558753 3:51538660-51538682 GTGCGGTCGGGCGCGCGGGCCGG + Intergenic
954779040 3:53045938-53045960 GGGCGCGAGCGGGCGAGCGCGGG - Exonic
955060246 3:55487212-55487234 GGGCGCGGACGCGCGCGAGCCGG + Exonic
956179085 3:66500924-66500946 GCGCGCGCGCGCGCGCTCTCTGG - Exonic
956659449 3:71583630-71583652 GTGCGCGCGCGGGCGGGAGTGGG - Intronic
957792910 3:84961632-84961654 GTGTGTGCGCGCGCGCGCGCCGG + Intronic
958641784 3:96814560-96814582 TTGCGCGCGCGCGCTCTCTCCGG + Intronic
960465936 3:117996887-117996909 GTGCGCGCGCGCGTGTGAACGGG - Intergenic
960702292 3:120450710-120450732 GCTCGCGCTCGCGCTCGCGCTGG - Exonic
960747750 3:120908573-120908595 GTGTTCGCGCGCCCGCGGGCGGG + Intronic
962793954 3:138834914-138834936 GCGCGCGCGCACACGGGCGCGGG - Intronic
963160757 3:142149144-142149166 GGGCGCGGGCCCGCGCGCGGAGG - Intronic
963335713 3:143971974-143971996 GTGCGCGTGCGCGCGGGCACGGG + Exonic
963741863 3:149088725-149088747 GTGTGTGTGTGCGCGCGCGCGGG - Intergenic
964430471 3:156600518-156600540 GCGCGCGCGCGCGCATGCACTGG + Intergenic
964518859 3:157542597-157542619 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
966182221 3:177197632-177197654 GAGCGGGCGGGCGGGCGCGCGGG + Intergenic
966593003 3:181702016-181702038 GTGCGCGCGCGCGCATGGGGGGG - Intergenic
966593005 3:181702018-181702040 GTGTGCGCGCGCGCGCATGGGGG - Intergenic
966593007 3:181702020-181702042 GTGTGTGCGCGCGCGCGCATGGG - Intergenic
966982733 3:185153058-185153080 GTGCGCGTGCGTGTGCGCGTGGG - Intergenic
967118498 3:186362332-186362354 GTGTGTGTACGCGCGCGCGCCGG - Intergenic
967171791 3:186827562-186827584 GTGCGCCTGCGCGAGCGCGGCGG + Intergenic
968063761 3:195746902-195746924 GTGTGCACGCGCGCGTGCACAGG + Exonic
968434455 4:577143-577165 GTGTGCGCGCGCGTGTGTGCGGG + Intergenic
968556534 4:1248776-1248798 GTGCGAGTGCGCGTGCGCGCCGG - Intronic
968584072 4:1407844-1407866 GAGCGCGCGGGCGCGTGCACCGG + Intergenic
968879833 4:3293165-3293187 GAGGGCGCGGGCGCGCGCCCCGG - Intronic
969330325 4:6470952-6470974 GCGCGAGCGCGGGCGCGGGCGGG - Intronic
969379015 4:6782515-6782537 CTGCGGGCGCGCGCGGGCGGTGG - Intronic
969533819 4:7743791-7743813 GTGTGTGCGCGCGCGCGTGAGGG - Intergenic
970399406 4:15703230-15703252 GGGCGCGCGCGCGGTGGCGCGGG + Exonic
970593188 4:17577179-17577201 GTGCGCCCGCGCATGCGGGCGGG - Exonic
970617442 4:17781352-17781374 GTGCACGTGCGTGCGCGCGCGGG + Exonic
970826545 4:20283105-20283127 GTGTGTGCGCGCGCGCACACAGG - Intronic
971207534 4:24584562-24584584 GCGGAAGCGCGCGCGCGCGCAGG - Intergenic
972499494 4:39664219-39664241 GCGCGCGCGCGCGCGCATGACGG + Intergenic
975701981 4:77075641-77075663 GGGGGCGCGGGCGCGGGCGCTGG + Exonic
