ID: 1098371418

View in Genome Browser
Species Human (GRCh38)
Location 12:69764311-69764333
Sequence TTGTATATGGTGAAGGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 955
Summary {0: 1, 1: 1, 2: 6, 3: 130, 4: 817}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098371418 Original CRISPR TTGTATATGGTGAAGGGGGA TGG Intronic
900075831 1:816964-816986 TTGTATATGGTGAAAGGTAGGGG - Intergenic
900768343 1:4520453-4520475 TCATATATGGTGGAGGTGGAGGG - Intergenic
901127071 1:6937110-6937132 TGGTAAATGGTGAATGGTGATGG - Intronic
902085552 1:13857943-13857965 TTGTATATGGTGTAAGGAAAGGG + Intergenic
902758656 1:18566578-18566600 ATGTAGATGGTGAAGGTGGGTGG + Intergenic
903613438 1:24633868-24633890 TTGGAGATGGTGAAGGGACAGGG + Intronic
904111172 1:28127653-28127675 TAGTGTATGGAGAAGGGGCATGG + Intergenic
904204627 1:28845741-28845763 TTGTATATGGTGTAAGGGAAAGG + Intronic
904958564 1:34310836-34310858 TTGTATATGGTGAAAGGAAGGGG - Intergenic
905244562 1:36603571-36603593 TTGGATATGGTGAAGGAGTCTGG - Intergenic
905487368 1:38312122-38312144 TTGTATATGGTGAAAGGTAGGGG - Intergenic
905968818 1:42124391-42124413 TTGTATATGGTTATGAGGTAGGG - Intergenic
906449809 1:45935564-45935586 TTGTATATGGTGAAAGGAAGGGG + Intronic
907017409 1:51030534-51030556 TTGTATATGGTGAAAGGTAAGGG + Intergenic
907032201 1:51183550-51183572 GTGTATTTGGGGAAGGGGAAGGG + Intergenic
907583848 1:55597024-55597046 TTGTATATGGTGAAAGATGGGGG + Intergenic
908013011 1:59801909-59801931 TTGTATATGGTGTAAGGAGGGGG - Intergenic
908204408 1:61830849-61830871 TTGTATATGGTGAAAGGAAGGGG - Intronic
908812236 1:67994599-67994621 TTGTATATGGTGAAAGGCAAGGG - Intergenic
908868483 1:68579658-68579680 TTGTATATGATGAGAGGGTAGGG - Intergenic
908924653 1:69239643-69239665 TTGTAAATGGTGAAAGGTAAGGG + Intergenic
909101341 1:71353074-71353096 TTGTATATGGTGTAAGGGAGGGG - Intergenic
909232454 1:73106954-73106976 TTGTATACGGTGAAAGGTGAGGG - Intergenic
909519773 1:76554103-76554125 TTCTACATGATGAAGGGGGAAGG - Intronic
909659456 1:78065863-78065885 TTGTATATGGTGTAAGGAAAAGG - Intronic
909901265 1:81138879-81138901 TTGTGTATGGTGAACTGAGATGG + Intergenic
910254374 1:85232723-85232745 TTGTATATGGTGAAAGGTAAGGG + Intergenic
910393322 1:86766705-86766727 TTGTATATGGTGAAAGGAAAGGG + Intergenic
910686603 1:89923897-89923919 TTGTATATGGTGAAAGGACGGGG - Intronic
910813242 1:91259378-91259400 TTGTATATGGTGTAAGAGAAGGG - Intergenic
911374806 1:97039103-97039125 TTGTATATGATGAAAGGGAGGGG + Intergenic
911492110 1:98582917-98582939 TTGTATATGGTGACAGGTGTGGG + Intergenic
911545096 1:99206895-99206917 TTGTATATGGTGAAAGGTAAGGG - Intergenic
911578630 1:99608619-99608641 TTGTATATGGTGAAAGGTAAGGG + Intergenic
912019091 1:105081907-105081929 TTGTATATGGTGAATAGTTAGGG + Intergenic
912190680 1:107336442-107336464 TTGTATATGGTGTAAGGTAAGGG - Intronic
912857513 1:113183451-113183473 TTGTATATGGTGATGGGTAGAGG - Intergenic
912957064 1:114162315-114162337 TTGTATATGGTGAAAGAGAAGGG - Intergenic
913386693 1:118265445-118265467 TTGTATATGGTGAAAGGAAGGGG - Intergenic
913412021 1:118562601-118562623 TTGGATATGAATAAGGGGGAGGG + Intergenic
913418381 1:118636948-118636970 TTATATATGGTCTATGGGGAAGG - Intergenic
