ID: 1098353352

View in Genome Browser
Species Human (GRCh38)
Location 12:69585863-69585885
Sequence CTGAGCCATCAGAGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 503
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 468}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098353339_1098353352 16 Left 1098353339 12:69585824-69585846 CCGCCCTCCTTCTAGGGGCGGAG 0: 1
1: 0
2: 0
3: 16
4: 129
Right 1098353352 12:69585863-69585885 CTGAGCCATCAGAGGGTGGAGGG 0: 1
1: 0
2: 1
3: 33
4: 468
1098353343_1098353352 9 Left 1098353343 12:69585831-69585853 CCTTCTAGGGGCGGAGCCTGGAG 0: 1
1: 0
2: 1
3: 12
4: 198
Right 1098353352 12:69585863-69585885 CTGAGCCATCAGAGGGTGGAGGG 0: 1
1: 0
2: 1
3: 33
4: 468
1098353340_1098353352 13 Left 1098353340 12:69585827-69585849 CCCTCCTTCTAGGGGCGGAGCCT 0: 1
1: 0
2: 2
3: 8
4: 126
Right 1098353352 12:69585863-69585885 CTGAGCCATCAGAGGGTGGAGGG 0: 1
1: 0
2: 1
3: 33
4: 468
1098353341_1098353352 12 Left 1098353341 12:69585828-69585850 CCTCCTTCTAGGGGCGGAGCCTG 0: 1
1: 0
2: 0
3: 15
4: 131
Right 1098353352 12:69585863-69585885 CTGAGCCATCAGAGGGTGGAGGG 0: 1
1: 0
2: 1
3: 33
4: 468
1098353334_1098353352 22 Left 1098353334 12:69585818-69585840 CCCGCTCCGCCCTCCTTCTAGGG 0: 1
1: 0
2: 0
3: 17
4: 189
Right 1098353352 12:69585863-69585885 CTGAGCCATCAGAGGGTGGAGGG 0: 1
1: 0
2: 1
3: 33
4: 468
1098353336_1098353352 21 Left 1098353336 12:69585819-69585841 CCGCTCCGCCCTCCTTCTAGGGG 0: 1
1: 0
2: 0
3: 14
4: 220
Right 1098353352 12:69585863-69585885 CTGAGCCATCAGAGGGTGGAGGG 0: 1
1: 0
2: 1
3: 33
4: 468
1098353347_1098353352 -7 Left 1098353347 12:69585847-69585869 CCTGGAGCGACGGGGTCTGAGCC 0: 1
1: 0
2: 0
3: 7
4: 116
Right 1098353352 12:69585863-69585885 CTGAGCCATCAGAGGGTGGAGGG 0: 1
1: 0
2: 1
3: 33
4: 468

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098353352 Original CRISPR CTGAGCCATCAGAGGGTGGA GGG Intronic
900426621 1:2583230-2583252 CTGTGTCCTCACAGGGTGGAAGG - Intergenic
900582950 1:3418357-3418379 CTGCACCAGCAGAGGGTGGCCGG - Intronic
900664966 1:3809038-3809060 CTGTGTCCTCACAGGGTGGAAGG + Intergenic
901177880 1:7317972-7317994 CTGAGCCATCAGAGCCTGGGTGG - Intronic
901218925 1:7571240-7571262 CTGCGTCCTCACAGGGTGGAAGG + Intronic
901840843 1:11952992-11953014 CTGTGTCCTCAGATGGTGGAAGG + Intronic
902203461 1:14851076-14851098 CTGACACATCTGATGGTGGAAGG - Intronic
902979690 1:20113907-20113929 CTGTGTCCTCTGAGGGTGGATGG - Exonic
906066074 1:42981041-42981063 CCGAACCCTCAGAGGGTAGAGGG + Intergenic
906492278 1:46278108-46278130 CAGAACCATCAGGGGGTGGCCGG - Exonic
907124387 1:52036497-52036519 CAGAGGCAGAAGAGGGTGGAAGG + Intronic
907864562 1:58387235-58387257 GTGAACCTTCAGAGAGTGGAGGG - Intronic
909681251 1:78294487-78294509 CTGTGGCTTCAGAGGGTAGAAGG + Intergenic
909694535 1:78451472-78451494 CTGTGCCCTCATATGGTGGAAGG - Intronic
910461024 1:87448080-87448102 TTGAGCCAACAGAGGCGGGAGGG - Intergenic
910628892 1:89337074-89337096 CTGTGGATTCAGAGGGTGGAAGG + Intergenic
911093254 1:94034708-94034730 CTGAGCTCACAGAGGTTGGAGGG - Intronic
912744865 1:112237747-112237769 CTGAGTAATCAGAGGGTAGGAGG - Intergenic
912959378 1:114181546-114181568 CTGAGCCTACAGATGGGGGAGGG + Intergenic
913077122 1:115350059-115350081 CAGAGCCATCAGCAGCTGGAGGG - Intergenic
913649206 1:120894441-120894463 CTGTGCCCTCACATGGTGGAAGG - Intergenic
914129357 1:144843052-144843074 CTAAGCCATAAGAGGGAGGGAGG - Intergenic
915002654 1:152607696-152607718 CTGAGCCAGGAGAGGGTGCTGGG - Intergenic
915464782 1:156090672-156090694 TGGAGCCCACAGAGGGTGGAGGG + Intronic
915986385 1:160469552-160469574 CTGAGCCATCTGAAGGCTGAAGG - Intergenic
916853349 1:168726143-168726165 AGGAGGCAACAGAGGGTGGAAGG + Intronic
918922041 1:190725148-190725170 CTGTGTCCTCAGAAGGTGGAAGG + Intergenic
919743574 1:200994854-200994876 CTAAACCATCAGTGGGTGCAGGG + Intronic
919917636 1:202148581-202148603 CTGGGCCACCGGAGGGTGGCAGG + Exonic
919986904 1:202681781-202681803 CTGAGCAGTCAGGGGATGGAAGG + Intronic
920402005 1:205681786-205681808 CAGAGCCAGGAGAGAGTGGACGG + Intergenic
921095620 1:211884945-211884967 ATGAGCATTCAGAAGGTGGAGGG - Intergenic
922004602 1:221516971-221516993 CAGAGCCTTCAGAGGGAGCATGG + Intergenic
922520341 1:226245089-226245111 GTGAGCCTTCAGATGGTGAAGGG - Intronic
922677592 1:227562042-227562064 CTGGGCCAGAACAGGGTGGAAGG - Intergenic
922743368 1:228029362-228029384 CTGAGCCACCCTGGGGTGGATGG - Intronic
923347649 1:233071318-233071340 GGGACCTATCAGAGGGTGGAGGG - Intronic
923411436 1:233713779-233713801 CTGTGTCATCACATGGTGGAAGG - Intergenic
924690749 1:246347707-246347729 CTGTGACATCACATGGTGGAAGG - Intronic
1063040890 10:2336346-2336368 CTGAGCCATCAGAGCTCTGAAGG + Intergenic