975778927 4:77819523-77819545 GGGCTCGCGGGCGGGCGCGCAGG + Intronic
976897466 4:90128515-90128537 GTGCGCGCGCGCGCGCGCTCTGG + Intronic
977908465 4:102502369-102502391 GCGCGCGCGCGCGCGCACGGAGG - Intronic
977937854 4:102827161-102827183 GGGCGCGCGCGGGAGCGCGCTGG - Intronic
978754261 4:112285827-112285849 GGCCGCGCGCGCGGGAGCGCGGG - Exonic
981034458 4:140154504-140154526 GTATGCGCGCGCGCGTGCGCGGG + Intergenic
982000301 4:151015746-151015768 GTGCGCGAGCGCGAGTGCGCGGG + Intergenic
984024116 4:174522520-174522542 CTGCACGCGCGCGCGCGCAGGGG - Exonic
984024118 4:174522522-174522544 GGCTGCACGCGCGCGCGCGCAGG - Exonic
984167447 4:176319908-176319930 GGGCGCGCGCGCGCTCGCGTCGG + Intergenic
985068425 4:186144925-186144947 GCGGGCGCGGGCGCGGGCGCGGG + Exonic
985068427 4:186144931-186144953 GCGGGCGCGGGCGCGGGCGCGGG + Exonic
985068429 4:186144937-186144959 GCGGGCGCGGGCGCGGGCGCGGG + Exonic
985068431 4:186144941-186144963 GCGCGGGCGCGGGCGCGGGCGGG + Exonic
985629862 5:1008781-1008803 CTGAGCGCGTGCGCCCGCGCCGG - Intergenic
985963944 5:3325250-3325272 GTGTGAGCGCGCGCGTGCGTGGG + Intergenic
986957645 5:13173969-13173991 GTGCACGCGCGCGCACGTGCAGG - Intergenic
986976028 5:13395018-13395040 GTGTGCACGCGCGCGCGCACTGG - Intergenic
986976034 5:13395105-13395127 GTGTGCGCGCGCGCGTGCACTGG - Intergenic
986976046 5:13395291-13395313 GCGCGCGCGCACGCGCGCACTGG - Intergenic
987303420 5:16617006-16617028 GCGCGCGCGCGGGCGCGCCTGGG + Exonic
987901085 5:24013042-24013064 GTGTGTGTGCGCGCGCGCGCAGG + Intronic
987901086 5:24013048-24013070 GTGCGCGCGCGCGCAGGCTGTGG + Intronic
989178907 5:38556769-38556791 GCGCGCGCGGGCGCGCGGCCGGG - Intronic
989178910 5:38556772-38556794 GGCCGCGCGCCCGCGCGCGCGGG + Intronic
992286112 5:75236993-75237015 GAGGCCGCGCGCGCGCGCGCAGG + Intergenic
992487596 5:77210887-77210909 GCGGGCGCGGGCGGGCGCGCGGG + Exonic
992487598 5:77210889-77210911 GGGCGCGGGCGGGCGCGCGGGGG + Exonic
992550072 5:77851553-77851575 ATACACGCGCGCGCGCGCACGGG - Intronic
993501931 5:88674934-88674956 GTGCGCGGGCACGCACACGCCGG + Intergenic
993550711 5:89270424-89270446 GTGTGCGCGCGCGCGCATGCTGG - Intergenic
993919146 5:93779125-93779147 GCGCGCGCGCGCGCACGTGCAGG + Intronic
994367113 5:98928824-98928846 GAGCGGGAGCGCGCGCGCGACGG - Exonic
995787105 5:115841912-115841934 GAGCGCGCGCGGTCGCGTGCGGG + Exonic
997237158 5:132279342-132279364 GTGCGCGCGCGCGCGCGCGTGGG - Intronic
997459874 5:134044655-134044677 GTGTGTGTGCGCGCGCGCACAGG + Intergenic
997582966 5:135028714-135028736 GGGCGCGGGCGCGGGCGCGGAGG - Exonic
998083355 5:139294464-139294486 GCGCGCGCGCGCGTGTGGGCCGG - Intronic
