ID: 1098361443

View in Genome Browser
Species Human (GRCh38)
Location 12:69658088-69658110
Sequence TTCCCAGAACACATCCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 191}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098361443_1098361447 14 Left 1098361443 12:69658088-69658110 CCACTCTGGATGTGTTCTGGGAA 0: 1
1: 0
2: 1
3: 9
4: 191
Right 1098361447 12:69658125-69658147 GCAATCTCTCTATATAGGACAGG 0: 1
1: 0
2: 0
3: 3
4: 59
1098361443_1098361446 9 Left 1098361443 12:69658088-69658110 CCACTCTGGATGTGTTCTGGGAA 0: 1
1: 0
2: 1
3: 9
4: 191
Right 1098361446 12:69658120-69658142 AGCTGGCAATCTCTCTATATAGG 0: 1
1: 0
2: 1
3: 8
4: 82
1098361443_1098361445 -8 Left 1098361443 12:69658088-69658110 CCACTCTGGATGTGTTCTGGGAA 0: 1
1: 0
2: 1
3: 9
4: 191
Right 1098361445 12:69658103-69658125 TCTGGGAATCAAGGACAAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098361443 Original CRISPR TTCCCAGAACACATCCAGAG TGG (reversed) Intronic
900430940 1:2603008-2603030 TGCCCAGAACACACGCAGTGGGG - Intronic
900634205 1:3653763-3653785 TTCCCCGAATAAATCCAAAGAGG - Intronic
900695812 1:4009716-4009738 CTCGCAGACCACATGCAGAGAGG - Intergenic
901664639 1:10819444-10819466 TCCCCAGAGCACCTCCAGGGAGG - Intergenic
902830904 1:19011946-19011968 TTCCCAGGGCACAAACAGAGTGG + Intergenic
905470829 1:38190506-38190528 TACCCAGCACACTTCCACAGGGG + Intergenic
905563140 1:38942741-38942763 TTTCCAGAACACTTCCACACAGG - Intergenic
908000239 1:59672191-59672213 TTCCCATCAACCATCCAGAGGGG - Intronic
910359906 1:86405151-86405173 TTACCAGAAACCATCCAGAAAGG + Intergenic
910433172 1:87178701-87178723 TTCCCAGCACACATTCACATAGG + Intergenic
916493894 1:165327535-165327557 ATCCCAGAACCCATCCAGAAAGG + Intronic
917693696 1:177495824-177495846 ATCCCACAACAGATCCTGAGGGG + Intergenic
917832988 1:178913722-178913744 TTCTCTGAAGACATCCAGAAAGG - Intronic
918145149 1:181749561-181749583 TTCACAGAAGAGATTCAGAGAGG - Intronic
921344712 1:214170585-214170607 TCCCCAGCACACATCACGAGAGG + Intergenic
921485943 1:215715560-215715582 TCCCTAGAAAACTTCCAGAGGGG + Intronic
921808392 1:219481637-219481659 TGCCAAGAAGTCATCCAGAGGGG - Intergenic
922036366 1:221852359-221852381 TTCAGAGGACACAACCAGAGAGG + Intergenic
922594711 1:226804682-226804704 TTCCCAGAATACTTCAACAGTGG - Intergenic
923535045 1:234842926-234842948 TTCACAGCACACATCTGGAGGGG + Intergenic
1062838923 10:654598-654620 TTCACAGAACACTACCAAAGAGG + Intronic
1065893445 10:30140269-30140291 TTGCCACCACACATTCAGAGGGG + Intergenic
1070779389 10:79128713-79128735 TCCCCAGGGCACCTCCAGAGTGG + Intronic
1071726775 10:88206322-88206344 TTTCCAGAACAATGCCAGAGGGG + Intergenic
1071759788 10:88589324-88589346 TTCCAAGAATACAACCAAAGAGG + Intronic
1072088943 10:92108142-92108164 TTCCAAGAAGAAATCCAGGGAGG + Intronic
1074039784 10:109776926-109776948 TATCCAGATCACATCCACAGAGG - Intergenic
1075220348 10:120579285-120579307 TCCCTAGATTACATCCAGAGGGG - Intronic
1075468896 10:122673167-122673189 GTCACAGAACACATCAAGACCGG - Intergenic
1075876206 10:125807936-125807958 TGGCCAGACCACATCCAGAAAGG + Intronic
