ID: 1098351615

View in Genome Browser
Species Human (GRCh38)
Location 12:69568016-69568038
Sequence CAATATATGAAAAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 569
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 524}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098351615_1098351621 23 Left 1098351615 12:69568016-69568038 CCCTCCTCCTTTTTCATATATTG 0: 1
1: 0
2: 2
3: 42
4: 524
Right 1098351621 12:69568062-69568084 CTTGTTTGTAAGTGATGCTTTGG 0: 1
1: 0
2: 0
3: 9
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098351615 Original CRISPR CAATATATGAAAAAGGAGGA GGG (reversed) Intronic
905800867 1:40841638-40841660 AAATATGGGAGAAAGGAGGAGGG + Intergenic
905856792 1:41319834-41319856 CTGTAAATGAAAAATGAGGAGGG - Intergenic
906442573 1:45861625-45861647 CAAAAGATGAAAAGGAAGGAAGG - Intronic
908621525 1:65986582-65986604 CAGAATAAGACAAAGGAGGAGGG - Intronic
909129674 1:71718810-71718832 AAATATAAGAATAAGGATGAAGG - Intronic
909874096 1:80780439-80780461 CAAAATATGAAAAGGAATGAAGG + Intergenic
910568443 1:88673058-88673080 CAATATATGAATAAAGATAAAGG - Intergenic
910787812 1:91020079-91020101 CAATATATTGTAAAAGAGGAGGG + Intronic
911405660 1:97435130-97435152 CAATTTTTTAAAAAGGAGCAAGG - Intronic
911581933 1:99644193-99644215 CAAGATTTAAAAAAAGAGGATGG - Intergenic
911769663 1:101724355-101724377 CAATATATGATAGAGGAGGAGGG - Intergenic
911883846 1:103272521-103272543 CATCACATGAAAAAGGAGAAAGG - Intergenic
911942419 1:104064390-104064412 CTATTTATGCAAAAGGAAGAGGG + Intergenic
912015652 1:105031864-105031886 CAATATATAAAACAGTATGAGGG - Intergenic
912197734 1:107419138-107419160 GAAGACAGGAAAAAGGAGGAAGG - Intronic
912538414 1:110394055-110394077 CAACAAAGGCAAAAGGAGGATGG - Intergenic
913247457 1:116882639-116882661 AAAGATGTGAAAAATGAGGAGGG + Intergenic
913363804 1:118013061-118013083 ACATATATGTGAAAGGAGGAGGG - Intronic
913478951 1:119266382-119266404 CAATATATGAAAGAAGAAAATGG + Intergenic
913557197 1:119979317-119979339 CAACAAATGAAAAAGAAGGCAGG + Intronic
914251249 1:145923616-145923638 CAATTTAACAAAAAGGGGGAGGG + Intergenic
915035132 1:152916317-152916339 CAATAAATGTTAAAAGAGGAAGG - Intergenic
916315543 1:163444226-163444248 GAATATAGGAGCAAGGAGGAAGG - Intergenic
917686545 1:177422311-177422333 CAAGAAATGAAAAGGAAGGAAGG + Intergenic
918664264 1:187129944-187129966 AAATCTATGAAAATGGATGAAGG - Intergenic
918732086 1:188011853-188011875 GAATTTATGGCAAAGGAGGAGGG + Intergenic
920123985 1:203679076-203679098 CAAAATATTAGAAAAGAGGAGGG + Intronic
920762207 1:208795528-208795550 CAACATATGAAACAGGCGGAGGG + Intergenic
920933987 1:210414141-210414163 CAATCTATGAACAAGGAAGCGGG - Intronic
921032635 1:211346879-211346901 CAATTTATGAAACAAGAAGATGG + Intronic
921965636 1:221085688-221085710 CTTTACATGAAAAATGAGGATGG + Intergenic
921998332 1:221446600-221446622 CCATATTTTAAATAGGAGGAAGG + Intergenic
922405578 1:225309590-225309612 CAATATATTAAATATGAGTAAGG + Intronic
922955855 1:229599064-229599086 CAGTGTCTGAAACAGGAGGAGGG + Intronic
924826286 1:247542398-247542420 CAGCATATGGAAAAGGTGGAAGG + Intronic
1063181631 10:3606635-3606657 CAATATATCAACAAGAATGAGGG - Intergenic
1063724010 10:8616534-8616556 CAGTAAATGAAAAATGAGCACGG - Intergenic
1063923110 10:10951143-10951165 AAAGAAAAGAAAAAGGAGGATGG - Intergenic
1064048248 10:12038430-12038452 TAATATATGAAAAAGCAGGCTGG + Intronic
1064106771 10:12506934-12506956 GAATTAATGAAAAAGGAGCAAGG + Intronic
1064111605 10:12544103-12544125 AAATATGGGGAAAAGGAGGAAGG + Intronic
1064223040 10:13457949-13457971 TAATATATGAAGAAGCAGCAAGG + Intronic
1064359403 10:14650051-14650073 CCAGATAGGAAGAAGGAGGAAGG + Intronic
1064389873 10:14932795-14932817 TAATCTATGAAAAAGAAGAAAGG - Intronic
1065050373 10:21785800-21785822 AAAAAGATGGAAAAGGAGGAGGG + Intronic
1065502273 10:26394089-26394111 CAATATATGAATTTGGAGGCAGG - Intergenic
1065856490 10:29834819-29834841 CAATCCAGGAAAAAGGAAGAAGG - Intergenic
1066087334 10:31983778-31983800 AAATATATAAAAAAGGATTATGG + Intergenic
1067537320 10:47122894-47122916 CTGTCTATGAAAAAGGAGGCAGG + Intergenic
1068132980 10:52918305-52918327 CAGTGTGTGAAATAGGAGGATGG - Intergenic
1070362636 10:75705671-75705693 GAATAACTGGAAAAGGAGGATGG + Intronic
1071250018 10:83808473-83808495 CAACATATGAAAGATGAGGCTGG + Intergenic
1071434079 10:85630587-85630609 CAATTTATAAAAATGGAAGAGGG + Intronic
1071997075 10:91160141-91160163 CAACAGATGGAAATGGAGGAAGG - Intergenic
1072680496 10:97502564-97502586 CAATATTTCAGAAAGGGGGAGGG + Intronic
1073370193 10:102981376-102981398 TAATATAGGAAAAAAGAGGAAGG - Intronic
1073520601 10:104125368-104125390 CTATCTAGGAAAAAGTAGGATGG - Intronic
1073619762 10:105034836-105034858 AATTATATGAACAAGGGGGAGGG - Intronic
1073673626 10:105619919-105619941 AAATATATGATGAAGGAAGAAGG + Intergenic
1073905818 10:108278246-108278268 GAATGTATGAAAGAGGAGAAGGG - Intergenic
1073991685 10:109268677-109268699 CAATATCTCAAAAAGGAAGAAGG + Intergenic
1074471157 10:113728045-113728067 CAACATAGGTAAAAGAAGGATGG + Intronic
1074852489 10:117449847-117449869 CTAAACAGGAAAAAGGAGGAAGG + Intergenic
