ID: 1098356559

View in Genome Browser
Species Human (GRCh38)
Location 12:69617871-69617893
Sequence AAGGCCCAGGATTCTGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098356559_1098356565 21 Left 1098356559 12:69617871-69617893 CCACAGGCAGAATCCTGGGCCTT No data
Right 1098356565 12:69617915-69617937 AACCTTGTCCCACCAAGCTTGGG No data
1098356559_1098356564 20 Left 1098356559 12:69617871-69617893 CCACAGGCAGAATCCTGGGCCTT No data
Right 1098356564 12:69617914-69617936 CAACCTTGTCCCACCAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098356559 Original CRISPR AAGGCCCAGGATTCTGCCTG TGG (reversed) Intergenic
No off target data available for this crispr