1076283393 10:129270698-129270720 TTCTCAGAACATCTCCAAAGGGG - Intergenic
1076807844 10:132868001-132868023 TTGCCACAGCACGTCCAGAGAGG + Intronic
1078519867 11:12054080-12054102 TTCACAGGGCACACCCAGAGGGG - Intergenic
1079779955 11:24589127-24589149 TTCCCAGAAAGCAGCCAGAGGGG - Intronic
1080421181 11:32112078-32112100 CTTCCAGAAGACTTCCAGAGGGG - Intergenic
1080790597 11:35519382-35519404 TACACAGAACACATCCATAAAGG + Intronic
1080865273 11:36188824-36188846 GTCCCAGAACACAGCCAGCCAGG + Intronic
1082198595 11:49334144-49334166 TTCTCAGAAGACATCTGGAGTGG - Intergenic
1083924327 11:65796813-65796835 TCCCCAGAACACAGCCAGCTGGG + Exonic
1084769286 11:71332169-71332191 TTCCCAGCCCACATCCTGGGAGG + Intergenic
1085043546 11:73340754-73340776 GTCCCACAGCACATGCAGAGTGG - Intronic
1085281869 11:75336247-75336269 TTCCTCAGACACATCCAGAGAGG - Intronic
1086657217 11:89373994-89374016 TTCTCAGAAGACATCTGGAGTGG + Intronic
1089137699 11:116262985-116263007 ATCAAAGAACACATCCATAGTGG - Intergenic
1090634941 11:128685257-128685279 CTCCCAGAACCCAGCCAGTGAGG - Intergenic
1091048498 11:132347294-132347316 TGCCCAGAACACATCCTGTCTGG + Intergenic
1091357824 11:134951427-134951449 TAACCAGCACACTTCCAGAGAGG + Intergenic
1092008786 12:5091688-5091710 TCCTCACAGCACATCCAGAGGGG + Intergenic
1092337111 12:7642855-7642877 TTCCCATAGCACAACCAGAAGGG + Intergenic
1095686053 12:45035128-45035150 TTCCCAAAACACATGCACAGAGG + Intronic
1096879417 12:54655300-54655322 TACCCAGAAGAGAGCCAGAGGGG - Intergenic
1097358678 12:58632091-58632113 TTTCCAGAACACAGCCAGGAGGG - Intronic
1098361443 12:69658088-69658110 TTCCCAGAACACATCCAGAGTGG - Intronic
1098471632 12:70851575-70851597 TTCACAAAACACCTACAGAGTGG - Intronic
1098947888 12:76608595-76608617 TTCCCAGAACACAGAGAAAGAGG - Intergenic
1101221293 12:102644008-102644030 TTCCTGGAGCACATCCAGGGAGG + Intergenic
1101899437 12:108780292-108780314 ATCCCAGATCACATCTACAGTGG - Intergenic
1103618378 12:122170267-122170289 TTTCCAGAAAATATCCAGTGTGG - Intronic
1104373814 12:128247135-128247157 TTCCTTGAGCACAGCCAGAGTGG - Intergenic
1105437283 13:20390164-20390186 TCCCCAGAACACAGCCAGAGTGG + Intergenic
1114139892 14:19897685-19897707 TCACCAGAACCCATCCAGACTGG - Intergenic
1115111633 14:29830345-29830367 TGCCAAGAAGACATTCAGAGTGG + Intronic
1118940605 14:70332748-70332770 TTCCCACAGCAGATCCAGAAGGG + Intronic
1120470960 14:84923977-84923999 TTCTCAGAATGCATCAAGAGCGG - Intergenic
1121309039 14:92924846-92924868 TTCCAAGTACACACCCAGCGTGG - Intronic
1121643670 14:95502918-95502940 TTCACAGAAAACAGTCAGAGTGG + Intergenic
1122009799 14:98736755-98736777 CTCCCAGAGCACAGCCAGACAGG + Intergenic
1122169193 14:99857639-99857661 TTTCCAGAAAACATCCAAGGTGG - Intronic
1123017179 14:105381018-105381040 CTCCGTGAACACATCCAGGGTGG - Exonic
1126636142 15:50781741-50781763 GTCCCATACCACACCCAGAGTGG - Intergenic
1127983241 15:64049499-64049521 TACCCAGAACTCATCCTCAGAGG - Intronic
1130086189 15:80779892-80779914 TCCCCAGAGGGCATCCAGAGGGG + Intronic