1064225240 10:13477922-13477944 CTGAACCCTCAGAGGGTAGAAGG - Intronic
1064366618 10:14714311-14714333 CTGAGCTAACAGAGGCTGTAGGG - Intronic
1065438460 10:25725261-25725283 GTGAACCATCAGAGAGTGAAGGG + Intergenic
1065641365 10:27785986-27786008 CTGAGACCTCAGAATGTGGAGGG + Intergenic
1065695301 10:28374272-28374294 CTGGGCAAAGAGAGGGTGGATGG - Intergenic
1065869003 10:29940170-29940192 CTGAGCCCTCACATGGTAGAAGG - Intergenic
1066174575 10:32890650-32890672 CTGTGTCCTCAGATGGTGGAAGG + Intergenic
1066190972 10:33055960-33055982 GAGAACCTTCAGAGGGTGGAAGG - Intergenic
1067143982 10:43680209-43680231 CTGAGTCATCCCATGGTGGAAGG - Intergenic
1068915663 10:62428673-62428695 CTGAGGCATCTAAGGCTGGAGGG + Intronic
1069036992 10:63656032-63656054 CTGAGTCCTCACATGGTGGAAGG - Intergenic
1069134790 10:64750982-64751004 CTAAGCCTTCAGAGGGTGAAGGG - Intergenic
1069661247 10:70125058-70125080 CTGAGTCATCCCATGGTGGAAGG - Intronic
1069751408 10:70747580-70747602 TGGAGACAGCAGAGGGTGGAAGG - Intronic
1070646270 10:78204379-78204401 CTGAGGCCTCAGAGGTGGGAGGG - Intergenic
1071073568 10:81725216-81725238 GTGTCCTATCAGAGGGTGGAGGG - Intergenic
1071642928 10:87332895-87332917 TAGAGCCGTCAGAGGGTGTATGG + Intergenic
1071720424 10:88138509-88138531 CTTAGCCAGCAGAGAGTGGAGGG - Intergenic
1071787459 10:88917925-88917947 CTGTGTCCTCACAGGGTGGAAGG + Intronic
1071881702 10:89905946-89905968 GGGACCTATCAGAGGGTGGAGGG - Intergenic
1071899150 10:90100383-90100405 CTGTGCCCTCACATGGTGGAAGG + Intergenic
1072306568 10:94113478-94113500 CTGAGTGTTCAGAGGGTGGATGG + Intronic
1072699873 10:97633114-97633136 GTTAGCGAGCAGAGGGTGGAGGG - Intronic
1073543661 10:104331779-104331801 CTGAGCTATCTGAGGGTGAAAGG - Intronic
1073809084 10:107133006-107133028 CTGAACCTTCAGCGGGTGTAAGG - Intronic
1073934819 10:108618843-108618865 CTGTGCCCTCACACGGTGGAAGG + Intergenic
1073955580 10:108867593-108867615 AGGACCTATCAGAGGGTGGAAGG + Intergenic
1074763483 10:116684362-116684384 CCAAACCATCACAGGGTGGAAGG + Intronic
1074842845 10:117373223-117373245 TTAAGCCATCAGATGCTGGAAGG + Intronic
1075086192 10:119415871-119415893 CTGTGCCATGAGTGGGTTGAAGG + Intronic
1075161832 10:120031121-120031143 CTGGGTCCTCACAGGGTGGAAGG - Intergenic
1075217742 10:120553394-120553416 CTGTGTCATCACATGGTGGAAGG - Intronic
1075397941 10:122141316-122141338 ATGAGCCAACAGGCGGTGGAAGG + Intronic
1075653049 10:124142652-124142674 CTGAGCCCACAAAGGGTGGGTGG - Intergenic
1077465741 11:2732916-2732938 CTGGGCCTCCAGAGGGTGGGTGG - Intronic
1077735119 11:4782831-4782853 CTGTGGCTTCAGAGGGTGCAAGG + Intronic
1078414264 11:11152442-11152464 CTGTGTCATCACATGGTGGAAGG + Intergenic
1079888417 11:26017981-26018003 TTAAGCCATCGGGGGGTGGAGGG + Intergenic
1080709026 11:34728139-34728161 GTGGACCATGAGAGGGTGGAGGG - Intergenic
1080792215 11:35531612-35531634 CTGAGTCCTCACATGGTGGAAGG + Intergenic
1082794234 11:57368449-57368471 CTGGCCCGTCAGAGCGTGGAGGG - Intronic
1083254836 11:61489689-61489711 CTGGGCGATCTGAGGGTCGATGG + Intronic
1083691748 11:64413498-64413520 CTGAGCAACCAGAGGAAGGATGG + Intergenic
1084020208 11:66412813-66412835 CTGAGGCAGGAGAGGGTGGCGGG - Intergenic
1084100269 11:66943324-66943346 CTGCGTCCTCACAGGGTGGAAGG - Intronic
1084330011 11:68424685-68424707 CAGAGCCTTCAGAGGGCGCAGGG - Intronic
1084475660 11:69387199-69387221 CTGACCGAGCAGAGGGAGGAAGG - Intergenic
1085452224 11:76641323-76641345 CAGAGCCTTCAGAGGGAGCACGG + Intergenic
1085733774 11:79021482-79021504 TTGTGCCATCAGATGGTGGGCGG + Intronic
1088252922 11:107877225-107877247 CTGTGTCCTCACAGGGTGGAAGG + Intronic
1089035818 11:115390082-115390104 CTGAGCCATCAGAGGATAGTGGG + Intronic
1089508449 11:118980275-118980297 CTGGGCCCTCAGAGGGAGGGAGG + Intronic
1089940534 11:122411775-122411797 CTGAACCTTCAAAGGGTGAAGGG + Intergenic
1090621299 11:128563301-128563323 CTGAGTCAACACTGGGTGGATGG + Intronic
1091823592 12:3493314-3493336 GTGGGCGATCAGAGGGCGGAGGG - Intronic
1093195180 12:16122141-16122163 CTGCGCCCTCACATGGTGGAAGG + Intergenic
1093231095 12:16542917-16542939 AAGAACCATCAGAGGATGGAGGG - Intronic
1095126317 12:38482128-38482150 CTGAACCCTCACATGGTGGAAGG - Intergenic
1095719357 12:45384187-45384209 CTCAGCCTTCATAGAGTGGAAGG + Intronic
1097352150 12:58560244-58560266 TTGAGCCTTCAGAGAGCGGATGG + Intronic
1098176184 12:67793845-67793867 GGGGCCCATCAGAGGGTGGAGGG + Intergenic
1098353352 12:69585863-69585885 CTGAGCCATCAGAGGGTGGAGGG + Intronic
1100129231 12:91469978-91470000 CTGAGCCATCTGAGACTGGCAGG + Intergenic
1100134049 12:91533161-91533183 CTGTGTCCTCATAGGGTGGAAGG - Intergenic
1102683967 12:114709920-114709942 ATGAGCAATCTGGGGGTGGAGGG + Intergenic