913964802 1:143367346-143367368 TTGTATATGCTGTAAGGTGAGGG + Intergenic
914059175 1:144192949-144192971 TTGTATATGCTGTAAGGTGAGGG + Intergenic
914119974 1:144773422-144773444 TTGTATATGCTGTAAGGTGAGGG - Intergenic
914332058 1:146681142-146681164 TTGTAGATGGAGCAGAGGGAAGG - Intergenic
914353849 1:146864517-146864539 TTGTATATGGTGAAAAGTAAGGG + Intergenic
914698265 1:150106075-150106097 TTGTATATGGTTAAGAGATAGGG - Intronic
914726326 1:150330663-150330685 TTTTTTATGGAGAATGGGGATGG + Intronic
914968744 1:152287277-152287299 TTGTATATGGTGTAAGGAAAGGG - Intergenic
915012382 1:152699392-152699414 TTGTATGAGGTAAAGTGGGAAGG - Exonic
915236588 1:154487909-154487931 ATGTAAAGGGTGAAGGGAGAAGG - Intronic
915775318 1:158478124-158478146 TTGTATATGGTGAAAAGTGAGGG - Intergenic
915933710 1:160077536-160077558 TTGTATAAATTCAAGGGGGATGG - Intergenic
916179106 1:162069383-162069405 TTGTTTTTGGAGAGGGGGGAGGG - Intergenic
916582347 1:166120347-166120369 TTGGATATGGTGCAGTGTGATGG - Intronic
917134286 1:171774080-171774102 TTGTATATGGTGTAGGGTAAGGG + Intergenic
917234821 1:172879787-172879809 TTGCATATGGTGAAAGGTGTGGG + Intergenic
917417186 1:174822584-174822606 TTTTCCATGGTGGAGGGGGAGGG + Intronic
917562828 1:176177756-176177778 TTGTATTTTGTTAAGGTGGAGGG - Intronic
918031342 1:180815378-180815400 TTGTGTATGTTGTAGGGGGAGGG + Intronic
918219287 1:182421255-182421277 TTGTATATGGTGAAAGGTAGGGG + Intergenic
918974372 1:191462947-191462969 TTGTATATGGTGTAGGGAAAGGG - Intergenic
919144710 1:193619336-193619358 TTGTATATGGTGAACGTTCAAGG - Intergenic
919296435 1:195707503-195707525 TTGTATTTGGTGAAAGGTAAAGG - Intergenic
919352312 1:196473227-196473249 GGGTATATGATGAAGGGGCAAGG - Intronic
919645066 1:200087207-200087229 GTGTATGTGTTGAAGGGAGAGGG - Intronic
920550095 1:206853057-206853079 TTGTATATGGTGAAAGGTAGGGG - Intergenic
920603071 1:207348742-207348764 TTGTATATGGTGAAAGGTAGGGG + Intronic
920770324 1:208878612-208878634 TTTTATATTGAGAATGGGGAGGG - Intergenic
921109775 1:212023885-212023907 TTGTATATGGTGAAAGGTAGGGG + Intronic
921269890 1:213458146-213458168 TTGTAGAGGGGGAAGGAGGATGG - Intergenic
921390731 1:214610856-214610878 TTGTATATGGTGTAAGGAGGGGG + Intronic
921546427 1:216480391-216480413 TTGTATATGGTGTAAGGTAAGGG - Intergenic
921969266 1:221128143-221128165 TTGTATATGGTGAAAGGTAGAGG - Intergenic
922026768 1:221757073-221757095 GTGTTTGTGGTGATGGGGGAGGG - Intergenic
922194655 1:223349628-223349650 TTGTATATGGTGAGGGTGATAGG - Intronic
922391596 1:225149125-225149147 TTGTATATGGTGAAAGGAAGGGG + Intronic
922998447 1:229985404-229985426 TTGAACATGGTGGAGGGGGAGGG - Intergenic
923249438 1:232166502-232166524 TTGTATATTGGGAAGGGTGGAGG - Intergenic
923345750 1:233050651-233050673 TTGTATATGGTGAAAGGTAGGGG - Intronic
923430041 1:233911108-233911130 TTGTATGAGGTGAGGGGGAAGGG + Intronic
923639553 1:235740425-235740447 TTGTCTCTGTGGAAGGGGGACGG - Intronic
924791149 1:247249491-247249513 TTATATATGGTGAAGGAGAGGGG + Intergenic
924929380 1:248714166-248714188 CTGCATATGGCAAAGGGGGAAGG - Intergenic
1063625306 10:7683924-7683946 TTGTGTATGGTGAAAGGTAAGGG - Intergenic
1063861981 10:10320209-10320231 TTATATATGGTGTAAGGTGAGGG - Intergenic
1064618911 10:17194125-17194147 TTGTATATGGTGAAAGGTAGGGG - Intronic