1075438988 10:122464437-122464459 AAATATTTGCAAAAGAAGGAGGG - Intronic
1076192562 10:128492968-128492990 AAAGAGATGAAAAAGGTGGAGGG + Intergenic
1077605510 11:3608475-3608497 CAATAAATAAAAAAGGAAAAAGG + Intergenic
1077751163 11:4971556-4971578 GAATGTATGGAAAAGGAGTAAGG + Intronic
1077992269 11:7422664-7422686 CAAGAAATGAGAAAGGAGTAAGG + Intronic
1078178978 11:8994204-8994226 CAAGAAATGAGGAAGGAGGAGGG + Intronic
1079561233 11:21822236-21822258 CAATAAAAGCAAAAGGAGGTGGG + Intergenic
1079652789 11:22950801-22950823 CAATGTATGAAAAAGCATGAGGG - Intergenic
1079928152 11:26522317-26522339 CAATCTATAAAATAGGAGCATGG + Intronic
1080594802 11:33762046-33762068 TATTATATGAAAAAGGTGAAGGG - Intronic
1080955684 11:37092387-37092409 CAAATTATGAAAAAGGAAGAGGG + Intergenic
1082715757 11:56611276-56611298 CAGTATCTGAAAAAGAAGGAAGG - Intergenic
1084765366 11:71304877-71304899 CAAAAAATAAAAAAGGAGAATGG + Intergenic
1085497236 11:76981098-76981120 CATTATATGAAAATGGAGCATGG + Intronic
1085705615 11:78784629-78784651 CAATATAAGAATAAGGTTGACGG - Intronic
1085834502 11:79937897-79937919 CTATATATGCAAAAGATGGATGG - Intergenic
1085857199 11:80188519-80188541 CAGTTAATGAAAAAGGAGAATGG - Intergenic
1086185546 11:84010649-84010671 CAATATTTGAGAAAGGAGCTAGG - Intronic
1087214064 11:95476355-95476377 CAATAATTTAAAAAAGAGGAAGG - Intergenic
1087907663 11:103717874-103717896 ATATATATGGAAAAGGAAGATGG + Intergenic
1088129698 11:106472574-106472596 CAATATATGGATAAGGATCAGGG + Intergenic
1088272673 11:108050935-108050957 AGATATATGGAAAATGAGGACGG - Intronic
1088531733 11:110817961-110817983 CAGTATATGCAAAAGCATGAAGG + Intergenic
1088641813 11:111879935-111879957 CAATATATGCAAAAGCTTGATGG + Intronic
1089037108 11:115406220-115406242 GAATATATGAATAATGAGGGAGG - Intronic
1089250879 11:117160388-117160410 AAATATATGAAATAGGAAAATGG - Intronic
1090598395 11:128343832-128343854 CACTGTATGAAAAATGAGAATGG + Intergenic
1090671451 11:128948940-128948962 CAATCTCTGAAATTGGAGGAGGG + Intergenic
1090840458 11:130483165-130483187 CAAAATATCAAAAAGAAAGAAGG - Intergenic
1091182637 11:133620581-133620603 CAGTAAAGGAGAAAGGAGGAAGG + Intergenic
1091959825 12:4684236-4684258 AAATAAATGAAAAAGGAAGCTGG - Intronic
1092307077 12:7312025-7312047 CAACATGTGAAAAATGAGCATGG - Intronic
1092801840 12:12176186-12176208 CAATATAGTAAAAATCAGGAGGG + Intronic
1092914120 12:13174072-13174094 CTCTAAATGGAAAAGGAGGAAGG - Intergenic
1092996125 12:13952594-13952616 CAATCTATGAAAAAGAAAGACGG - Intronic
1093139594 12:15492856-15492878 GAATTCATGAAAAAGAAGGAGGG + Intronic
1093286784 12:17273505-17273527 TAATATTTGAAATAGGAGGGAGG + Intergenic
1093546668 12:20356839-20356861 TAATATATGAAAATGCAGTATGG + Intergenic
1093843974 12:23944694-23944716 CAATCAATGAAAGAGAAGGAAGG + Intronic
1094117418 12:26932194-26932216 GAATATATAAAAATGGATGAAGG + Intronic
1095610046 12:44117206-44117228 CAATATATGCAAAAGTAAGGAGG - Intronic
1095809904 12:46361924-46361946 GAATATATAAAAGAGAAGGAAGG - Intronic
1097242407 12:57584699-57584721 CTATATGTGAAAGAGGAGGGAGG - Exonic
1097538023 12:60898524-60898546 ATATATATGAATAAGTAGGATGG + Intergenic
1097938930 12:65282347-65282369 AAATATATGAACATGGATGAGGG - Intronic
1098313025 12:69166241-69166263 AAATATTTGAAGAAGTAGGAGGG - Intergenic
1098351615 12:69568016-69568038 CAATATATGAAAAAGGAGGAGGG - Intronic
1098609925 12:72444025-72444047 CTTTATATGCAAAAAGAGGAAGG - Intronic
1098645423 12:72894773-72894795 ATATAGATGGAAAAGGAGGAAGG + Intergenic
1099049465 12:77765883-77765905 AAATATATAATAAAAGAGGAGGG + Intergenic
1099537817 12:83866512-83866534 CAACATAAGAAATAGGAGGATGG - Intergenic
1100245673 12:92754185-92754207 GAATATCTGGAAAAGGAGCATGG + Exonic
1100519229 12:95357412-95357434 TAATAAATGAAAAATAAGGAAGG - Intergenic
1101219478 12:102622798-102622820 CTAGATATGAAAAAGGGTGAAGG + Intergenic
1101712748 12:107283671-107283693 CATTATTTGAGAAAGAAGGAGGG - Intergenic
1102231852 12:111268091-111268113 CATTATAAGAGAAAGGAGGTTGG - Intronic
1103619210 12:122175961-122175983 TAAAATATGAATAAGGAGGCCGG - Intronic
1103882966 12:124180600-124180622 CAACATATGAATTTGGAGGAGGG - Intronic
1104277854 12:127346449-127346471 AAACAGATGAAGAAGGAGGAAGG + Intergenic
1104558182 12:129821026-129821048 TTATATAGGAGAAAGGAGGAGGG - Intronic
1105489285 13:20871953-20871975 CAATATATTAAATGGCAGGATGG + Intronic
1106320613 13:28634438-28634460 CAATTAGTGGAAAAGGAGGAAGG + Intergenic
1106708935 13:32311204-32311226 CCATAGATGGAAAAGGAGGGAGG + Intronic
1107172674 13:37361605-37361627 CAATATAAGCAAAAGGATAAAGG + Intergenic
1107199765 13:37700290-37700312 TAATAGATGAAAATGGTGGATGG + Intronic
1107459297 13:40585984-40586006 CCATATATGGGAAATGAGGAGGG - Intronic
1107486086 13:40828799-40828821 CAAGAAAAGAAAAAGGAGGGTGG + Intergenic
1107741730 13:43457462-43457484 CAATTTATCAATAAGAAGGAAGG + Intronic
1107752037 13:43577980-43578002 CTATATAAAAAAAAGGAGAATGG + Intronic
1108551762 13:51553145-51553167 CAACATATGAAAATGGGGGGAGG - Intergenic
1108662422 13:52599284-52599306 AAAAAAAGGAAAAAGGAGGAAGG + Intergenic
1109010186 13:56930629-56930651 AAATATAGGAGAAGGGAGGAGGG + Intergenic