1104114303 12:125734671-125734693 TTGAGGCTTCAGAGGGTGGCAGG + Intergenic
1105941688 13:25153220-25153242 GTGAACCTTCAGAGGGTGAAGGG - Intergenic
1106537316 13:30658570-30658592 CTGTGCCATTAGACGATGGAGGG - Exonic
1106541564 13:30695204-30695226 CTTATACAGCAGAGGGTGGAGGG - Intergenic
1106797877 13:33226045-33226067 CTGTGCCCTCACATGGTGGAGGG - Intronic
1107982780 13:45749328-45749350 CTGTTCCATCAGAGGATGGAAGG - Intergenic
1107982867 13:45750187-45750209 ATGAACCTTCAGAGAGTGGAGGG - Intergenic
1108229833 13:48325132-48325154 GGGACCTATCAGAGGGTGGAGGG - Intronic
1108813046 13:54253578-54253600 GAGGCCCATCAGAGGGTGGAAGG + Intergenic
1109056308 13:57553329-57553351 CTGAGCCTTAAGGGGATGGAGGG + Intergenic
1109752886 13:66719451-66719473 CTGAGTCCTCACATGGTGGAGGG - Intronic
1111766015 13:92530371-92530393 CTGAGGCTTTAGTGGGTGGATGG - Intronic
1112024602 13:95400502-95400524 ATGAGCCTTCAGAGGGTGAAGGG - Intergenic
1112998608 13:105604596-105604618 CTGGGCCTTCACATGGTGGAAGG + Intergenic
1114661001 14:24344816-24344838 CTGAGTCGGCAGGGGGTGGAAGG - Intergenic
1114697708 14:24643364-24643386 CTGAGTCCTCAGAGTGTGAAAGG + Intergenic
1116147927 14:41099567-41099589 CTGTGACTTCAGAGGGTGGAAGG + Intergenic
1117062097 14:51973575-51973597 CGGAGCCAGTAGAGGTTGGAGGG - Intronic
1117514356 14:56485682-56485704 CTGAGTCCTCACATGGTGGAAGG - Intergenic
1118878451 14:69805023-69805045 CTGTGCCCTTAGATGGTGGAGGG - Intergenic
1119113178 14:71994784-71994806 CAGAGCCTTCAGAGGGAGCATGG + Intronic
1119672649 14:76531149-76531171 TGGAGCCAGCAGAAGGTGGAAGG - Intergenic
1120721308 14:87892271-87892293 CTCAGCCTTCAGAGGGAGCACGG + Intronic
1121618860 14:95332360-95332382 CTGAGCCAGCAGAGGAAAGAGGG + Intergenic
1121862247 14:97329447-97329469 CTGTGTCCTCACAGGGTGGAGGG + Intergenic
1122271350 14:100569630-100569652 CTGAGCCAGCGCAGGGTGGGAGG + Intronic
1122320719 14:100854002-100854024 CTGATGGATAAGAGGGTGGAAGG + Intergenic
1122350348 14:101085974-101085996 CTGGGCCATCCTATGGTGGAAGG - Intergenic
1124096006 15:26649339-26649361 CTGGGTCATCACATGGTGGAGGG - Intronic
1125602695 15:40924168-40924190 ATGAGCCATCAGCCAGTGGATGG + Intergenic
1125987397 15:44067580-44067602 CTGCATCCTCAGAGGGTGGAGGG + Intronic
1126358742 15:47823591-47823613 CTGAGACCTCACATGGTGGAAGG - Intergenic
1127783777 15:62338679-62338701 CTGTGCCCTCACATGGTGGAAGG + Intergenic
1129463569 15:75711903-75711925 CTGACCCAGCAGAGGCTGAATGG - Intronic
1129584579 15:76849468-76849490 CAGTGCCATCACAGGATGGAGGG - Intronic
1129721319 15:77879499-77879521 CTGACCCAGCAGAGGCTGAATGG + Intergenic
1129771971 15:78208321-78208343 CTGAGCCCTTAGAGCCTGGAGGG - Intronic
1130461020 15:84158210-84158232 CTCAGCCATCCCAGGGTGGTGGG - Intergenic
1130617341 15:85423749-85423771 CAGATTCATCAGAGGATGGATGG + Intronic
1131001944 15:88946056-88946078 CTGAATCTTCAGAGGGTGAAGGG - Intergenic
1131475540 15:92735511-92735533 CTGTGTCTTCATAGGGTGGAAGG + Intronic
1132119408 15:99163766-99163788 CTGTGTCCTCACAGGGTGGAAGG - Intronic
1132359428 15:101200588-101200610 CTGACCCATCTGGGGGTGCAGGG - Intronic
1132547118 16:538440-538462 CTGAGCCACCACAGGATGGCAGG + Intronic
1132758082 16:1495679-1495701 GTGAGGCACCAGAGGGTGGCAGG - Intronic
1132841428 16:1980100-1980122 CTGAGCCTCCAGACTGTGGATGG + Exonic
1134490703 16:14693760-14693782 GTGAGACACCAGAGGGTGGGAGG - Intronic
1134496084 16:14732878-14732900 GTGAGACACCAGAGGGTGGGAGG - Intronic
1134627933 16:15736190-15736212 GTGAGACTGCAGAGGGTGGATGG + Intronic
1135465258 16:22679535-22679557 CATAGACCTCAGAGGGTGGAGGG - Intergenic
1135681765 16:24463349-24463371 ATGAGTCACCAGAGGATGGAAGG + Intergenic
1136069415 16:27778981-27779003 CTGGGCCCTCTGAGGCTGGATGG - Exonic
1136154718 16:28374952-28374974 GTGAGACACCAGAGGGTGGGAGG + Intergenic
1136208374 16:28740306-28740328 GTGAGACACCAGAGGGTGGGAGG - Intergenic
1136264462 16:29106982-29107004 GTGAGACACCAGAGGGTGGGAGG - Intergenic
1137559416 16:49493205-49493227 CTGAGTCAGCAGAGGCTTGAAGG - Intronic
1138233469 16:55358674-55358696 GGGGCCCATCAGAGGGTGGAGGG + Intergenic
1138544029 16:57705734-57705756 AGGAGAGATCAGAGGGTGGATGG - Intronic
1138613755 16:58148075-58148097 CAGAGCCTTCAGAGGGAGCATGG - Intergenic
1138689504 16:58754121-58754143 CTCCGCCAGCAGAGAGTGGAGGG + Intergenic
1141044394 16:80703566-80703588 CTGAGCCACCACAGGGTGATGGG - Intronic
1141777467 16:86133914-86133936 CTGTGCCATCACTTGGTGGAAGG - Intergenic
1142420156 16:89964961-89964983 CTGAGACATTAAAGGGTGGCAGG - Intronic
1143250915 17:5522396-5522418 CTGTGTCCTCACAGGGTGGAAGG - Intronic
1143316893 17:6039719-6039741 CTGTGCCCTCACATGGTGGAAGG + Intronic
1143538398 17:7555507-7555529 GTGAGCCATCGGAAGGAGGAAGG + Intronic