1134552293 16:15143827-15143849 TTCCCAGACCAGATGCTGAGTGG + Intergenic
1137556027 16:49470831-49470853 TTCCCAGTGGACAGCCAGAGGGG - Intergenic
1142756320 17:2018449-2018471 GTCCCAGATCCCAGCCAGAGAGG + Intronic
1144247688 17:13383865-13383887 TTCTCAGAGCACATTCACAGAGG + Intergenic
1147574450 17:41590588-41590610 TTCCCAGAAGCCTTCCAGATTGG - Intergenic
1148028713 17:44605542-44605564 TTTCCAGACCTCACCCAGAGGGG + Intergenic
1151119048 17:71771902-71771924 TTCCAAAAACACTTCAAGAGTGG - Intergenic
1151323490 17:73365328-73365350 TTCCCAGGACACATTCACTGAGG + Exonic
1153485359 18:5592652-5592674 TTCCCATAACAGAGGCAGAGGGG + Intronic
1155672121 18:28384493-28384515 TTCCCAGAACAAATTCAGTTTGG - Intergenic
1156661696 18:39353330-39353352 TTCCTTGAAGACATCCAGATAGG - Intergenic
1158110767 18:53939096-53939118 TTCCCACAAGACAATCAGAGAGG + Intergenic
1163266098 19:16223477-16223499 TTCCCAGCCCACATGGAGAGAGG + Intronic
1164265299 19:23610357-23610379 TCCCCAGAGCACAGCCACAGTGG - Intronic
1164643101 19:29840760-29840782 TTCCCTGAACACACTCGGAGGGG - Intergenic
1164746811 19:30622475-30622497 TTCGAACAACACATCCAGAACGG - Intronic
1164809482 19:31144921-31144943 TCCCCAGGCCACATCCAGGGTGG - Intergenic
1165490175 19:36118862-36118884 TTCCCCACACACAGCCAGAGGGG - Intronic
1165809163 19:38600297-38600319 TTCCCCAAACAAAGCCAGAGCGG + Intronic
1166969533 19:46555797-46555819 GTCCCTGAAGACATACAGAGAGG + Intronic
1168550846 19:57292048-57292070 TCCCACGAACCCATCCAGAGTGG + Exonic
925724932 2:6863505-6863527 TGCCCAAAACAGATCCAGAAAGG - Exonic
926567528 2:14493012-14493034 TGCCCAGAAAACATGCAGTGAGG - Intergenic
927393520 2:22623087-22623109 TCTCTAGAAAACATCCAGAGTGG - Intergenic
929999351 2:46850459-46850481 TTCCCCGAAAACACCCAGACAGG - Intronic
931247402 2:60503111-60503133 TTGCCAGGACAAATGCAGAGTGG - Intronic
932140278 2:69270871-69270893 TTTCCAGAATGCATGCAGAGAGG - Intergenic
935493439 2:103748387-103748409 TTGCCAGTAAACAGCCAGAGAGG - Intergenic
939204584 2:139084030-139084052 TTCCCACAAAACTGCCAGAGGGG - Intergenic
942079968 2:172390900-172390922 TTCCCAGAACATTTCCAAACAGG - Intergenic
944302315 2:198137928-198137950 TTCCCAGAACACAGCCTAGGGGG - Intronic
944809773 2:203316699-203316721 TACCCAGAACACAACCTGAAGGG - Intergenic
945190462 2:207182271-207182293 TCCCGAGAACACATTGAGAGAGG + Intergenic
946662624 2:222017863-222017885 TTCCCAGAAATTAACCAGAGAGG - Intergenic
1169326722 20:4682654-4682676 TGCCCACAAAACAACCAGAGTGG + Intergenic
1172314192 20:33940842-33940864 TGCCCAGGACACCTGCAGAGAGG - Intergenic
1173773169 20:45681336-45681358 TTCCCAGATCACATACAAAAAGG - Intergenic
1175264933 20:57696732-57696754 TTCCCAGAATAGACTCAGAGCGG - Intronic
1176350912 21:5795894-5795916 TTCTCAGAAAACATTCAGACAGG - Intergenic
1176357726 21:5916478-5916500 TTCTCAGAAAACATTCAGACAGG - Intergenic
1176545233 21:8193964-8193986 TTCTCAGAAAACATTCAGACAGG - Intergenic
1176564184 21:8377009-8377031 TTCTCAGAAAACATTCAGACAGG - Intergenic
1177826918 21:26094503-26094525 ACCCCAGTAAACATCCAGAGAGG + Intronic
1181928934 22:26383719-26383741 GTCCCAGAACCATTCCAGAGTGG - Intergenic
