ID: 1098358555

View in Genome Browser
Species Human (GRCh38)
Location 12:69633306-69633328
Sequence GCTGGAAAGTGGCTGGTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098358555_1098358562 8 Left 1098358555 12:69633306-69633328 CCTTAGACCAGCCACTTTCCAGC No data
Right 1098358562 12:69633337-69633359 TTCGAGTCCTCATCCGTGATGGG No data
1098358555_1098358561 7 Left 1098358555 12:69633306-69633328 CCTTAGACCAGCCACTTTCCAGC No data
Right 1098358561 12:69633336-69633358 CTTCGAGTCCTCATCCGTGATGG No data
1098358555_1098358566 23 Left 1098358555 12:69633306-69633328 CCTTAGACCAGCCACTTTCCAGC No data
Right 1098358566 12:69633352-69633374 GTGATGGGAAGGAAATAGATTGG No data
1098358555_1098358563 12 Left 1098358555 12:69633306-69633328 CCTTAGACCAGCCACTTTCCAGC No data
Right 1098358563 12:69633341-69633363 AGTCCTCATCCGTGATGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098358555 Original CRISPR GCTGGAAAGTGGCTGGTCTA AGG (reversed) Intergenic
No off target data available for this crispr