ID: 1098366208

View in Genome Browser
Species Human (GRCh38)
Location 12:69705927-69705949
Sequence AACCCGCATCGTGGTTTTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098366202_1098366208 -8 Left 1098366202 12:69705912-69705934 CCCCTGCCTCTTCAGAACCCGCA No data
Right 1098366208 12:69705927-69705949 AACCCGCATCGTGGTTTTCCGGG No data
1098366201_1098366208 -2 Left 1098366201 12:69705906-69705928 CCACTGCCCCTGCCTCTTCAGAA No data
Right 1098366208 12:69705927-69705949 AACCCGCATCGTGGTTTTCCGGG No data
1098366204_1098366208 -10 Left 1098366204 12:69705914-69705936 CCTGCCTCTTCAGAACCCGCATC No data
Right 1098366208 12:69705927-69705949 AACCCGCATCGTGGTTTTCCGGG No data
1098366203_1098366208 -9 Left 1098366203 12:69705913-69705935 CCCTGCCTCTTCAGAACCCGCAT No data
Right 1098366208 12:69705927-69705949 AACCCGCATCGTGGTTTTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098366208 Original CRISPR AACCCGCATCGTGGTTTTCC GGG Intergenic