1185075896 22:48682112-48682134 TCCTCTGAACACATCCACAGGGG - Intronic
1185118929 22:48954178-48954200 TGCCCAGAGCATTTCCAGAGAGG + Intergenic
1185376911 22:50486918-50486940 TACCCAGACCCCATGCAGAGAGG + Intronic
1203250103 22_KI270733v1_random:110202-110224 TTCTCAGAAAACATTCAGACAGG - Intergenic
950541409 3:13615391-13615413 TGCCCAGGACAAATCCACAGGGG - Intronic
950871422 3:16232992-16233014 GTCCAAGAACTCATCCAGTGAGG - Intergenic
952584186 3:34871481-34871503 TTCCTTGACCACATCCAGAATGG - Intergenic
955905799 3:63806326-63806348 ATCCCAGGAAACACCCAGAGTGG - Intergenic
957682508 3:83455444-83455466 TTCCAAGACCACATCTAAAGAGG - Intergenic
961603887 3:128079403-128079425 TTCCAAGACCACTTCCACAGAGG - Intronic
962746217 3:138398966-138398988 ATCCCTGCACACACCCAGAGGGG - Intronic
963487297 3:145951459-145951481 TTCCCAGAACTCAAGCATAGTGG - Intergenic
963487401 3:145952814-145952836 TTCCCAGAACCCAAGCATAGTGG + Intergenic
965176352 3:165338791-165338813 GTCCCAAAACACATCCATGGGGG - Intergenic
968140646 3:196253401-196253423 TTCCCTAAACAAGTCCAGAGGGG + Intronic
969993291 4:11286572-11286594 CTCTAAGATCACATCCAGAGTGG + Intergenic
970951323 4:21758995-21759017 TTGCCAGAACCCATTCAAAGTGG - Intronic
970965336 4:21921835-21921857 TTCCCATAAATCAGCCAGAGTGG + Intronic
971988685 4:33863421-33863443 TTCCTTGAACACATCAACAGTGG + Intergenic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
973834306 4:54793806-54793828 TTGCCAAAACACATCCATTGAGG + Intergenic
977527092 4:98158683-98158705 TTCCCAGAAGAAGTCTAGAGTGG - Intergenic
979558013 4:122073123-122073145 TTCCCAGAAGACAGACAGAAAGG + Intergenic
983734647 4:171043058-171043080 TTCCCCGAACATGGCCAGAGCGG - Intergenic
984756321 4:183328730-183328752 TCACCAGGACAGATCCAGAGGGG + Intergenic
986493092 5:8313666-8313688 GTCCCTGAACACATCTAAAGAGG - Intergenic
986662798 5:10074291-10074313 TACACACATCACATCCAGAGTGG - Intergenic
988900448 5:35726888-35726910 TTCCCTGATAACATCAAGAGGGG - Intronic
988962360 5:36382982-36383004 TTGCCAGAATCCATCCAGGGAGG - Intergenic
989254614 5:39352727-39352749 TTTCCAGAAGGCATCCAGAGGGG + Intronic
994145962 5:96395277-96395299 TTCCAAGAACACATCCAATATGG - Intronic
994732191 5:103505362-103505384 ATCCCAGAACTCACACAGAGAGG + Intergenic
994737668 5:103575596-103575618 CTCCCAGAATATAACCAGAGTGG + Intergenic
995115088 5:108470511-108470533 TTCCCAGTATACATACAGGGAGG + Intergenic
997237330 5:132280408-132280430 CTCCCAGAACAAGTCCAGTGTGG - Intronic
997432689 5:133851677-133851699 TCCCCAGACCAGAGCCAGAGTGG - Intergenic
999650024 5:153756225-153756247 ATCCCACAGCAGATCCAGAGGGG + Intronic
1002168958 5:177364633-177364655 TGCCCAGGACAGAGCCAGAGAGG + Intronic
1002412802 5:179096661-179096683 ATCCCACAACAGATCCTGAGGGG - Intergenic
1002778620 6:349542-349564 CTCCCAGAACCCACCCAGGGTGG + Exonic
1006973631 6:38074888-38074910 TTTACAGAACACAGGCAGAGCGG - Intronic
1008509704 6:52264744-52264766 TTCCCGGAACACATCCAAGAGGG + Exonic
1012050974 6:94343553-94343575 TCCCCAGAACCCAGCCACAGAGG - Intergenic