1064654508 10:17543828-17543850 TGGTATATGCTGAAGGGAGAGGG - Intergenic
1064700955 10:18021142-18021164 TTGTATATGGTGAAAGGGGAGGG + Intronic
1064738635 10:18409682-18409704 TTGTATAGGGTAATTGGGGAGGG + Intronic
1064774500 10:18760626-18760648 TTGTCTGTGGTGCAGGGGGTTGG + Intergenic
1064912903 10:20422612-20422634 TTGTATATGGTGAAAGGAAGAGG + Intergenic
1065451290 10:25860753-25860775 TTGTATATGGTGTAAGGTAAGGG - Intergenic
1066039969 10:31539280-31539302 TTGTATATGGTGTACGGTAAGGG + Intergenic
1066286623 10:33973158-33973180 TTGTATATGGTGTGAGGGAAGGG + Intergenic
1066587538 10:36952905-36952927 CTGTATATGGAGAAGGAGGTGGG + Intergenic
1066993047 10:42534906-42534928 TTGTATACGGTGTAAGGAGAGGG + Intergenic
1067401392 10:45977514-45977536 TTGCATATGGTGCAGGGTTAGGG - Intronic
1067846611 10:49728773-49728795 TTGTATATGGTGTAAGGTGAGGG - Intergenic
1067869741 10:49947090-49947112 TTGCATATGGTGCAGGGTTAGGG - Intronic
1068192539 10:53669963-53669985 TTGTATATGGTGAAAGGTAGAGG - Intergenic
1068310631 10:55270102-55270124 TTGTATATGGTAAAAGGTAAGGG - Intronic
1068328816 10:55534050-55534072 TTGTATATGGTGAAAAGTAAGGG - Intronic
1068494668 10:57772249-57772271 TTGTATATGGTGAGAGGGAGGGG - Intergenic
1068503351 10:57868046-57868068 TTGTAGATGGTGAAGTATGAAGG - Intergenic
1068640534 10:59400295-59400317 TTGTATATGGTGAAAGGTAGGGG + Intergenic
1068771978 10:60831954-60831976 TTGTATATGGTGTAAGGGAAGGG - Intergenic
1069805477 10:71120430-71120452 TTGTATATGGTGCAGGGAAGGGG + Intergenic
1071440943 10:85693753-85693775 TTGTATATGGTGAAAGATAAGGG - Intronic
1071542142 10:86495494-86495516 TTGTATATGGTGTAAGGTTAGGG - Intronic
1071894132 10:90046228-90046250 TTGTATATGGTGAAAGGTAGGGG + Intergenic
1072057702 10:91776669-91776691 TTGTATAGAGTGAGTGGGGAGGG + Intergenic
1072864800 10:99047290-99047312 TTGTATATGGTGAAAGGTAAGGG - Intronic
1073059543 10:100725074-100725096 GTGTGTATGGGGGAGGGGGAGGG - Intergenic
1073661803 10:105483956-105483978 TTGTATATGGTGAAAAGTAAGGG + Intergenic
1073856723 10:107684270-107684292 TTCTATATGGTTGAGGGGTATGG - Intergenic
1073933999 10:108608570-108608592 TCGTATATGGTGTAAGGAGAGGG - Intergenic
1074072955 10:110091604-110091626 TTGTATATGGTGAAAGGAAAAGG - Intronic
1074248473 10:111718383-111718405 TTGTATATGGTGTAAAGAGAAGG - Intergenic
1074323487 10:112425175-112425197 TTGGCTTTGGTGAAAGGGGAGGG - Intronic
1074488845 10:113919683-113919705 TTGAATTTGGGGAAGGGGGTAGG + Intergenic
1074581816 10:114726423-114726445 TGGTATAAGGCAAAGGGGGAAGG + Intergenic
1074664418 10:115703228-115703250 TTGTATATGGTGAAAGGTAGGGG - Intronic
1074933603 10:118155687-118155709 TTGTATATGGTGAGAGGTAAGGG - Intergenic
1075094310 10:119460991-119461013 GTGTAAATGGTGAGGGGGGCCGG - Intergenic
1075329936 10:121566655-121566677 AGGTGTATGGTGGAGGGGGAGGG - Intronic
1075952809 10:126496711-126496733 TTGAATATGGGGATGGGGAAAGG + Intronic
1076101542 10:127783921-127783943 TTGTATATGGTGTAAGGAGGGGG - Intergenic
1076103239 10:127799152-127799174 TGGTATATGTTGGTGGGGGAGGG - Intergenic
1076292585 10:129358875-129358897 TTTTGTAAGGTGAAGGGGGAAGG + Intergenic
1077107278 11:847716-847738 TTGTAGATGGGAAAGGGGGTGGG + Intronic