1144129119 17:12228788-12228810 ATGAGCCCTCAGTGGGTGAATGG + Intergenic
1144347048 17:14358978-14359000 CTGAGCCTACAGAGGTTTGAAGG - Intergenic
1144727713 17:17510257-17510279 CTGAGCCATAAGGGAGTGGCCGG + Intronic
1144938155 17:18916812-18916834 CTGTGTCCTCAGATGGTGGAAGG + Intronic
1147117414 17:38311729-38311751 CTGTGTCGTCAGTGGGTGGAAGG - Intronic
1147555025 17:41473133-41473155 GTAAGACATCAGAGGGTGAAAGG + Intergenic
1147978240 17:44259976-44259998 CTGAGCTATCAGTGGTGGGAGGG + Intronic
1147980808 17:44272844-44272866 CTGAGCAGTCTGGGGGTGGATGG + Intergenic
1148412271 17:47477859-47477881 CTGTGTCATCAGTGGGTGGAAGG + Intergenic
1148964453 17:51422899-51422921 CTGAGCCATGGAAGGGGGGATGG + Intergenic
1149344116 17:55717036-55717058 CTGTGCCCTCAGATGGTAGAAGG - Intergenic
1149446673 17:56718569-56718591 CTGAGCCATCAGGAACTGGAGGG + Intergenic
1149781439 17:59399554-59399576 GTGAGCCTTCAGTGGGTGCAAGG + Exonic
1150230396 17:63546517-63546539 CTGAGCCATGAGGTGCTGGAGGG - Exonic
1150364961 17:64573966-64573988 ATGGCCTATCAGAGGGTGGAAGG + Intronic
1151020793 17:70615152-70615174 AGGACCTATCAGAGGGTGGAGGG - Intergenic
1151259060 17:72902434-72902456 TTGAGCCTTCAGAGGGAGCATGG + Intronic
1152148032 17:78580950-78580972 CTGAGCGATCACCGGGTGGCAGG + Intergenic
1152315185 17:79576088-79576110 ATGAGCCTCCAGAAGGTGGATGG + Intergenic
1152461796 17:80445607-80445629 GGGAGCCATCAGAGGGAGGGGGG + Intergenic
1152546459 17:81002543-81002565 CTGCGTCATCACATGGTGGAAGG + Intronic
1152915212 17:83031198-83031220 CTGATCCATCAGAGGCCGGCAGG + Intronic
1153416282 18:4849513-4849535 GTGAGCCTTCAGTGGGTAGAGGG + Intergenic
1153576936 18:6531961-6531983 CAGAGCCTTCAGAGGGAGCATGG - Intronic
1154393824 18:13968960-13968982 CTGTGGCATCACATGGTGGAAGG + Intergenic
1155068481 18:22290104-22290126 CTGTGCCCTCACAGGGTGGAAGG + Intergenic
1155074845 18:22345634-22345656 CTGAGCCAGCTCAGGCTGGATGG + Intergenic
1156458660 18:37308910-37308932 CTGTGCTATCTGAGTGTGGAGGG - Intronic
1156877146 18:42028415-42028437 TTTAGCCAGCAGAGGGTGCAAGG + Intronic
1158598998 18:58841028-58841050 GCGAGCCTTCAGAGGGTGAAAGG - Intergenic
1158626891 18:59079373-59079395 CTGAGCAAGCACAGGGTGGCTGG - Intergenic
1159041444 18:63326663-63326685 CAGAGCCATCTGAGGGATGAAGG + Intergenic
1159643693 18:70892398-70892420 TTGAGCCATCAGAGAGTGCATGG + Intergenic
1159960936 18:74555398-74555420 CCGAGCCATCAGAGGCGGGCTGG - Intronic
1160118966 18:76109827-76109849 CTGTGCCCTCACACGGTGGAAGG + Intergenic
1161153866 19:2722375-2722397 CAGAGCCATCAGTGGGTGAGAGG + Intronic
1161575679 19:5052987-5053009 CTGGGCCACCAGAGGTTGGGTGG + Intronic
1162502940 19:11064860-11064882 CTGAGACATCAGTTGGTGGTTGG + Intronic
1162732638 19:12728184-12728206 CTCAGCAAGTAGAGGGTGGAAGG - Intergenic
1163055174 19:14712595-14712617 CCGAGCCATCAGAGGGAGCACGG - Intronic
1164789966 19:30968435-30968457 CTGAGCCTTCAGAGAGAGCATGG + Intergenic
1165762492 19:38329823-38329845 CTGAGCCATGGAAGGGAGGAGGG + Intergenic
1165793564 19:38506188-38506210 TTGAGCCAGGGGAGGGTGGAGGG + Intronic
1165869396 19:38960357-38960379 CTTTGCCGTCAGATGGTGGATGG + Intronic
1165981846 19:39730965-39730987 CTGATCCATGACAGGGTGGGTGG - Intergenic
1166097315 19:40549061-40549083 CTGAACAAGGAGAGGGTGGAAGG + Intronic
1168476259 19:56677569-56677591 CTGTGTCCTCACAGGGTGGAAGG + Intergenic
926028263 2:9563604-9563626 CTGGGCCTTCAGAGGGAGCATGG + Intergenic
926704210 2:15825392-15825414 CTGACCCAGCAGAGGAAGGAAGG - Intergenic
928600185 2:32896902-32896924 CTGTGCCATCCCAAGGTGGAAGG - Intergenic
930165753 2:48202253-48202275 TTGAACCCTCAGAGGGTAGAGGG - Intergenic
930253667 2:49064466-49064488 CTGAGTCCTCACATGGTGGAAGG - Intronic
930263624 2:49174846-49174868 CTGAGCCATCAGAGGGCACAAGG + Intergenic
930683669 2:54285101-54285123 CTGTGCCCTCATATGGTGGAAGG + Intronic
932326890 2:70869156-70869178 CTGAGTCATCACATGGTGGAGGG - Intergenic
932341509 2:70965218-70965240 CGGAGCCAGCGGAGGGCGGAGGG - Exonic
932837679 2:75052257-75052279 CTAAGTCCTCAGATGGTGGAAGG - Intronic
933238364 2:79890885-79890907 CTGTGTCATCACATGGTGGAAGG + Intronic
933240296 2:79913428-79913450 CTGAGGCATCAGTCGGTGCAGGG + Intronic
933389098 2:81648679-81648701 GTGAACCTTCAGAGGGTAGAAGG - Intergenic
934103882 2:88678771-88678793 GTGACCCTTCAGAGGGTGAAAGG - Intergenic
934771136 2:96908193-96908215 CTGAGCACACAGAGTGTGGACGG + Intronic
935828741 2:106977195-106977217 CTGTGGCATCAGAGTGTGGATGG + Intergenic
936084457 2:109456893-109456915 CTGAGCCTTCAGAAAGTGGCAGG + Intronic
936619457 2:114080414-114080436 CTGTGTCATCACATGGTGGAAGG + Intergenic
937036729 2:118788379-118788401 TAGAGCCTTCAGAGGGAGGATGG - Intergenic
