ID: 1098366204

View in Genome Browser
Species Human (GRCh38)
Location 12:69705914-69705936
Sequence GATGCGGGTTCTGAAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098366204_1098366213 14 Left 1098366204 12:69705914-69705936 CCTGCCTCTTCAGAACCCGCATC No data
Right 1098366213 12:69705951-69705973 TCACTCCAGCAGCTTCCCACAGG No data
1098366204_1098366209 -9 Left 1098366204 12:69705914-69705936 CCTGCCTCTTCAGAACCCGCATC No data
Right 1098366209 12:69705928-69705950 ACCCGCATCGTGGTTTTCCGGGG No data
1098366204_1098366208 -10 Left 1098366204 12:69705914-69705936 CCTGCCTCTTCAGAACCCGCATC No data
Right 1098366208 12:69705927-69705949 AACCCGCATCGTGGTTTTCCGGG No data
1098366204_1098366215 22 Left 1098366204 12:69705914-69705936 CCTGCCTCTTCAGAACCCGCATC No data
Right 1098366215 12:69705959-69705981 GCAGCTTCCCACAGGTCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098366204 Original CRISPR GATGCGGGTTCTGAAGAGGC AGG (reversed) Intergenic