998083356 5:139294468-139294490 CCGCGCGCGCGCGCGCGTGTGGG - Intronic
998131267 5:139652145-139652167 GCGCGCGCGCGCGCGCGCGCCGG - Intronic
998583232 5:143402759-143402781 GGGCTCGCGCTCGGGCGCGCCGG + Intronic
999129444 5:149271793-149271815 GGGCGGGCGCGGGCGCGGGCGGG + Intergenic
999239131 5:150117521-150117543 GCGCGCGCGCGCGCGCTGCCAGG - Intronic
999798779 5:155013685-155013707 GCGCGCACGTCCGCGCGCGCAGG - Intergenic
1000220535 5:159209615-159209637 GAGCGCGGGCGCGCGCGGGAGGG - Intronic
1000220537 5:159209619-159209641 GAGTGAGCGCGGGCGCGCGCGGG - Intronic
1000463315 5:161547823-161547845 GTGCGCGCGGGTGCGCGCAGCGG - Intronic
1002058836 5:176614170-176614192 GTGTGTGTGTGCGCGCGCGCAGG - Intergenic
1002488760 5:179559098-179559120 GTAAACGCGCGCGCGCGCCCGGG + Intronic
1002515250 5:179753223-179753245 GCGCGCGCGCGCGCGCGTGCTGG + Intronic
1002515252 5:179753225-179753247 GCGCGCGCGCGCGCGTGCTGGGG + Intronic
1002559739 5:180072914-180072936 GTGTGCGCGCGCGCGCGTTTCGG - Intergenic
1002754698 6:148157-148179 GTGCGTGCCCGCGCCGGCGCGGG - Intergenic
1002887765 6:1311797-1311819 GTGTGCGTGTGTGCGCGCGCGGG - Intergenic
1002991741 6:2245294-2245316 GTGCGGGGGCGGGGGCGCGCCGG - Intronic
1004069728 6:12287754-12287776 AGGCGCGCGCGCGCGCGCGCAGG + Intergenic
1004720445 6:18264216-18264238 GGGCGGGCGCGCGCGCACGCGGG - Intronic
1004767717 6:18749550-18749572 GCGCGCGCGCACGCGCGCGCAGG - Intergenic
1006125373 6:31834555-31834577 GCGCGCGCCCGCGCGCGCGCGGG + Intergenic
1006136206 6:31897583-31897605 ATGCCCGCGCGCGCGCCCGGGGG - Intronic
1006204684 6:32330040-32330062 GTGCGCGCGCGCACGTGTGTTGG + Intronic
1006271984 6:32972075-32972097 GCGCGCGCGCTCGCTCACGCGGG - Exonic
1006271987 6:32972082-32972104 GAGCGAGCGCGCGCGCGCGGAGG + Exonic
1006787942 6:36680275-36680297 ACACGCACGCGCGCGCGCGCCGG - Intronic
1007451313 6:41941776-41941798 CGGCGCGCGCGCGCGGGCGGCGG - Exonic
1007633585 6:43285511-43285533 GTGCTCGCGCGCGTCCTCGCGGG - Exonic
1007702067 6:43771374-43771396 GTGCGTGCGAGCGCGCGCGTGGG + Intronic
1007885788 6:45228582-45228604 GTGTGTGTGTGCGCGCGCGCGGG - Intronic
1010235577 6:73572515-73572537 GTGCGGGCGCACGCACGCACTGG - Intergenic
1011277200 6:85642968-85642990 GCGGGGGCGCGCGCGCGCACCGG - Exonic
1011281135 6:85678931-85678953 GTGCGCCTGCGGGCGCGCGCCGG - Intergenic
1011640469 6:89412323-89412345 GAGCGCGCGCGCGCCCGTGCGGG - Intergenic
1012872897 6:104693053-104693075 GTGTGCACGCGCGCGCGCGCTGG + Intergenic
1012872899 6:104693055-104693077 GTGCACGCGCGCGCGCGCTGGGG + Intergenic
1012886513 6:104852227-104852249 GTGCGCGCGTGCGCGTGCACGGG + Intronic