937152856 2:119697778-119697800 GTGAACCTTCAGAGGGTGGAGGG - Intergenic
937758801 2:125574650-125574672 CAGGGCCATGAGAGGCTGGAGGG - Intergenic
938341917 2:130541475-130541497 CTGAGCCAACACAGGAAGGAGGG + Intronic
938347915 2:130579236-130579258 CTGAGCCAACACAGGAAGGAGGG - Intronic
938786246 2:134632621-134632643 CTGTGTCCTCAAAGGGTGGAAGG + Intronic
938920178 2:135987671-135987693 CTGGAACATGAGAGGGTGGAAGG + Intergenic
939961310 2:148568445-148568467 CTGAGCCTGCAGATGGTGCAAGG + Intergenic
940632953 2:156261651-156261673 GGGGCCCATCAGAGGGTGGAGGG + Intergenic
940989715 2:160085184-160085206 CTTAGCCAACAGAGGATGTAAGG - Intergenic
942235202 2:173897413-173897435 CTGAGCCATCTGAGTGAGAAAGG + Intergenic
944396390 2:199272460-199272482 CTGAGCCGAAAGAGTGTGGATGG + Exonic
945191973 2:207197874-207197896 CTGAGCCAACACAGGGTGTATGG - Intergenic
945524761 2:210874463-210874485 CTGTGTTATCAGATGGTGGAAGG + Intergenic
947576481 2:231279017-231279039 CTGTGGCAACAGAGAGTGGATGG - Intronic
948149593 2:235734437-235734459 CTTTGCCATCAGAGAGGGGAGGG - Intronic
948251865 2:236535987-236536009 CTGGGCCAGCAGAGGGAGGTGGG + Intergenic
948530108 2:238598734-238598756 CTGAGCCAGGACAGGGTAGAAGG - Intergenic
948582950 2:239000326-239000348 CTGTGCCCTCACATGGTGGAAGG + Intergenic
948981133 2:241495420-241495442 CTGGGCCAGGAGAGGGAGGAGGG + Exonic
1169301440 20:4445171-4445193 CTGCATCATCAGATGGTGGAAGG - Intergenic
1169969108 20:11249416-11249438 CTGAGAATTCAGTGGGTGGAGGG - Intergenic
1170509640 20:17063558-17063580 CTCACCCAACAGAGGATGGAAGG - Intergenic
1172980148 20:38935382-38935404 CAGGGCCACCAGAGGGTGGCAGG - Intronic
1173225827 20:41161946-41161968 CTAACCCATGAGAGGGAGGAAGG - Intronic
1173291510 20:41719072-41719094 CTGTGCCCTCACATGGTGGAAGG + Intergenic
1173428131 20:42960349-42960371 CTGTGTCCTCACAGGGTGGAAGG + Intronic
1173999285 20:47362600-47362622 GTGAGCCACAGGAGGGTGGAGGG - Intergenic
1174089134 20:48032947-48032969 GGGATCTATCAGAGGGTGGAGGG - Intergenic
1174194080 20:48760631-48760653 CTGAGCCAGGAGAGGGAGGCTGG + Intronic
1174263337 20:49313426-49313448 GGGAGCCTTCAGAGTGTGGAGGG - Intergenic
1174780597 20:53385474-53385496 CACAGCCATCAGATGGTGAAAGG + Intronic
1175051945 20:56163943-56163965 CTGTGTCACCAGATGGTGGAGGG - Intergenic
1178037635 21:28602676-28602698 CTGAGCCAATAGAGGGTAAAAGG + Intergenic
1178123939 21:29497338-29497360 AGGAGCCATCAGAAGCTGGAGGG - Intronic
1178352762 21:31884639-31884661 CTGAGTCCTCATATGGTGGAAGG - Intronic
1178458293 21:32776586-32776608 CTGAGTCCTCACATGGTGGAAGG + Intergenic
1179174883 21:39001080-39001102 CTGAGGCAGTAGAGGGTGGGTGG - Intergenic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1181128229 22:20714095-20714117 CAGAGCCTTCAGAGGGGGCACGG + Intronic
1181311281 22:21946211-21946233 CAGGGCCACTAGAGGGTGGAGGG + Intronic
1181711610 22:24695143-24695165 CTGAGCCACCAGGGGGTGCGCGG + Intergenic
1181928946 22:26383801-26383823 CTGAGCTAAGAGAGGGAGGATGG - Intergenic
1182335302 22:29580133-29580155 CTGAGCCCTCTGAGGGTGGGAGG + Intronic
1183007562 22:34916188-34916210 CTGTGTCCTCACAGGGTGGAAGG - Intergenic
1184186985 22:42871546-42871568 TTGAGCCCACAGAGGGTGGAGGG + Intronic
1184219409 22:43089575-43089597 CTGGGCCCCGAGAGGGTGGACGG - Intergenic
1184888097 22:47359430-47359452 CTGAGCCCTCACAGGGTCAAAGG - Intergenic
1185108934 22:48890068-48890090 GGGAGCCACCAGAGGCTGGAAGG + Intergenic
949511228 3:4768817-4768839 CTGAACCATCAGAGGAAGGCAGG - Intronic
949721235 3:6992790-6992812 GTAAGACATCAGAGGGTGGGAGG - Intronic
950203849 3:11062944-11062966 CTGAGCCAGATGAGTGTGGAGGG + Intergenic
950523084 3:13507876-13507898 CTGAGGCAGCAGAGTGGGGATGG - Intergenic
953058146 3:39404791-39404813 GTGAACACTCAGAGGGTGGAGGG + Intergenic
954284224 3:49607342-49607364 CTGAGCCAACAGAGGGACCAGGG - Intronic
954761390 3:52877261-52877283 CTGAGGCATGTGAAGGTGGAGGG - Intronic
954784217 3:53081286-53081308 CTGAGCCAGCAAAGGAGGGAGGG - Intronic
955807752 3:62755097-62755119 CTGAGACTTCAGAGAGGGGAAGG + Intronic
955955797 3:64288149-64288171 TTGAACCCTCAGAGGGTAGAGGG + Intronic
956123388 3:65988437-65988459 ATGAGCCATCAGCGGCTGCAAGG + Intronic
956460925 3:69471761-69471783 CTGAGTCAGAAGAGAGTGGATGG - Intronic
957114339 3:76005053-76005075 CTGTGCCATCTCATGGTGGAAGG - Intronic
957211375 3:77262825-77262847 CTGAGACAGCAGAGGTTGGATGG + Intronic
957262804 3:77922493-77922515 TTGAGCCATCAGAGTGGGGGAGG - Intergenic
957463104 3:80548149-80548171 CTGAGTCTTCATATGGTGGAAGG + Intergenic
962814902 3:138988832-138988854 CTGTGTCCTCACAGGGTGGAAGG + Intergenic
963052900 3:141157789-141157811 CTGAGCCAACAGAGGGCAGAAGG + Intergenic