1110016498 13:70412150-70412172 CATTATATGAAATAGTATGAAGG - Intergenic
1111003720 13:82220684-82220706 CAATAAATGAAAAATAATGATGG + Intergenic
1111056749 13:82960492-82960514 CAATATATAAGAAAGCAGAAAGG + Intergenic
1111161120 13:84396088-84396110 CAGAATCTGAAAAAGGAGGTAGG + Intergenic
1112185157 13:97120894-97120916 CAATATAAGAACAAAGAGGCTGG - Intergenic
1112393696 13:99008913-99008935 CAACATATGAATAGGGAGGTAGG + Intronic
1112603091 13:100876272-100876294 AAAGAAAGGAAAAAGGAGGAAGG - Intergenic
1113077384 13:106480476-106480498 CATGATGTGAAAAAAGAGGAAGG + Intergenic
1114008268 14:18337240-18337262 CAGTATATAAAACAGGATGATGG - Intergenic
1114354138 14:21888878-21888900 CAATTTTTAAAAAAGGAGGGAGG - Intergenic
1115129726 14:30040756-30040778 TAATAAAGGAAAAAGGTGGAAGG - Intronic
1115833891 14:37375479-37375501 TAATAAATTAAAAAGGAGGCTGG - Intronic
1115886354 14:37976070-37976092 TAATATATGAAGAAAGAGCAAGG + Intronic
1116388504 14:44361980-44362002 CAATATCTAAAACATGAGGAGGG - Intergenic
1117484403 14:56179866-56179888 CAAGATTTTAAAAAAGAGGAAGG - Intronic
1117598657 14:57350784-57350806 CAAAATATGAAAAAGTAAGTTGG + Intergenic
1121142101 14:91552235-91552257 CAATATGTGACACAGCAGGAAGG + Intergenic
1121653659 14:95578791-95578813 CAATATTTAAAAAAAGAAGAAGG - Intergenic
1122533700 14:102447065-102447087 CACTATAAGAAACAGGATGAGGG + Intronic
1123159789 14:106267381-106267403 GAATAAAGGAAAAATGAGGAGGG + Intergenic
1123406189 15:20020603-20020625 CAACAAATAAGAAAGGAGGAAGG - Intergenic
1123515519 15:21027251-21027273 CAACAAATAAGAAAGGAGGAAGG - Intergenic
1123951639 15:25284258-25284280 CAATATTTGAAAATGTAGGAGGG + Intergenic
1124229768 15:27934160-27934182 CAACATTTTAAAAAGGAAGATGG + Intronic
1126491752 15:49244690-49244712 CAATATATGAGAGAGGAGTTGGG + Intronic
1127028912 15:54839826-54839848 CACTGTTTGAAAAAGCAGGAAGG + Intergenic
1127302797 15:57673360-57673382 CAATTTATAAAAAAAGAGAAAGG - Intronic
1127508841 15:59620526-59620548 CAATATAAACAAAATGAGGATGG - Exonic
1127561441 15:60140835-60140857 CAATAGAGGAAAAAGAAAGAGGG - Intergenic
1128129209 15:65214620-65214642 CAAGATATGAGACAGGTGGACGG - Intergenic
1128179275 15:65587314-65587336 CCATTTATGAAGCAGGAGGATGG + Intronic
1128398368 15:67252636-67252658 CAATTAAAGAAAAAAGAGGAAGG + Intronic
1128810250 15:70566196-70566218 CAATAAATGGAAAGGGAGGAAGG - Intergenic
1129863057 15:78878091-78878113 CAAATTAGGAAAAATGAGGACGG - Intronic
1130007529 15:80114484-80114506 CAATAAATGTATTAGGAGGAGGG + Intronic
1130521774 15:84667257-84667279 CAATAAGTGTATAAGGAGGAGGG + Intergenic
1130551449 15:84892215-84892237 TAAAAAAAGAAAAAGGAGGATGG + Intronic
1131375730 15:91921385-91921407 CAATATATGAATCTGGGGGAAGG + Intronic
1131619016 15:94047309-94047331 AAATATATGAAAAAGCATGAGGG + Intergenic
1131654018 15:94435159-94435181 CACTATATGAAAATGCAGGCTGG - Intronic
1132050770 15:98606070-98606092 GAATAAATGAATGAGGAGGAAGG - Intergenic
1132690412 16:1179437-1179459 CAATAAATAAATGAGGAGGACGG - Intronic
1133323298 16:4928139-4928161 CAAAAAATGAAAAAGGAGGCTGG - Intronic
1133912634 16:10079639-10079661 CCATCTATGAAAAAGGAAGCAGG + Intronic
1135177341 16:20242336-20242358 CAAGACAGGAAAAAGGAGAAAGG + Intergenic
1135266983 16:21035515-21035537 AAATATATCAAAAAGTAAGATGG + Intronic
1135856996 16:26020925-26020947 CCATATATGTAAAATGGGGATGG + Intronic
1136162790 16:28431662-28431684 CAATTTATGGAGGAGGAGGAAGG - Intergenic
1136200176 16:28683326-28683348 CAATTTATGGAGGAGGAGGAAGG + Intergenic
1136216524 16:28797519-28797541 CAATTTATGGAGGAGGAGGAAGG + Intergenic
1137869046 16:51931917-51931939 CAATAAATTATAGAGGAGGAGGG + Intergenic
1138923610 16:61564066-61564088 CAAGAGATTAAGAAGGAGGAAGG - Intergenic
1139462123 16:67130697-67130719 CAAAATATGAGATGGGAGGAAGG + Intronic
1140266950 16:73429103-73429125 CAAAAGATGAAAAAGGAAGGAGG - Intergenic
1140697409 16:77548654-77548676 AAATACAAAAAAAAGGAGGAAGG + Intergenic
1140859251 16:79004987-79005009 TAATAAATGAAAAAGGGGAAGGG + Intronic
1140937607 16:79689155-79689177 CAATAAATGGAAAAGTGGGATGG + Intergenic
1142783222 17:2198569-2198591 CAAGACATGAAAAATGGGGAAGG + Intronic
1143331297 17:6137870-6137892 CAATGTAGGAAACAGGAGAAAGG + Intergenic
1144293482 17:13850517-13850539 GAATATATGTAAAATGAGAAAGG - Intergenic
1144874234 17:18388840-18388862 CAAGAGCTGAAAAAGGAGAAAGG - Exonic
1144964782 17:19070124-19070146 AAATAGAAGGAAAAGGAGGAGGG - Intergenic
1144983185 17:19182054-19182076 AAATAGAAGGAAAAGGAGGAGGG + Intergenic
1144985040 17:19196185-19196207 AAATAGAAGGAAAAGGAGGAGGG - Intergenic
1145157994 17:20555578-20555600 CAAGAGCTGAAAAAGGAGAAAGG + Intergenic
1145302054 17:21647841-21647863 CAATATGTGAGACAGGATGAGGG + Intergenic
1145328400 17:21850625-21850647 CAATATGTGAGACAGGATGAGGG + Intergenic
1145348256 17:22055475-22055497 CAATATGTGAGACAGGATGAGGG - Intergenic
1145402243 17:22551406-22551428 CATTATATGTAAACGGGGGAGGG - Intergenic
1145415324 17:22709914-22709936 CAATATGTGAGACAGGATGAGGG + Intergenic
1145695182 17:26781969-26781991 CAATATGTGAGACAGGATGAGGG + Intergenic