1013507567 6:110815234-110815256 GCGCGCGCGCGCGCGAGAGGCGG - Exonic
1013836419 6:114341584-114341606 ACGCGCGCGCGCGCGCGGGATGG - Intronic
1013836420 6:114341588-114341610 ACACACGCGCGCGCGCGCGCGGG - Intronic
1014632353 6:123803243-123803265 GTGTGTGCGCGCGCGCTCGGGGG - Intergenic
1014632355 6:123803245-123803267 GTGTGTGTGCGCGCGCGCTCGGG - Intergenic
1015626036 6:135181568-135181590 GGGGGCGCGCGGGGGCGCGCGGG + Intronic
1017163830 6:151390435-151390457 GCGAGCGCGCGCGCGCACGCGGG - Intronic
1017671974 6:156777720-156777742 GCGCGGGCGCGGGCGCGGGCAGG + Intergenic
1018154441 6:160972777-160972799 GTGCGTGCGCGTGCGCGCAATGG - Intergenic
1018329954 6:162716751-162716773 GCGTGCGCGCGCGCGCAGGCGGG - Intronic
1018329956 6:162716755-162716777 GTGTGCGTGCGCGCGCGCGCAGG - Intronic
1018400017 6:163413534-163413556 GTGCGCACGCGTGTCCGCGCAGG + Intergenic
1019474537 7:1237578-1237600 GTGCGCGCGGGGGCGCGCGGCGG - Intergenic
1019562382 7:1665313-1665335 GTGAGCGCGCGCGTCCGCGAGGG - Intergenic
1019703302 7:2485140-2485162 GCGCGCGCGCGCGCGTGTGAGGG - Intergenic
1019828425 7:3301889-3301911 GTGCGCGCGGGGTCGCGGGCCGG + Intronic
1020066214 7:5190365-5190387 GAGGGCGCGCGCGCGAGGGCGGG - Exonic
1020253002 7:6484189-6484211 CTGCCGGCGCGCGCGCGCGCGGG + Exonic
1020253004 7:6484192-6484214 TGCCCCGCGCGCGCGCGCGCCGG - Exonic
1020347620 7:7182614-7182636 GAGCGGGCGGGAGCGCGCGCTGG + Exonic
1021107625 7:16656540-16656562 GTGTGTGCGCGCGCGCGCTGGGG - Intronic
1021107627 7:16656542-16656564 GTGTGTGTGCGCGCGCGCGCTGG - Intronic
1022230748 7:28410062-28410084 GGGCGGGTGGGCGCGCGCGCAGG + Intronic
1022715190 7:32892001-32892023 AGGCGCGCGCGCGCGCGAGGCGG - Intronic
1022923438 7:35037747-35037769 GTCCGCGCGTGCGCGCTGGCCGG - Intronic
1023447680 7:40248869-40248891 GTGCGAGCGCGCGCGCGCGCTGG - Intronic
1023638607 7:42237200-42237222 GTGCGAGTGTGCGAGCGCGCCGG + Intronic
1023972157 7:44999803-44999825 GCGCGCGCGGGAGCGCGCGCGGG - Intronic
1026000350 7:66556272-66556294 GGGCGCGGGCGCGGGCGCGAGGG - Intergenic
1026522744 7:71131497-71131519 GTGCGCGCGCGCACCCGGGCAGG - Intergenic
1027774130 7:82443756-82443778 GAGCGAGAGCGCGCGAGCGCCGG - Exonic
1029449595 7:100633393-100633415 GTGAGTGCGCGCGCGGGCGGGGG - Intronic
1029496324 7:100896987-100897009 GCGTGCGTGCGCGCGCGCGGCGG + Intergenic
1029496326 7:100896993-100897015 GTGCGCGCGCGCGGCGGTGCGGG + Intergenic
1029536992 7:101162942-101162964 GCGCCGGCGCGCGCGCGCGGCGG + Exonic
1030093345 7:105876744-105876766 GTCCGCGCCCGCCCGCCCGCCGG + Intergenic
1031213281 7:118858667-118858689 GAGCGCGCGCGCGCGCGCGTGGG - Intergenic