964964313 3:162472124-162472146 CTGTGTCATCACATGGTGGAAGG + Intergenic
965317730 3:167211922-167211944 CTGAGCCAACCGGAGGTGGAAGG + Intergenic
966008462 3:175047023-175047045 CTGTGTCCTCAGATGGTGGAAGG + Intronic
966200518 3:177356423-177356445 CTGAGCTAGGAGAAGGTGGAGGG + Intergenic
966420761 3:179732184-179732206 CTTATCCACCAGAGGCTGGAAGG + Intronic
967170015 3:186815724-186815746 CTTAGTCATCACAGGATGGAAGG - Intergenic
968813045 4:2808770-2808792 CTGAGCCCTAGGAGGGTGGGTGG - Intronic
968813062 4:2808819-2808841 CTGAGCCCTAGGAGGGTGGGTGG - Intronic
968813079 4:2808868-2808890 CTGAGCCCTAGGAGGGTGGGTGG - Intronic
968813096 4:2808917-2808939 CTGAGCCCTAGGAGGGTGGGTGG - Intronic
968813113 4:2808966-2808988 CTGAGCCCTAGGAGGGTGGGTGG - Intronic
968813130 4:2809015-2809037 CTGAGCCCTAGGAGGGTGGGTGG - Intronic
968813147 4:2809064-2809086 CTGAGCCCTAGGAGGGTGGGTGG - Intronic
968813164 4:2809113-2809135 CTGAGCCCTAGGAGGGTGGGTGG - Intronic
968813181 4:2809162-2809184 CTGAGCCCTAGGAGGGTGGGTGG - Intronic
968813198 4:2809211-2809233 CTGAGCCCTAGGAGGGTGGGTGG - Intronic
969299007 4:6286359-6286381 CTGTGTCCTCACAGGGTGGAAGG - Intronic
969346145 4:6571322-6571344 CTGAACCATCAGAGGAGGTAGGG + Intergenic
969719183 4:8883639-8883661 CAGAGCCACCAGGGGCTGGAAGG - Intergenic
970789529 4:19840249-19840271 CTGCGTCATCTCAGGGTGGAAGG - Intergenic
971278163 4:25217406-25217428 CAGAGCCTTCAGAGGGAGCATGG + Intronic
971448238 4:26775590-26775612 CTGTGTCATCTGATGGTGGAAGG - Intergenic
972990664 4:44819401-44819423 CAGAGCCTTCAGAGGGAGCATGG - Intergenic
973160683 4:47012350-47012372 GTGGCCTATCAGAGGGTGGAGGG - Intronic
973208490 4:47587674-47587696 CTGCACCTTCAGATGGTGGAAGG + Intronic
973626814 4:52780892-52780914 CCCAGCTAACAGAGGGTGGAGGG - Intergenic
974306126 4:60142508-60142530 GTGAGACTTCAGAGGGTGAAGGG + Intergenic
976513966 4:85943411-85943433 CTGTGCCCTCAGATGGTGGAAGG + Intronic
977002103 4:91518037-91518059 CAGAGCCCTCAGAGGGAGCATGG - Intronic
977653973 4:99500959-99500981 CTGTGCCTTCACATGGTGGAAGG + Intergenic
977729183 4:100331311-100331333 CTGAGCCCACCCAGGGTGGAAGG + Intergenic
978549986 4:109915086-109915108 CTGAGCCACCAGAGGTGGCAAGG - Intronic
979458309 4:120951379-120951401 CTGAGTCCTCAGACAGTGGAGGG + Intergenic
979714600 4:123822581-123822603 CTGTGCCCTCACATGGTGGACGG + Intergenic
980114527 4:128666494-128666516 CTGAGCCATCACATGGTGGAAGG + Intergenic
980982951 4:139669683-139669705 GTGAACCTTCAGAGGGTGAAGGG - Intronic
982403035 4:154989590-154989612 CTTAGCCTTCAGAGGGAGCATGG - Intergenic
982727995 4:158925932-158925954 CTGTGTCCTCACAGGGTGGAAGG + Intronic
983351740 4:166598937-166598959 CTGAGCCATAAGAGTAAGGAGGG + Intergenic
984319054 4:178167938-178167960 CTAAGTCCTCACAGGGTGGAGGG - Intergenic
985370233 4:189278987-189279009 GGGAGTCATCAGAGGGTGGGTGG + Intergenic
986125733 5:4881016-4881038 CGGAGCCTTCAGAGGGAGCACGG - Intergenic
986183981 5:5419430-5419452 CTGGGGCATCCTAGGGTGGAAGG - Intergenic
986867984 5:12012581-12012603 CTGTGCCCTCACATGGTGGAAGG - Intergenic
988538029 5:32086366-32086388 CTTTGCCATCAGAGGGTGAATGG + Intronic
988580220 5:32462240-32462262 CTGCGCCATCACATGGTGGAAGG - Intergenic
989312745 5:40039448-40039470 CTGCACCATCACATGGTGGAAGG + Intergenic
990499737 5:56384108-56384130 CTGAGCCAATCCAGGGTGGAAGG - Intergenic
990735034 5:58851048-58851070 GTGAGACATCAGTGGGTGGTAGG - Intronic
990757383 5:59088775-59088797 GTGACCTATCAGAGGGTGGAGGG + Intronic
991229275 5:64312008-64312030 CAGAGCCATTTGAGGGTGCAAGG + Intronic
993336471 5:86665712-86665734 GTGAGCCATTAGAAGGTAGAAGG - Intergenic
993556715 5:89348546-89348568 GGGACCTATCAGAGGGTGGAGGG + Intergenic
994604368 5:101948449-101948471 AGCAGCCATCAGAAGGTGGAGGG - Intergenic
996284593 5:121774167-121774189 TTGAGCCCTCAGAGGATAGAGGG - Intergenic
996306709 5:122055202-122055224 CTGAGTCCTCACATGGTGGAAGG + Intronic
996362972 5:122670867-122670889 CTGGCCTTTCAGAGGGTGGAAGG - Intergenic
996897105 5:128498016-128498038 GTGAGACATCAGAGGGAGGCAGG + Intronic
996915031 5:128702225-128702247 CTGTGTCATCACATGGTGGAAGG - Intronic
997056674 5:130452208-130452230 CTGTGGCTTTAGAGGGTGGAAGG - Intergenic
997593433 5:135090232-135090254 ATGAGCCAGCAGAGTGTTGAAGG + Intronic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
998403921 5:141863085-141863107 CTGAGCCAGCAGTGGGAGGTGGG - Intronic
998942606 5:147300964-147300986 GTGAACCTTCAGAGGGTGAAGGG - Intronic
999320909 5:150614476-150614498 CTGACCCCTCAGAGGGAGCAGGG + Intronic
999825240 5:155267349-155267371 GGGAGCTTTCAGAGGGTGGAGGG - Intergenic
1000145948 5:158453473-158453495 CTGAGGCTTAGGAGGGTGGAGGG + Intergenic
1001335338 5:170791927-170791949 CTGTGTCATCAGATGGTGGAAGG + Intronic