1146737306 17:35249667-35249689 CATGATATCAAAGAGGAGGAAGG - Intronic
1148726728 17:49797357-49797379 CAATGTATAAGAAAGGAGGCTGG - Intronic
1150060230 17:62061670-62061692 CAATGAAAGAAAAAGGAGGCTGG + Intronic
1150896733 17:69220287-69220309 CAGTATATGAAAAGGAAAGAAGG + Intronic
1151522124 17:74637706-74637728 TAATATAAAAAAAAGGAGAAAGG + Intergenic
1151885164 17:76919219-76919241 TAAAATATCAAAGAGGAGGATGG - Intronic
1203193000 17_KI270729v1_random:206803-206825 CAATATGTGAGACAGGATGAGGG + Intergenic
1203202364 17_KI270730v1_random:6238-6260 CAATATGTGAGACAGGATGAGGG + Intergenic
1154006409 18:10531925-10531947 CAACATATGGAAAAGCAGGGAGG + Intronic
1154330826 18:13427841-13427863 AAATATATGGAAAATGAGGCAGG - Intronic
1156312459 18:35937303-35937325 AGAGAGATGAAAAAGGAGGAGGG + Intergenic
1156643689 18:39133469-39133491 CCATATAAGAAAAAAGACGATGG - Intergenic
1156724485 18:40111696-40111718 AAAGATAGGAAAAAGGAGGAGGG - Intergenic
1156862222 18:41851079-41851101 CAATATATGAAAAGTGAGCATGG - Intergenic
1158217557 18:55115875-55115897 CAATAAATTACAAAGTAGGATGG + Intergenic
1158265611 18:55657856-55657878 CAGTTTATGCAAAAGCAGGAGGG + Intronic
1158385939 18:56991439-56991461 CAATATTTAAAAAATGAGGCCGG - Intronic
1159477292 18:68938204-68938226 CAATCTATGAAAAAAGTGTAAGG + Intronic
1160263183 18:77314882-77314904 CAAAATATGTTAAAGGTGGACGG + Intergenic
1161894034 19:7066836-7066858 GGATATAAGAAAAAGGAGCAGGG + Intergenic
1161904353 19:7144393-7144415 AAATAAATAAATAAGGAGGATGG - Intronic
1163224761 19:15950876-15950898 CAAAATAGAAAAAAGGAGGTTGG + Intergenic
1163257734 19:16167854-16167876 CAATAAATAAATAAGGAGCAAGG + Intronic
1167067483 19:47197534-47197556 CAATATATAAAAAATAAAGAGGG + Intronic
1167672642 19:50862605-50862627 AAATATATAAAATAGGACGAAGG + Intronic
1168555443 19:57335254-57335276 CAATATAGGAAAATGTAAGATGG - Intergenic
925144813 2:1574201-1574223 AAATACATGAAAAAGCAGGCAGG + Intergenic
925228340 2:2206319-2206341 CAATAAAAGAAAAAGGTGAATGG - Intronic
925750262 2:7083645-7083667 CAATATATAAACAAATAGGAGGG + Intergenic
925774698 2:7323340-7323362 CAGTGTTTGAAAAAGGAAGAAGG - Intergenic
926347250 2:11958742-11958764 ACTTATATGAAAAATGAGGAGGG + Intergenic
928409709 2:31045443-31045465 CAGCATATGAAAATGGGGGAGGG - Intronic
928822470 2:35378090-35378112 CAATAAATGCAGAAGGAGTAAGG - Intergenic
929282818 2:40100954-40100976 CAAAGTATGTAAAAGGAGGCTGG - Intronic
930050742 2:47214423-47214445 CAAAAAAAGAAAAAGGAAGAAGG + Intergenic
932116235 2:69050947-69050969 CAATATAAGAAGCAGAAGGAAGG - Intronic
934220174 2:90075147-90075169 CATGATAGGAAACAGGAGGAGGG - Intergenic
935483603 2:103624114-103624136 CAATGTAACAAAAAGGTGGAAGG - Intergenic
935866065 2:107388989-107389011 CAACATATGAAACACAAGGAGGG - Intergenic
936443851 2:112580551-112580573 CAAAAAATGAAAATGGAGGTAGG - Intergenic
937392422 2:121501595-121501617 CAATCTATGAAAAAGAAATAAGG + Intronic
937512146 2:122608019-122608041 CATTATATGAATAAGGAACATGG + Intergenic
937649885 2:124307931-124307953 CAATATATGACAAAGCTGGCGGG + Intronic
939742905 2:145932221-145932243 TAATTTATGAAAAAGTATGAAGG + Intergenic
939851340 2:147309464-147309486 AAATATGTGAGAAAGAAGGAAGG - Intergenic
940361374 2:152799734-152799756 CAATCTATGAACCAGGAAGAGGG + Intergenic
941105257 2:161344477-161344499 CAACATATGAATAGGAAGGAGGG + Intronic
941594066 2:167453783-167453805 TCAAATATGTAAAAGGAGGAAGG + Intergenic
942111661 2:172688602-172688624 CTATAAAGGATAAAGGAGGAGGG + Intergenic
942538738 2:176993501-176993523 CATTAAATCAAAAAGGAGGTAGG + Intergenic
942729422 2:179047464-179047486 CGATATATTAAAAATGAGAAGGG - Intronic
943026705 2:182638162-182638184 AAATAGAGGAAAAAGGATGAGGG + Intergenic
943532601 2:189103252-189103274 GAATATATGTCAAAGGAGAAGGG - Intronic
943952757 2:194151358-194151380 TAATTTATGATAAAGGAAGATGG + Intergenic
944153727 2:196589981-196590003 GAAAAAATGAAATAGGAGGAAGG - Intronic
944218568 2:197279655-197279677 CAAACTAGGAAGAAGGAGGAAGG - Intronic
944396753 2:199276705-199276727 CAATTTATGAAAAAGCTGGCAGG + Intronic
944967347 2:204950200-204950222 CAATATATTCAAAATGGGGAGGG - Intronic
945268065 2:207910907-207910929 GAATAAGTGAAAAAGGAGAAGGG + Intronic
945806540 2:214497457-214497479 CCATATATGAAGAAGGATCATGG - Intronic
946027433 2:216680214-216680236 CAGTATTTGAAAAAAGAGGGAGG - Intronic
946111628 2:217424576-217424598 CAAAACATGAAAAAGAAAGAAGG + Intronic
947005099 2:225502346-225502368 CAATTTATGATGAAGGAGAAAGG - Intronic
947458438 2:230280560-230280582 CAATCCATTAAAAAGCAGGAAGG - Intronic
948081752 2:235212167-235212189 CAATATTTCAGAAAGAAGGAAGG - Intergenic
1169949621 20:11029027-11029049 GAGTATAAGAAAAAGGAGAAAGG - Intronic
1170336394 20:15275021-15275043 CAATAATTGAAAAAGGAGGCTGG + Intronic
1170390912 20:15873671-15873693 AAATATATAAAAAAGAAAGAAGG + Intronic
1172206975 20:33169731-33169753 AAATATATGAAAAAAGAAGAGGG - Intronic
1172219643 20:33264681-33264703 CAAAATATGAAAAATGAGCCAGG + Intergenic
1172791535 20:37509249-37509271 CAGTAATTGAACAAGGAGGATGG - Intronic
1173007668 20:39152560-39152582 AAGTATATGAAAGAGGATGAGGG + Intergenic
1173186211 20:40842530-40842552 CCATGTATGAAACAGCAGGAAGG - Intergenic