1032013411 7:128360970-128360992 GTGTGCGCGCGCGCGTGCAGGGG - Intronic
1032013413 7:128360972-128360994 GTGTGTGCGCGCGCGCGTGCAGG - Intronic
1033361152 7:140640080-140640102 GTGCGTGCGCGTGCAAGCGCGGG - Intronic
1034147328 7:148884468-148884490 GCGCGTGCGCGCGCGGGCGGCGG + Intergenic
1034147330 7:148884472-148884494 GTGCGCGCGCGGGCGGCGGCGGG + Intergenic
1035212801 7:157340988-157341010 GTGTGTGTGTGCGCGCGCGCAGG + Intronic
1036578821 8:10054386-10054408 GGGCGCGGGCGGGCGGGCGCGGG - Exonic
1036930602 8:12951952-12951974 GGGGGAGCGCGCGCGCGGGCCGG - Intronic
1037878411 8:22560871-22560893 GTGCGCGCGCGCACGCGCCGTGG + Intronic
1037900476 8:22685425-22685447 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
1037900478 8:22685429-22685451 GCGCGCGCGCGCGCGCGGGGAGG + Intergenic
1038359756 8:26865103-26865125 GTGAGAGCGCGCGCGCGGGTGGG + Exonic
1038767909 8:30446841-30446863 GTGCGCGCGCGCGCGCGCGGTGG + Intronic
1039595454 8:38787133-38787155 GCGCGCGCGCGCGGGGGCGGCGG - Intronic
1039595456 8:38787139-38787161 CTACTCGCGCGCGCGCGCGGGGG - Intronic
1039903263 8:41767659-41767681 GTGCGCGCGGGGGCGCGGGCGGG + Intronic
1039918353 8:41875941-41875963 GTGTGCGCCCGGGCGCGCGCCGG - Intronic
1041689883 8:60678640-60678662 CGGCGCGCGGGCGCGGGCGCGGG + Intergenic
1044115311 8:88327743-88327765 GCGCGCGCGCGCGCGCGCCAAGG - Intronic
1044661813 8:94598873-94598895 GTGTGTGTGCGCGTGCGCGCGGG + Intergenic
1044719692 8:95133760-95133782 GGGCGCGCCCGTGCGCGCGCAGG + Intergenic
1045287780 8:100806878-100806900 GTGTGTGCGCGCGCACGCACAGG + Intergenic
1045918297 8:107499829-107499851 GTGCGCGCGCACGCGTGTGCTGG - Intergenic
1047423563 8:124727075-124727097 GCGCGCGCGCGCGTGGGGGCGGG - Intronic
1047423565 8:124727079-124727101 GTGTGCGCGCGCGCGCGTGGGGG - Intronic
1047423567 8:124727081-124727103 GTGTGTGCGCGCGCGCGCGTGGG - Intronic
1047961750 8:130016316-130016338 GGGCGCGCGCGCGGGCCGGCCGG + Intronic
1048484255 8:134832340-134832362 GTGTGTGTGCGCGCGCGCGTGGG + Intergenic
1049420970 8:142516477-142516499 GTGTGCGCGCGCGTGTGTGCGGG + Intronic
1049780949 8:144428639-144428661 GTCCGGGCGGGCGCGGGCGCAGG - Intergenic
1050091283 9:2017556-2017578 GTGTGTGCGCGCGCGAGCGGCGG + Intronic
1050437853 9:5628956-5628978 GAGGGCCCGCGCGCGCGCTCTGG - Intergenic
1050552130 9:6757949-6757971 CGGCGCGCGCGCCCTCGCGCAGG + Intronic
1050964939 9:11788017-11788039 GTGCGCGCGCGTGTGTGTGCAGG + Intergenic
1051418812 9:16870810-16870832 GAGGGCGCGCGCGGGCGGGCGGG - Intronic
1051660850 9:19425318-19425340 GTGTGCACGCGCACGCACGCAGG - Intronic
1054842662 9:69760012-69760034 GAGCGCGCGCGCGCGCGCGCGGG + Intergenic