1001934226 5:175693235-175693257 CAGAGCATTCAGAGGGTGGAAGG + Intergenic
1002085622 5:176773553-176773575 TAGAGCCTTCAGAGGGTGCATGG + Intergenic
1002652699 5:180713361-180713383 GGGACCCATCAGAGGGTGTAGGG - Intergenic
1002723801 5:181281881-181281903 CTGAGCCGTAGGAGGGTGGGTGG + Intergenic
1003486745 6:6586734-6586756 CTGTGCCCTCACATGGTGGAAGG - Intergenic
1004465509 6:15881454-15881476 TAGAGCCATCAGAGAGAGGATGG + Intergenic
1004881446 6:20012432-20012454 CAGAGCCTTCAGAGGGAGCATGG + Intergenic
1005684956 6:28245390-28245412 CTGAGACATCAGAGGATTCATGG - Exonic
1006544884 6:34772091-34772113 TTGAGTAATTAGAGGGTGGACGG + Intronic
1007422737 6:41729237-41729259 CTGGGCCTTGAGAGAGTGGATGG - Intronic
1008613099 6:53202164-53202186 GTGAACCTTCAGAGGGTGAAGGG + Intergenic
1009684355 6:66936947-66936969 CAGTGCCAGCAGAGGGTGGCAGG - Intergenic
1010009393 6:71032694-71032716 CTGAGCCTTCAGAGGCAGGCTGG - Intergenic
1011215056 6:84996729-84996751 CTGAGCCAGGAGAGTGTGGTAGG + Intergenic
1012227949 6:96726410-96726432 CTGAGCCATCAGAAGAATGAGGG + Intergenic
1012396100 6:98799123-98799145 CGGAGCCTACTGAGGGTGGAGGG + Intergenic
1013091622 6:106905576-106905598 ATGAGCCTTCAGAGGGTGATGGG + Intergenic
1014706853 6:124758369-124758391 CTGTGCCCTCACAGGGCGGAAGG - Intronic
1015101375 6:129485797-129485819 CTGAGCCATCACTGTGTGGCAGG + Intronic
1015169893 6:130240768-130240790 CTGAGTCCTCACATGGTGGAAGG - Intronic
1015312006 6:131776498-131776520 GTGATCTTTCAGAGGGTGGAGGG - Intergenic
1015890830 6:137968086-137968108 CTGGGACATCAGAGTGTGGTGGG - Intergenic
1016393076 6:143594340-143594362 CTGAGACATCATAGTGTGGTGGG - Intronic
1017506684 6:155074929-155074951 CTGGGGAGTCAGAGGGTGGAGGG + Intronic
1017848544 6:158281831-158281853 AAGAGTCATCAGATGGTGGAAGG - Intronic
1019760676 7:2810261-2810283 CTGTGTCCTCAGATGGTGGAAGG + Intronic
1022276688 7:28862239-28862261 TTGAGCCATCACAAGGTGGTTGG + Intergenic
1022597025 7:31722562-31722584 CTGACCTATCTGAGGGTGGATGG + Intergenic
1023482485 7:40648824-40648846 CAGAGCCTTCAGAGGGAGCACGG + Intronic
1023985099 7:45089384-45089406 CTGACCAAGCAGAGGGTGCAGGG + Intergenic
1024509289 7:50190508-50190530 CTGAACCCTCAGAGGGTGGTGGG + Intergenic
1025204253 7:56982637-56982659 TGGAGCCACCAGAGGCTGGAAGG + Intergenic
1025667686 7:63594297-63594319 TGGAGCCACCAGAGGCTGGAAGG - Intergenic
1026103657 7:67403431-67403453 CTGTGTCATCACATGGTGGAAGG + Intergenic
1029615927 7:101657150-101657172 CTGAGCCATCAGCAAGGGGAGGG + Intergenic
1030244821 7:107371538-107371560 CTGATCCATCACAGGGTTGATGG - Intronic
1030427194 7:109393488-109393510 CTGTGTCCTCACAGGGTGGAAGG + Intergenic
1031768505 7:125811792-125811814 GGGGCCCATCAGAGGGTGGAGGG - Intergenic
1032531852 7:132627687-132627709 CTGTGCCTTCACATGGTGGAAGG - Intronic
1033079865 7:138285251-138285273 CTGTGCCCTTACAGGGTGGAAGG - Intergenic
1033892785 7:146035961-146035983 CTGAGCTAACAGAGGGTCAAGGG - Intergenic
1034542753 7:151769568-151769590 CAGAGCCTTCAGAGGGAGCATGG + Intronic
1034763336 7:153694337-153694359 GGGTTCCATCAGAGGGTGGAGGG - Intergenic
1037248199 8:16861518-16861540 CTCAACCATAAGAGGGAGGACGG - Intergenic
1039626707 8:39061685-39061707 CTGAGCCATCACATGACGGAAGG + Intronic
1039813976 8:41075874-41075896 CTCAGCCATGACAGGATGGAAGG + Intergenic
1040021398 8:42744545-42744567 CTGAGTCCTCACATGGTGGACGG + Intergenic
1040889606 8:52303198-52303220 CCAAGCCTTCAGAGGGTGCATGG - Intronic
1041116808 8:54547949-54547971 GTGGCCTATCAGAGGGTGGAGGG + Intergenic
1041561627 8:59225595-59225617 CTGAGCCAGTCGGGGGTGGAAGG + Intergenic
1041804808 8:61838462-61838484 GTGAACCTTCAGAGAGTGGAGGG - Intergenic
1043270628 8:78329197-78329219 CAGAGCCTCCACAGGGTGGAAGG + Intergenic
1043692605 8:83174381-83174403 CTGAGCGATGGGATGGTGGAGGG - Intergenic
1044053841 8:87543061-87543083 CTGAGCCTTCAGGGGGCAGAGGG + Intronic
1044063553 8:87669743-87669765 CAGAGCCTTCAGAGGGAGCATGG - Intergenic
1044125767 8:88456904-88456926 CTGAGCCAACCTGGGGTGGAAGG + Intergenic
1044782286 8:95755562-95755584 GGGACCCATCAGAGGGTGAAGGG + Intergenic
1045315472 8:101040257-101040279 CAGAGCCACCAGAAGCTGGAAGG - Intergenic
1045858962 8:106794339-106794361 TAGAGCCATCAGAGGGAGCATGG - Intergenic
1045968745 8:108055992-108056014 CTGAGGGACCAGAGGGTGAATGG - Intronic
1046179305 8:110622278-110622300 GGGGCCCATCAGAGGGTGGAAGG + Intergenic
1046951596 8:120024711-120024733 TAGAGCCATCAGAGGGAGCATGG + Intronic
1047344505 8:124014033-124014055 GTGAGCCTTCAGAGAGAGGAGGG - Intronic
1047603340 8:126449658-126449680 CTGAGTCATCTTAGGGTTGAGGG + Intergenic
1048145156 8:131834474-131834496 TAGAGCCGTCAGAGGGAGGATGG + Intergenic