1174004085 20:47396418-47396440 CAAAATATGAAAAATTAGCAGGG + Intergenic
1174828054 20:53786887-53786909 CAATGGATGAAAAAGCAGGAAGG + Intergenic
1176652784 21:9565674-9565696 CAATATGTGATACAGGATGAGGG + Intergenic
1176702440 21:10071837-10071859 CAATAAATGAAAAAGTATGATGG - Intergenic
1177210616 21:18066663-18066685 CAATATATGAATTTGGAGGGAGG - Intronic
1177241307 21:18461719-18461741 CTATATAATTAAAAGGAGGATGG - Intronic
1177359978 21:20055680-20055702 CGATATCACAAAAAGGAGGACGG + Intergenic
1177854764 21:26388305-26388327 AAATATATGAAAAAGGAATAAGG + Intergenic
1180255946 21:46627596-46627618 CAATATATGAATTTGGAGGTAGG - Intergenic
1180432773 22:15268057-15268079 CAGTATATAAAACAGGATGATGG - Intergenic
1183291956 22:37008147-37008169 CTGTGTAGGAAAAAGGAGGAAGG + Intergenic
949237589 3:1828809-1828831 CAATATATGATCAGGCAGGAGGG + Intergenic
949324090 3:2844029-2844051 CAGTATATGGAACAGAAGGATGG - Intronic
950267376 3:11584580-11584602 GAATATATGAGATGGGAGGAAGG + Intronic
950269122 3:11599296-11599318 CAATAAAAGAAAAATGAGGGGGG + Intronic
950729593 3:14946458-14946480 CAACGTCAGAAAAAGGAGGAAGG + Intergenic
950755880 3:15172050-15172072 ATATATAGGAGAAAGGAGGAGGG - Intergenic
951251376 3:20397748-20397770 GAGTATAAGAAAAAGGAGGTTGG + Intergenic
951262479 3:20526854-20526876 CAATATAAAAAAAATGATGAGGG + Intergenic
951320690 3:21240970-21240992 CAATAATTGGAAAAGTAGGAAGG - Intergenic
951667789 3:25146394-25146416 CAATATATGTTAAAGGGGGCAGG + Intergenic
951841980 3:27044167-27044189 CAAAATATGTTAAAGGTGGAGGG + Intergenic
951949663 3:28185695-28185717 CAATATATGAATTAGGGGGCAGG + Intergenic
952088088 3:29850903-29850925 CAATGAATGAAAAAGGGGGAGGG - Intronic
953191373 3:40691042-40691064 AAGTAGATGAAAAAGGAGGTGGG + Intergenic
953374650 3:42418578-42418600 AAAAATAAGAAAAAGGAGGGAGG + Intergenic
953526784 3:43697689-43697711 CAATATATGAAAAGAAAAGATGG + Intronic
954550885 3:51480668-51480690 CAGGATGAGAAAAAGGAGGATGG - Intronic
955419914 3:58725721-58725743 CAATGTATGAAGAAGCACGATGG - Intronic
955745322 3:62134841-62134863 CAAAATATGAAATGGGATGAAGG + Intronic
956235770 3:67069232-67069254 AAATAAATGAAAGAGAAGGAAGG - Intergenic
956317472 3:67954377-67954399 ATAAATATGAAAATGGAGGAAGG + Intergenic
956480364 3:69668006-69668028 CAATAACTGAAAAACGAAGAGGG + Intergenic
956498697 3:69857483-69857505 CCTTATGTGAAAAAAGAGGAAGG - Intronic
956994390 3:74807424-74807446 CAAAATGTCAAACAGGAGGAAGG + Intergenic
957049772 3:75402387-75402409 CAAAAAAAAAAAAAGGAGGAAGG + Intergenic
957319608 3:78612367-78612389 CAATTTATTAAAAAAGAGAAGGG - Intronic
957525406 3:81373034-81373056 CAATTTATGAGAAATGAGTAGGG + Intergenic
957538188 3:81533002-81533024 CAATAAATGGAAAAGGAACAAGG - Intronic
957955082 3:87176066-87176088 CAATATATGAGTAAGGAAAAGGG + Intergenic
958798900 3:98733570-98733592 CAGTTTAGGAGAAAGGAGGACGG + Intronic
959421451 3:106134840-106134862 TAATATATGAAAAAGCCTGAGGG - Intergenic
959473962 3:106786922-106786944 CAACACATGAAAAAGAATGATGG + Intergenic
959514258 3:107247989-107248011 CAAAGTATCAACAAGGAGGAAGG + Intergenic
960180240 3:114567442-114567464 CAATATATGAAGGAGATGGAGGG - Intronic
960202722 3:114857151-114857173 CTATGCATGAAAATGGAGGATGG - Intronic
960285403 3:115822755-115822777 CAATATTTGAGAAAGGAAGTTGG + Intronic
960427547 3:117527366-117527388 CAACATATGAATTATGAGGAGGG - Intergenic
960925007 3:122785957-122785979 CAGTATATAGAAAAGGATGAGGG - Intronic
961493919 3:127276744-127276766 GAATATGTGCAAAAGGAGTATGG - Intergenic
961584616 3:127911623-127911645 AAATACATGATGAAGGAGGATGG + Intergenic
962336828 3:134540711-134540733 TAATTTATGAAAAATGAAGATGG - Intronic
962911628 3:139856246-139856268 CAATCTATGCACAGGGAGGATGG + Intergenic
963719704 3:148848087-148848109 CAATATAAGAAAAAGTTGGAAGG - Intronic
964525398 3:157611415-157611437 CAAAAGAGGAAAAAGGAGGGAGG + Intronic
964665132 3:159163659-159163681 TAATACATGAAAAATGAGGCTGG - Intronic
964735845 3:159916000-159916022 CAATATCTTAAAAAGAAAGATGG + Intergenic
965097111 3:164244456-164244478 GAATATAACAAAAAGGTGGAGGG - Intergenic
965308637 3:167100227-167100249 CAATATATGAAACGGGTGGTGGG + Intergenic
965834929 3:172840988-172841010 CAAAACAGGAGAAAGGAGGAAGG - Intergenic
966089383 3:176114139-176114161 GAAAATATGAAAAATGAGGCTGG - Intergenic
966632605 3:182095215-182095237 AAATATATTAAAAAAGAGGTGGG - Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967559790 3:190904660-190904682 CAAAAGGTGAAAAAGGAGAAAGG - Intergenic
968202988 3:196771852-196771874 GAAAATATGAAAGAGGAGGCCGG - Intronic
969915477 4:10486992-10487014 CAATATATGACTAATGATGAGGG + Exonic
970455023 4:16214881-16214903 CAAAAAATGACAAGGGAGGAAGG + Intronic
970747623 4:19318443-19318465 TAATATATAAAAATGGAGGGTGG + Intergenic
970987958 4:22179876-22179898 AAATAGATGTCAAAGGAGGAAGG - Intergenic
971655250 4:29336006-29336028 TTATAGAAGAAAAAGGAGGAAGG - Intergenic
971710141 4:30100106-30100128 CAACATATGAATATGGGGGAGGG + Intergenic
971997566 4:33984922-33984944 ATATATATTTAAAAGGAGGATGG - Intergenic
972108973 4:35530962-35530984 CAATATATGAATTTGGTGGAGGG + Intergenic