1055158921 9:73100353-73100375 GCGCGCGCGCGCGCGTGCATAGG + Intergenic
1055397632 9:75891512-75891534 GTGCGTACGCGCGCGCGCGCAGG - Intronic
1055611578 9:78030930-78030952 ACGCGCCCGCGCGCCCGCGCGGG + Intronic
1055945860 9:81690024-81690046 GCGCGCGGGCGCGCGCTAGCGGG + Intergenic
1056341589 9:85639350-85639372 GTGTGCGCGTGCGCGCGCATGGG - Intronic
1057619104 9:96619418-96619440 CGGCGGGCGCGCGGGCGCGCGGG - Exonic
1057708023 9:97411999-97412021 CTGCGCACGCGCGGGCGCTCCGG - Exonic
1058058551 9:100473242-100473264 GCGGGCGGGCGCGCGCGCGGCGG - Exonic
1058058567 9:100473290-100473312 GTGCGCGCGAGGGTGCGAGCCGG - Exonic
1058602538 9:106685482-106685504 ACGCGCGCGCGCGCGCGCACAGG - Intergenic
1059145645 9:111897029-111897051 GCGCGCGGGCGGGGGCGCGCAGG + Exonic
1059191842 9:112333855-112333877 CTGGGGGCGCGCGCGCGCGCCGG - Intergenic
1059270464 9:113067530-113067552 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059270466 9:113067532-113067554 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059271601 9:113072980-113073002 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059271603 9:113072982-113073004 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059272732 9:113078424-113078446 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059272734 9:113078426-113078448 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059273866 9:113083866-113083888 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059273868 9:113083868-113083890 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059274999 9:113089310-113089332 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059275001 9:113089312-113089334 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059800452 9:117745069-117745091 CTGCGGGCGAGCGAGCGCGCGGG - Intergenic
1060225705 9:121788999-121789021 GTGTGTGCGCACGCGCGTGCAGG - Intergenic
1060283375 9:122228492-122228514 GAGCGCGCGCGCGAGCGGGGGGG - Intronic
1060283377 9:122228494-122228516 GGGAGCGCGCGCGCGAGCGGGGG - Intronic
1060283379 9:122228496-122228518 GTGGGAGCGCGCGCGCGAGCGGG - Intronic
1060463867 9:123884982-123885004 GTGTGTGCGCGCGCGCTCGCAGG - Intronic
1060514576 9:124257917-124257939 GGGCGGGCGCGCGGGCGCGCGGG + Intronic
1060514577 9:124257927-124257949 GCGGGCGCGCGGGCCCGCGCAGG + Intronic
1061015811 9:127980444-127980466 CTGCGCGCGAGCGGCCGCGCTGG + Exonic
1061453492 9:130681582-130681604 GCGCGGGCGCGTGCGCGTGCGGG - Exonic
1061453513 9:130681668-130681690 GAGCGCGCCCGCGCCCCCGCCGG + Exonic
1061472153 9:130835297-130835319 ATGGGCGGGCGCGGGCGCGCGGG + Intronic
