ID: 1098358611

View in Genome Browser
Species Human (GRCh38)
Location 12:69633909-69633931
Sequence CTGGAGAAGCAGCAGGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098358611_1098358615 -6 Left 1098358611 12:69633909-69633931 CCCTCATCCTGCTGCTTCTCCAG No data
Right 1098358615 12:69633926-69633948 CTCCAGAGTTGGCAGTTACCAGG No data
1098358611_1098358619 24 Left 1098358611 12:69633909-69633931 CCCTCATCCTGCTGCTTCTCCAG No data
Right 1098358619 12:69633956-69633978 CATTCATGGTGATTTGTACCTGG No data
1098358611_1098358617 10 Left 1098358611 12:69633909-69633931 CCCTCATCCTGCTGCTTCTCCAG No data
Right 1098358617 12:69633942-69633964 TACCAGGAGCATGTCATTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098358611 Original CRISPR CTGGAGAAGCAGCAGGATGA GGG (reversed) Intergenic
No off target data available for this crispr