972401781 4:38711308-38711330 CAACATCTGAAAGAGGAGGCAGG - Intergenic
973268901 4:48240379-48240401 CAACACAAGAAAAAGGTGGATGG + Intronic
973567528 4:52203195-52203217 GCATATAGGAAAAAGGAAGAAGG + Intergenic
974040835 4:56855995-56856017 CAATATATGAATTTGGAGAAGGG + Intergenic
974543030 4:63263731-63263753 GATTAAAAGAAAAAGGAGGAGGG + Intergenic
974712603 4:65619573-65619595 CACTAAATGAAAAATGAGTAAGG + Intronic
975120206 4:70720068-70720090 CAAAATAAAAAAAAGAAGGAGGG - Intronic
976224897 4:82788129-82788151 CCATATATGAATAAGGAAGTGGG + Intronic
976355362 4:84110881-84110903 CAAGGGAGGAAAAAGGAGGAAGG - Intergenic
976433798 4:84993813-84993835 CAAAAAATAAAAAAGGAAGAGGG + Intergenic
977458297 4:97291774-97291796 CAATATAGGGAATAGAAGGATGG - Intronic
978085947 4:104654918-104654940 AAAAAAATGAAAAAGAAGGAAGG + Intergenic
978972544 4:114827679-114827701 CATTTTATGAAAAAGGCTGAAGG + Intergenic
979618239 4:122768941-122768963 CAAGAGATGAGTAAGGAGGACGG + Intergenic
979633375 4:122928735-122928757 AAATATATGAAAAAAGATAAAGG - Intronic
979843922 4:125484115-125484137 CATTTTGTGAAAAATGAGGAAGG + Intronic
979877414 4:125910752-125910774 CAATCTCTGAATAAGGAGGAGGG + Intergenic
980258922 4:130422113-130422135 CAAAATATGAAAAGATAGGAGGG + Intergenic
980302773 4:131015046-131015068 CAAAATATGCAAATGGTGGAGGG + Intergenic
980374613 4:131928253-131928275 CAATAAATGAAAAAGTATGATGG - Intergenic
980770497 4:137365520-137365542 CAATATAAGAGAAAGGAGGGAGG + Intergenic
980872988 4:138631493-138631515 CAAAGTAAGAAAAAGAAGGAAGG - Intergenic
981595247 4:146414026-146414048 AAAGACATGAAAGAGGAGGATGG + Intronic
981992259 4:150935636-150935658 AAATATATGAAAAAAGTGAAGGG + Intronic
982340920 4:154297820-154297842 CAATATATGAAAAACTTGAAGGG + Intronic
982360972 4:154518659-154518681 CAATAAATGAAAAATAAGAAAGG - Intergenic
982482382 4:155928149-155928171 TAGTATTTGAAAAAGGAAGAGGG - Intronic
982527410 4:156496685-156496707 CGATAGTTGGAAAAGGAGGAAGG + Intergenic
982932136 4:161421738-161421760 GAATAGAACAAAAAGGAGGAGGG + Intronic
983234051 4:165158822-165158844 GAATATAGGAAAAAGTAGAAGGG - Intronic
983484326 4:168316518-168316540 CAATATATGAAAAAAAATAATGG + Intronic
983617356 4:169722814-169722836 CAATGTATGAAAAAGAAAAATGG - Intronic
984506945 4:180631685-180631707 CCATATATTAAAAAGAAAGAAGG + Intergenic
985385356 4:189440724-189440746 CAAAATAAGAAAAGGGGGGAGGG - Intergenic
987226540 5:15847623-15847645 CATTATATGGAAAAGGTGGGGGG + Intronic
987308803 5:16663155-16663177 CCATCTATTAAAAATGAGGATGG + Intronic
987575789 5:19726193-19726215 AAAGAGATGAAAAAGGAAGAAGG + Intronic
988521502 5:31949526-31949548 AAATATATGAACAAGAAGAATGG - Intronic
988645155 5:33086823-33086845 CTATATAGGAAAGAGGTGGAGGG + Intergenic
988660150 5:33257657-33257679 CAGCATATGAATTAGGAGGATGG - Intergenic
988702644 5:33690536-33690558 GAATATGTCAAAAAGGAAGATGG + Intronic
989254714 5:39353879-39353901 GAATAATTGAAAGAGGAGGAAGG + Intronic
989707033 5:44346556-44346578 CAATGTGTGAAAAAGAAAGAAGG - Intronic
989746272 5:44834026-44834048 CAATGAATGAGAAAGGGGGAGGG - Intergenic
990007110 5:50956412-50956434 AAATATATTAAAAAGGCCGATGG + Intergenic
990400804 5:55435746-55435768 TAATAGATGAAAATGGGGGAGGG - Intronic
990502649 5:56412039-56412061 CAGAATGTGAGAAAGGAGGAAGG - Intergenic
990620403 5:57553014-57553036 CAATATATAAAAAAGAAGGAAGG - Intergenic
991482234 5:67093219-67093241 CATTAAATGAAAAAGTAAGAAGG - Intronic
992046337 5:72894084-72894106 CAATATCTGAAAAAGTATGCTGG - Intronic
992590448 5:78290644-78290666 GAATATTTTAAAAAGAAGGAAGG + Intronic
992941440 5:81766299-81766321 GAATGGAGGAAAAAGGAGGAAGG + Intergenic
993011310 5:82486378-82486400 CAATAAATTAGAAAGGAAGATGG + Intergenic
994282536 5:97922544-97922566 CTATATTTGAAAAAGTAAGAGGG + Intergenic
994716668 5:103329711-103329733 CAACATATGAATATGGAGGAGGG + Intergenic
994927351 5:106134244-106134266 CAATAGAAGAAAAAGAAAGAAGG - Intergenic
995164478 5:109023039-109023061 AAATGTATGTAAAGGGAGGATGG + Intronic
995294993 5:110510026-110510048 CAATATATGGAAAAAGGAGAAGG - Intronic
995456207 5:112354978-112355000 CAAAATAAACAAAAGGAGGAAGG + Intronic
995602108 5:113808605-113808627 CAATAAAAGAAAGAGCAGGAGGG - Intergenic
995650895 5:114366703-114366725 CAATAAGTAAAAAAGGAGGGCGG - Intronic
995654250 5:114407022-114407044 AAATAAATAAAAAAGGAGCATGG - Intronic
995974838 5:118021648-118021670 CAAAATATGAATAAGAAGAAAGG - Intergenic
998159709 5:139806493-139806515 CCATATTTGACAAATGAGGAAGG - Intronic
998592209 5:143489751-143489773 CAATAAATAAAAATGAAGGAAGG + Intergenic
998782535 5:145674076-145674098 AAATATAAGAAATAGGAGGGGGG + Intronic
999163438 5:149526114-149526136 AAATAGATAAATAAGGAGGAAGG - Intronic
1000092904 5:157945808-157945830 AAATATATAAAAAAGAAGGAAGG - Intergenic
1000200266 5:159002665-159002687 ATATATATAGAAAAGGAGGAAGG + Intronic
1000636339 5:163647926-163647948 AAAAAAATGGAAAAGGAGGAAGG - Intergenic
1001427603 5:171633937-171633959 CAGCATCTGAAACAGGAGGATGG - Intergenic
1001549118 5:172589326-172589348 GAATCTACGAAAAATGAGGATGG - Intergenic
1001619355 5:173069879-173069901 CCAAATCTGAGAAAGGAGGAAGG + Intronic