1048225817 8:132584406-132584428 CTAAGACATCAGAGAGGGGAAGG + Intronic
1048971077 8:139645274-139645296 CTGAGCCTTTAGAAGGTGAAGGG - Intronic
1049323376 8:142009282-142009304 CTGTGCCCTCACATGGTGGATGG - Intergenic
1050206774 9:3204695-3204717 CTGTGTCATCACAAGGTGGAAGG - Intergenic
1053289849 9:36872765-36872787 CTGTGCCCTCATAGGGTGGGGGG - Intronic
1053320857 9:37097810-37097832 CAGAATCAGCAGAGGGTGGAGGG + Intergenic
1053897142 9:42753694-42753716 CAGAGCCAGCAGGGGGTGGCAGG + Intergenic
1054266843 9:62925861-62925883 CGGAGCCAGCAGGGGGTGGCGGG + Intergenic
1054550336 9:66595315-66595337 CGGAGCCAGCAGGGGGTGGCGGG + Intergenic
1056963109 9:91143858-91143880 GTGAGCCATGAGAGGCAGGAAGG + Intergenic
1057397121 9:94690087-94690109 CTGAGCCTTCAGAGGGGGTGTGG + Intergenic
1057519798 9:95751821-95751843 CTGAGCCACAGGAGGGAGGATGG + Intergenic
1058485747 9:105442045-105442067 CAGAGCCATGGGAGGGTAGATGG + Intergenic
1058560844 9:106227269-106227291 CTGTGTCCTCAGATGGTGGAAGG - Intergenic
1058732375 9:107862480-107862502 ATGTGACTTCAGAGGGTGGAAGG - Intergenic
1058748589 9:108016614-108016636 CTGGGGCATGAGAGTGTGGAAGG + Intergenic
1060033817 9:120237798-120237820 CAGAGCCTTCAGAGGGAGCATGG - Intergenic
1060050042 9:120372007-120372029 CTCAGCCATCAGACCCTGGAGGG - Intergenic
1060607767 9:124932828-124932850 CTGTGCCCTCACATGGTGGAAGG + Intronic
1061147660 9:128809179-128809201 CTCAGCCCGCAGCGGGTGGAGGG - Exonic
1061234416 9:129334323-129334345 CAGAGCCTTCAGGGGGAGGAAGG - Intergenic
1061785666 9:133026522-133026544 CTGTGCCATAACATGGTGGAGGG + Intergenic
1061935139 9:133853318-133853340 CTCGGCCAAGAGAGGGTGGAAGG + Intronic
1062127030 9:134869462-134869484 CAGACCCCGCAGAGGGTGGAGGG + Intergenic
1062384251 9:136302812-136302834 CTGAGCATTCAGGGGCTGGAGGG + Exonic
1062432103 9:136530809-136530831 CTGAGCCATCGTGGGGTGCAGGG - Intronic
1185894813 X:3848434-3848456 CTGAGCCTTCAGAGGGAGTGTGG + Intergenic
1185899931 X:3886859-3886881 CTGAGCCTTCAGAGGGAGTGTGG + Intergenic
1185905047 X:3925287-3925309 CTGAGCCTTCAGAGGGAGTGTGG + Intergenic
1186009706 X:5115865-5115887 TGGGGCCATCGGAGGGTGGAAGG - Intergenic
1186061987 X:5719040-5719062 CTGAGCTAGCAGTGGGTGAATGG - Intergenic
1186237932 X:7533343-7533365 CTTTGCCATTACAGGGTGGAGGG + Intergenic
1186621052 X:11240620-11240642 TTGATCAATCAAAGGGTGGATGG - Intronic
1186782677 X:12929083-12929105 CTGAGGCAGTAGAGGGTTGAGGG + Intergenic
1186926825 X:14342847-14342869 CTGATCCATAACATGGTGGAAGG + Intergenic
1188351816 X:29140777-29140799 CTGAGTCCTCACATGGTGGAAGG + Intronic
1188431950 X:30113575-30113597 CTGTGACATCACATGGTGGAAGG + Intergenic
1188584448 X:31756142-31756164 ATGAGCCCCCAGAGGGTGGGAGG - Intronic
1188976651 X:36683541-36683563 CTGAGTGAGCAGATGGTGGAAGG - Intergenic
1189560234 X:42184763-42184785 CTGTGTCCTCAGATGGTGGAAGG - Intergenic
1190132901 X:47767865-47767887 GTGAACCACTAGAGGGTGGAGGG - Intergenic
1190388682 X:49910551-49910573 CTGAGGCATTAGAGGCTTGAAGG - Intergenic
1190953170 X:55165799-55165821 GGGGCCCATCAGAGGGTGGAGGG - Intronic
1191116436 X:56857839-56857861 CTGTGGCTTCAGAGGGTGAAAGG - Intergenic
1192590683 X:72357045-72357067 TTGAACCAGGAGAGGGTGGAAGG + Intronic
1192873228 X:75204771-75204793 CTGCGCCAGCAGAGAGGGGAGGG + Intergenic
1194093867 X:89611480-89611502 GTGAACCTTCAGAGGGTGAAGGG + Intergenic
1194736713 X:97521127-97521149 CTGTGCCCTCACATGGTGGAAGG - Intronic
1194876956 X:99201183-99201205 CTGTGGCTTCAGAGGGTGGAAGG + Intergenic
1195292588 X:103443470-103443492 CTGTGTCATCACAAGGTGGAAGG - Intergenic
1195940995 X:110168028-110168050 CTGAGCCAACAGGCGGTGGCAGG - Intronic
1196937710 X:120745973-120745995 CTGTGCCCTCACATGGTGGAGGG - Intergenic
1196943750 X:120803645-120803667 TTGGCCTATCAGAGGGTGGAGGG - Intergenic
1197814170 X:130479500-130479522 TTGACCCATTAGAGGGTTGAGGG + Intergenic
1199208289 X:145174912-145174934 CTGCGCCCTCATATGGTGGAAGG - Intergenic
1199224515 X:145356860-145356882 GGGACCTATCAGAGGGTGGAGGG - Intergenic
1199680459 X:150220905-150220927 CAGAGCCACCAGAAGCTGGAGGG - Intergenic
1199858861 X:151781645-151781667 CTGAGCCAAGAGTGGGTTGAGGG - Intergenic
1200182029 X:154156442-154156464 GGCAGCCATCAAAGGGTGGAAGG - Exonic
1200187682 X:154193556-154193578 GGCAGCCATCAAAGGGTGGAAGG - Intergenic
1200193332 X:154230696-154230718 GGCAGCCATCAAAGGGTGGAAGG - Exonic
1200199087 X:154268500-154268522 GGCAGCCATCAAAGGGTGGAAGG - Exonic
1201773977 Y:17644722-17644744 ATGAAACTTCAGAGGGTGGAAGG - Intergenic
1201827580 Y:18261267-18261289 ATGAAACTTCAGAGGGTGGAAGG + Intergenic
1202378235 Y:24256970-24256992 CTCAGCCATCCCAGGGTGGTGGG + Intergenic
1202492547 Y:25413151-25413173 CTCAGCCATCCCAGGGTGGTGGG - Intergenic