1061489799 9:130938672-130938694 GTGGGCGCGGGCGCGGGCGCGGG + Exonic
1061680978 9:132242249-132242271 GTGCGGGCGGGAGCGCGGGCCGG - Exonic
1062230522 9:135479597-135479619 GTGGGCGCGCTCTCGCGGGCGGG + Intronic
1062341433 9:136095379-136095401 GGCCGCGCGCGCGCGCGCACTGG + Intergenic
1203469175 Un_GL000220v1:108727-108749 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203470237 Un_GL000220v1:112840-112862 GGGCGGGCGCGCGTACGCGCGGG - Intergenic
1203471789 Un_GL000220v1:118423-118445 GCGCGCGCGCGCGCGCGTGCGGG + Intergenic
1203471791 Un_GL000220v1:118425-118447 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1203476996 Un_GL000220v1:152699-152721 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203478058 Un_GL000220v1:156812-156834 GGGCGGGCGCGCGTACGCGCGGG - Intergenic
1185504799 X:624229-624251 GGGCTGGCGCGCGCGCGCGAGGG + Intergenic
1186480347 X:9891891-9891913 GTGCGCGTGCGTGCACACGCAGG + Intronic
1187067551 X:15855069-15855091 GCGCGGGCGCGCGGGCGCTCGGG - Intergenic
1187265002 X:17723769-17723791 GTGCGCGCGCGTGCGCGCATGGG + Intronic
1187341462 X:18425339-18425361 CGGCGCGCGCGTGAGCGCGCAGG + Intergenic
1187533540 X:20116933-20116955 GTGCGCATGCGGACGCGCGCGGG - Intergenic
1187648353 X:21374270-21374292 GCGCGTGCGCGTGCGCGTGCCGG - Intergenic
1187675770 X:21715310-21715332 ACGCGCGCGCGCTCGCGCGCTGG + Intronic
1188594242 X:31877693-31877715 GTGCACGCACGCGCGCACACAGG + Intronic
1188597812 X:31922522-31922544 GTGTGCGCGCGCGTGCGCTAGGG + Intronic
1188597814 X:31922524-31922546 GTGCGCGCGCGTGCGCTAGGGGG + Intronic
1189310506 X:40014432-40014454 GCGCGCGCGCGCTCGAGTGCCGG + Intergenic
1190246986 X:48697070-48697092 GCCCCCGCGCGTGCGCGCGCCGG - Intronic
1193743225 X:85243868-85243890 TCTCGCGCACGCGCGCGCGCGGG - Intergenic
1195316845 X:103687501-103687523 GGGCGCGCGCGCGTGCGTGATGG + Intronic
1196180110 X:112680193-112680215 GAGCGCGCGCGCATGCGCGCAGG + Intergenic
1197655139 X:129108644-129108666 GTGTGTGTGCGCGCGCGCGGCGG + Intergenic
1197782488 X:130171888-130171910 GTGCGCGCGCGCGCGTGAAGGGG - Exonic
1197782490 X:130171890-130171912 GTGTGCGCGCGCGCGCGTGAAGG - Exonic
1198517483 X:137424656-137424678 GCGCGCCCGCGCGCGTTCGCGGG - Intergenic
1198767161 X:140091575-140091597 CTGCGGGCGGGCGGGCGCGCGGG - Intergenic
1198808474 X:140511039-140511061 GTGGGAAAGCGCGCGCGCGCTGG - Intergenic
1198887459 X:141354995-141355017 GTGCGCGCGCTTGCACGTGCTGG - Intergenic
1199815944 X:151397067-151397089 GTGAGCGCCCGCCCCCGCGCCGG + Intronic
1200136842 X:153879433-153879455 GTGCACGTGCGCGTGCGCGCAGG + Intronic
1200229434 X:154436837-154436859 GTGGGCGGGCGCGCGCGGGGCGG + Intergenic