1002554356 5:180023465-180023487 AAATATATGCAAAAGGAGCCTGG + Intronic
1002668082 5:180841751-180841773 CATACTATGAAAAAGGAAGAAGG + Intergenic
1003481783 6:6541190-6541212 GAATATATGAGAAAAGAAGAAGG - Intergenic
1003510634 6:6776998-6777020 TAATACATGAAAAAGGTGGAAGG - Intergenic
1003626215 6:7744023-7744045 CAACATATGGAAAAAGGGGAAGG + Intronic
1003650967 6:7959800-7959822 CAATATAAGAAAAATGAGCTGGG + Intronic
1003679915 6:8242846-8242868 ACATATATGAGAGAGGAGGACGG - Intergenic
1003975767 6:11342960-11342982 CTAAATATGAAAAAGAAAGAGGG + Intronic
1004031332 6:11871978-11872000 CAATTTGTGAAAAGGAAGGAAGG - Intergenic
1004154007 6:13150763-13150785 CAATATATAAAAGAGGAGAAAGG - Intronic
1004526743 6:16415915-16415937 CAAAACAGGAAAAAGAAGGAGGG + Intronic
1005239934 6:23812544-23812566 CAACATATGAATTGGGAGGAAGG + Intergenic
1005689140 6:28284919-28284941 CAAAATATGAATAAGGACTAAGG - Intronic
1005882640 6:30072574-30072596 GAATGTATGAAAAAGGAAGAGGG + Intronic
1005904179 6:30246487-30246509 CAATATAAGAAAAAATAGGCTGG - Intergenic
1008073375 6:47119944-47119966 TAATAATAGAAAAAGGAGGAGGG + Intergenic
1009360593 6:62806726-62806748 CAATATATCATAAAAGAAGATGG + Intergenic
1010619373 6:78055370-78055392 CAATATATGCAACAGGAGCCAGG - Intergenic
1010673031 6:78709247-78709269 CAACATATGAATATGGAGCAGGG + Intergenic
1010776689 6:79894669-79894691 CAATGAGTGAAAGAGGAGGAAGG - Intergenic
1010851981 6:80788321-80788343 CAAGATATGGAAGAGAAGGACGG + Intergenic
1011554258 6:88558088-88558110 CTATATATTAAAAATGAGGAAGG - Intergenic
1011799531 6:90995649-90995671 CAATAGATAAAAAAGCAGGCTGG - Intergenic
1012227462 6:96720547-96720569 CAATTTGTCAAAAAGGGGGAGGG - Intergenic
1012290259 6:97447020-97447042 CAATATTTCAAAAAGGAGGGAGG - Intergenic
1012301173 6:97590270-97590292 AACTATATGAATAAGGAGGAAGG - Intergenic
1012827819 6:104167661-104167683 CAAAAAATAAAAAAGGAGGAGGG + Intergenic
1013386610 6:109638084-109638106 CCTTTTATGAAAAAGGAGGCAGG + Intronic
1014686850 6:124512397-124512419 CATTAAATGTAAAAGGAGGAAGG + Intronic
1014789883 6:125660165-125660187 CAATACATGAAGAAGTAGGAGGG - Intergenic
1014852420 6:126358194-126358216 CAATTTAGGAAAAAGAAAGAAGG - Intergenic
1014964524 6:127730493-127730515 AAAGAAATGAAAAAGAAGGAAGG + Intronic
1015514174 6:134068486-134068508 CAATCTATGAAAAACATGGAGGG + Intergenic
1016207502 6:141487393-141487415 CAATATATGAATCTGGGGGAAGG - Intergenic
1016225290 6:141727769-141727791 CAACATATGAATTAGGAAGAGGG + Intergenic
1016234673 6:141848995-141849017 CAATGTAGAAACAAGGAGGAAGG - Intergenic
1016237880 6:141890287-141890309 TAATATATAAAAAAAGAGAAAGG + Intergenic
1016359527 6:143252476-143252498 GAATAAATGGAAAATGAGGATGG + Intronic
1017070718 6:150573445-150573467 GAACATAAGAAACAGGAGGAGGG + Intergenic
1017160825 6:151364181-151364203 CTATACATGAAATAGGATGATGG + Exonic
1018651813 6:165998737-165998759 CAATGAATGAGAAAGCAGGATGG - Intergenic
1019642469 7:2111465-2111487 AGATCAATGAAAAAGGAGGAAGG + Intronic
1020499907 7:8904573-8904595 GAATAGAGCAAAAAGGAGGATGG + Intergenic
1022222074 7:28323375-28323397 CAAGATAGGAACACGGAGGAAGG - Intronic
1023308474 7:38856372-38856394 CAACATATGAATTAGGAGGTGGG + Intronic
1023628594 7:42140803-42140825 TTATACAAGAAAAAGGAGGAGGG + Intronic
1023726031 7:43143275-43143297 CAATATATAAAAAAGAAAGGCGG - Intronic
1024542273 7:50486603-50486625 CAACATGTGAATGAGGAGGAAGG - Intronic
1024970791 7:55068254-55068276 GAATATAGGAAATAGAAGGATGG - Intronic
1025271038 7:57517119-57517141 CAATGTCTGAAAAAGAAGGTTGG + Intergenic
1025279131 7:57614386-57614408 CAATATGTGAGACAGGATGAGGG + Intergenic
1025305600 7:57851114-57851136 CAATATGTGAGACAGGATGAGGG - Intergenic
1025967226 7:66285419-66285441 AAATATTTGAAAAGGGAGAAAGG + Intronic
1026789730 7:73323877-73323899 CAAAATATGAAAAATGAGCTGGG + Intronic
1027303593 7:76868091-76868113 AAAAAGATAAAAAAGGAGGAAGG + Intergenic
1027702841 7:81489992-81490014 TAATATATGAACAAGGAGAGAGG + Intergenic
1028310472 7:89327008-89327030 CAATATATGAATGAGTATGAAGG - Intronic
1028326679 7:89535746-89535768 CAAAATATGCAAACAGAGGAGGG - Intergenic
1028604454 7:92640401-92640423 CAATAGATACAAAAGAAGGATGG + Intronic
1029313934 7:99694104-99694126 CAATACATGAAAAAGCAAAAAGG - Intronic
1029853152 7:103485768-103485790 CAATAAATAGAAATGGAGGATGG - Intronic
1031094974 7:117406347-117406369 TAAAATATGAAAATAGAGGATGG + Intronic
1031132877 7:117853273-117853295 TAAAAAATGAAAAAGGAAGAGGG - Intronic
1031486301 7:122330265-122330287 CAATATTTGTTAAATGAGGAAGG + Intronic
1031549111 7:123086201-123086223 CAGTATCAGAAAAAGGAGAATGG + Intergenic
1032412637 7:131709149-131709171 TAATAAATGAAGAAGGAAGAAGG - Intergenic
1032740206 7:134730920-134730942 CAATAGATGAACAATGAGGTAGG - Intergenic
1032924329 7:136585678-136585700 TAGTAAATAAAAAAGGAGGAAGG + Intergenic
1035944527 8:3946699-3946721 CAAAATATGAAAAATGAAAAGGG - Intronic
1036024654 8:4891929-4891951 CAATAAAAGAAAAAAGAAGATGG + Intronic
1037106314 8:15112392-15112414 CAATATCTGAAGCAGGAGAATGG - Intronic
1037156760 8:15710111-15710133 AAATAGAAGAAAAAGGAGGTAGG - Intronic