1013055091 6:106575451-106575473 TTCCAAGGCCACATCCAGAGAGG - Intronic
1013377056 6:109527426-109527448 TTCCATGAACAGATCCAGGGGGG - Intronic
1013442828 6:110188841-110188863 ATCACAGAACCCATCCAGTGAGG - Intronic
1014198369 6:118583348-118583370 TTCCCAGAGCACAACCATAAGGG + Intronic
1014320589 6:119924079-119924101 TTCCCTCAACAAATCCTGAGTGG - Intergenic
1015051565 6:128847152-128847174 TTGCCTCAACTCATCCAGAGTGG - Intergenic
1018705469 6:166460740-166460762 TTCGCAGAAAACATCCAGCCTGG + Intronic
1019125423 6:169837511-169837533 TTCCCACTACACATCCTAAGAGG - Intergenic
1019574560 7:1730249-1730271 TTTCCGGAACACATCCACTGGGG + Intronic
1026445141 7:70477774-70477796 TTCCCAGTACACATCAAGCTTGG - Intronic
1026670211 7:72383651-72383673 TTCCCAGAACACTTCCTTAGAGG - Intronic
1030184933 7:106752241-106752263 TTCTCTGAACAGGTCCAGAGTGG - Intergenic
1030300754 7:107972070-107972092 TTCTTAGAAAACCTCCAGAGAGG - Intronic
1030871290 7:114759346-114759368 TTGCCACAAGACAGCCAGAGAGG + Intergenic
1031121107 7:117723540-117723562 TTCCCAAAACAAATCCAAATTGG - Intronic
1033275869 7:139971276-139971298 TTCCAGGTACACACCCAGAGAGG - Intronic
1035233537 7:157481299-157481321 TTCACATTACACACCCAGAGTGG - Intergenic
1038400008 8:27277404-27277426 TTCCCAGAAGACAGGGAGAGGGG - Intergenic
1039340603 8:36645537-36645559 TTCCCAGATCACAAACTGAGAGG + Intergenic
1043130899 8:76459649-76459671 TTCCCAGATTACAGCTAGAGTGG + Intergenic
1046528558 8:115414075-115414097 TTCACAACACATATCCAGAGGGG - Exonic
1048257061 8:132913082-132913104 TTCACAGATCTGATCCAGAGTGG + Exonic
1050489544 9:6173372-6173394 TTCCCATAACAGATCCTGAGAGG + Intergenic
1052584956 9:30415006-30415028 TTCCCACAGCACATCCTGAAGGG - Intergenic
1052715462 9:32110987-32111009 TTCCCTGAAGACATACAGTGTGG - Intergenic
1055254583 9:74352931-74352953 TTCCCAGAACTCACACAGAGTGG - Intergenic
1056750775 9:89349639-89349661 TTCACAGACAACATGCAGAGAGG - Intronic
1059555458 9:115276220-115276242 GACCCAGAGCACATCCAGAAAGG + Intronic
1059950724 9:119459928-119459950 TTCCCAGAGAACATCCACTGTGG + Intergenic
1061622032 9:131816916-131816938 TTCACAGACTTCATCCAGAGTGG + Intergenic
1061751417 9:132780105-132780127 TTCCCAGATCACGTCCATTGAGG - Intronic
1062292644 9:135803923-135803945 TTCCCGGAACATATCCAGGTGGG - Intergenic
1186388331 X:9132749-9132771 TAACCAGAGCACACCCAGAGGGG + Intronic
1186771764 X:12825345-12825367 TTCCAAGATCACATCCTGGGTGG + Intergenic
1187424262 X:19162861-19162883 CTCCCAGACCAGATCCTGAGGGG + Intergenic
1187488351 X:19725741-19725763 TTCCCAGTTTACATCCAGTGGGG - Intronic
1187900672 X:24025043-24025065 TTCCCAGGACTTATCCAGAGGGG - Exonic
1189885741 X:45542546-45542568 TAGCCAGAACTCCTCCAGAGAGG - Intergenic
1190416236 X:50183093-50183115 GTCCCAGAACTCAGCAAGAGAGG - Intergenic
1191093311 X:56647608-56647630 TTCCCAGCACCAATACAGAGAGG + Intergenic
1192554118 X:72076868-72076890 CTCCCAGAGCACAGACAGAGGGG + Intergenic
1197650815 X:129061458-129061480 TTCCCAGACCACATCAAAATAGG - Intergenic
1201473840 Y:14360287-14360309 ATCCCAGAAGACTTCTAGAGAGG + Intergenic