1037559941 8:20064425-20064447 CAATAAATTAGAAAGAAGGATGG + Intergenic
1038932397 8:32208718-32208740 AAATATTTGAAAAAAGAGAATGG + Intronic
1038981287 8:32762166-32762188 CAATCTATGAAAAAGTAGGCAGG + Intronic
1039341970 8:36660274-36660296 AAATATGTGAAAAAGTAGGCAGG + Intergenic
1039693814 8:39889033-39889055 CAATATCAGAAAATGGAGAAGGG + Intergenic
1040758805 8:50812959-50812981 CTATGTAAGAAAAACGAGGATGG - Intergenic
1040816525 8:51513691-51513713 CAATTTAGAATAAAGGAGGAAGG - Intronic
1041206355 8:55502102-55502124 AAATATTTGAAAAAAGAGGATGG - Intronic
1041800819 8:61796218-61796240 GAAAATAGCAAAAAGGAGGAGGG - Intergenic
1042002769 8:64144983-64145005 GAATGCATGAAAAAGGAGCAAGG - Intergenic
1042240940 8:66663894-66663916 AAATAAATGAAAAAGGGGCAAGG + Intronic
1042361407 8:67887467-67887489 CAACATATTGAGAAGGAGGATGG - Intergenic
1042925931 8:73968633-73968655 CAATATTTGAAATAGCAGGGTGG - Intronic
1044020014 8:87094489-87094511 AAAAATATCAAAAAGGAAGAAGG + Intronic
1045155973 8:99471741-99471763 CAATATGTAAAAAAGGAGTGTGG - Intronic
1045694670 8:104795034-104795056 CAGTACATGAAAAAGTGGGAGGG - Intronic
1046494717 8:114998669-114998691 CAATAAAAAAAAAAGGAGGAAGG - Intergenic
1047177056 8:122551821-122551843 CAACATAAGAAAAAGGATAATGG + Intergenic
1047676271 8:127206513-127206535 CTATTTATGAAAGAGGCGGATGG - Intergenic
1047742081 8:127814587-127814609 CAACATCTGTAAAATGAGGATGG - Intergenic
1047750282 8:127875392-127875414 CAACATGTGAAAAAGGGAGAGGG - Intergenic
1047782993 8:128124839-128124861 CAATACAGGGAAAACGAGGAGGG + Intergenic
1048048171 8:130792687-130792709 CAATAAAAGAAAATGGATGAGGG - Intronic
1050369869 9:4909767-4909789 CTATGTTTGAAAAAGAAGGAAGG - Intergenic
1051097847 9:13487019-13487041 AAAAATAAGTAAAAGGAGGAAGG + Intergenic
1051230352 9:14949403-14949425 CAATTTAGGAAAGAGGAAGAGGG + Intergenic
1051544408 9:18258411-18258433 CCACATAGGAGAAAGGAGGATGG + Intergenic
1053639587 9:40058234-40058256 CAATAAATGAAAAAGTGTGATGG - Intergenic
1053766492 9:41406880-41406902 CAATAAATGAAAAAGTGTGATGG + Intergenic
1054320391 9:63654893-63654915 CAATAAATGAAAAAGTGTGATGG - Intergenic
1054545162 9:66318386-66318408 CAATAAATGAAAAAGTGTGATGG + Intergenic
1055919400 9:81442364-81442386 CAATAAATGGAAGAGGAGGAGGG + Intergenic
1055968462 9:81888281-81888303 CAATATATTAAAAATTAGGGTGG + Intergenic
1056554455 9:87677158-87677180 CAATAAATGGAGAAGGAGGGAGG - Intronic
1056952627 9:91055772-91055794 TACAATATGAAAAAGGTGGAGGG - Intergenic
1057288505 9:93781557-93781579 CAATATATGCTAAAGATGGATGG - Intergenic
1058599520 9:106654071-106654093 AAATAAAGGAAAAAGGAGGCCGG - Intergenic
1058953183 9:109922453-109922475 AAAAAGATGGAAAAGGAGGAAGG + Intronic
1059347833 9:113643570-113643592 CAATGCAAGAAAAAGAAGGAAGG - Intergenic
1060218602 9:121752881-121752903 CCTCATCTGAAAAAGGAGGAAGG - Intronic
1060867107 9:127009300-127009322 CAATCCATGATAAAGGATGAGGG - Intronic
1202787459 9_KI270719v1_random:41929-41951 CAATAAATGAAAAAGTATGATGG - Intergenic
1203630515 Un_KI270750v1:69215-69237 CAATATGTGACACAGGATGAGGG + Intergenic
1185783191 X:2866943-2866965 CAATATTGCAGAAAGGAGGAGGG + Intronic
1186235726 X:7507429-7507451 CAAAAAATGAAAAAAGAGGTAGG + Intergenic
1187590990 X:20717297-20717319 CAAAATATAAAAATAGAGGAAGG - Intergenic
1187700201 X:21957580-21957602 CATTATTTGAAAAAGAAGGCCGG - Intronic
1187790985 X:22949896-22949918 TAATAAATGAAAAAGAATGATGG + Intergenic
1187972783 X:24675149-24675171 CAAGATAAGAATAAGGATGAGGG - Intergenic
1187974927 X:24695450-24695472 CTATATATGAAAAAAGATCAGGG + Intronic
1188895908 X:35668079-35668101 CAAAATATGAAAAACAAAGAAGG - Intergenic
1189090971 X:38082283-38082305 CAATTTATTAAATTGGAGGAGGG - Intronic
1189169641 X:38896779-38896801 AAATAGGGGAAAAAGGAGGAGGG + Intergenic
1189239562 X:39515205-39515227 CAATGAATGAAAAATGAGGCTGG + Intergenic
1189904750 X:45746482-45746504 CAAGAGATGAAAAAGCTGGATGG + Intergenic
1190578713 X:51869458-51869480 CAATTTATTAAAAAGAAAGAGGG + Intronic
1190584333 X:51922896-51922918 AAAAACATGAAAGAGGAGGAAGG + Intergenic
1190952948 X:55163614-55163636 AAATCTAGGAAAAAGGAGGCTGG + Intronic
1191736002 X:64388403-64388425 GAAAATATGTAACAGGAGGAAGG + Intronic
1192622004 X:72686803-72686825 AAATGTATCAAAAAGGAAGATGG - Intronic
1192672398 X:73159295-73159317 CAAAATATGTTAAAGGTGGAGGG + Intergenic
1193459185 X:81769984-81770006 TTATATATAAAAAAGGAGAAAGG + Intergenic
1193654371 X:84181875-84181897 AGATATATGAAAAGGGTGGAGGG - Intronic
1194150456 X:90318732-90318754 AAATATATGAAAAAATAGCAGGG - Intergenic
1194736962 X:97523618-97523640 CAATATTTGAAAAATGAAAAAGG + Intronic
1195954471 X:110314821-110314843 CAATATATGAACAAGCTGTATGG - Intronic
1196492069 X:116279235-116279257 CAATATTTGATAAAAAAGGAGGG + Intergenic
1197570290 X:128142157-128142179 CCAAAGATGACAAAGGAGGAAGG + Intergenic
1198852251 X:140977330-140977352 GAAAATAAGAAAGAGGAGGAGGG - Intergenic
1200496819 Y:3895490-3895512 AAATATATGAAAAAATAGCAGGG - Intergenic
1201309936 Y:12587932-12587954 CAATATATGTAAAAGTATGTAGG + Intergenic
1201460516 Y:14217644-14217666 CAAAATGTGCAAAAGGAGAATGG + Intergenic