1078036331 11:7809181-7809203 TTGTATATGGTGAAAAGAAAGGG - Intergenic
1078217827 11:9326651-9326673 TTGTATATGGTGTAAGGAGGGGG - Intergenic
1078410346 11:11109939-11109961 TTGTATATGGTGTAAGGTAAGGG + Intergenic
1078695763 11:13629588-13629610 TTACTTATGGTGAAAGGGGAAGG - Intergenic
1078779904 11:14427681-14427703 TTGTATATGGTGTAAGGTAAGGG - Intergenic
1079184615 11:18225273-18225295 TTGTATATGGTGAAAAGTAAGGG + Intronic
1079232090 11:18657543-18657565 CTTTATATGGTGATGGGGAAGGG - Intergenic
1079302794 11:19294266-19294288 TTGTATATGGTGAAAGGGAGGGG + Intergenic
1079709588 11:23665315-23665337 TTGTATATGGTGAAAGGTAATGG + Intergenic
1080152398 11:29068603-29068625 TTGTATATGGTGAATGGTAGAGG - Intergenic
1081107165 11:39084759-39084781 TTGTATATGGTGAAAGGTAAGGG + Intergenic
1081267170 11:41039101-41039123 TTGTATATGGTGAAAGGCAAGGG + Intronic
1081945605 11:46990801-46990823 TTGTATATAGTGAAAGGTAAGGG + Intronic
1082089361 11:48076712-48076734 TTTTAAATGGTAAAGGGGGAGGG + Intronic
1082114433 11:48312925-48312947 TTGTATGTGGTGTAAGGGAAGGG - Intergenic
1082668903 11:56009514-56009536 TTGTATATGGTGAAAGATAAAGG - Intergenic
1082754632 11:57062422-57062444 TTGTATATGGTGAAAGGAAAGGG - Intergenic
1082886052 11:58083631-58083653 TTGTATATGCTGAAAGGTAAGGG + Intronic
1083514974 11:63248695-63248717 TTGTATATGGTGTAAGGAAAGGG - Intronic
1083527137 11:63379335-63379357 TTGTATATGGTGAAAGGAAGGGG - Intronic
1084252981 11:67916512-67916534 TTGTATATGGTGTAAGGGAGGGG - Intergenic
1084614052 11:70223327-70223349 TTGTATGTGGTGAAAGGCAAGGG - Intergenic
1084819887 11:71679477-71679499 TTGTATATGGTGTAAGGGAGGGG + Intergenic
1085335770 11:75693456-75693478 TTGTATATGGTGAATGGTAGGGG + Intergenic
1085888514 11:80549536-80549558 TTGTATATGATGAAAGGAAAAGG - Intergenic
1085898850 11:80672725-80672747 TTGTATATGGTGAGAGAGAAGGG + Intergenic
1086013854 11:82139930-82139952 TTGTATATGGTGAGAGGTGGCGG - Intergenic
1086041365 11:82483202-82483224 TTTTATATGGTGACCAGGGAAGG - Intergenic
1086076129 11:82854990-82855012 TTGTATATGGTGAAAGGAAGGGG - Intronic
1086266489 11:85004898-85004920 TTGTATAAGGTGAAAGGGAGAGG + Intronic
1086293011 11:85332628-85332650 TTGTATATGGTGAAAGGAAGGGG + Intronic
1086839888 11:91672057-91672079 TTGTATATGGTGTAAGGGGGGGG - Intergenic
1087113858 11:94502255-94502277 TAGTGTATGGTGAAGAGGAAAGG - Intergenic
1087439804 11:98169007-98169029 TTGTGTATGGTGAAGGGTGGGGG - Intergenic
1087691321 11:101323892-101323914 TTGTAGATAGGGAAAGGGGAAGG + Intergenic
1087873209 11:103325382-103325404 TTGTATATGGTGGAAGGAGTGGG + Intronic
1088235094 11:107714899-107714921 ATGTATATGGTGATGGTGGTGGG - Intronic
1088471531 11:110192355-110192377 TTGTATATGGTGAAAGGTAGTGG - Intronic
1088508190 11:110547282-110547304 TTGTATATGGTGAAAGGAAGGGG - Intergenic
1088508196 11:110547314-110547336 TTGTATATGGTGAAAGGAAGGGG - Intergenic
1089548660 11:119252190-119252212 ATGTAAATGGAGTAGGGGGAGGG - Intronic
1089570130 11:119402136-119402158 TTGTATATGGTGAGAGGTGGGGG - Intergenic
1089674241 11:120079413-120079435 CTGTAAATGTTGAAGGGGGAAGG + Intergenic
1089718414 11:120387235-120387257 TTGTGTGTGGTGGGGGGGGAGGG + Intronic
1089951146 11:122527962-122527984 TTGTATATGGTGTAAGGAAAGGG + Intergenic
1090770647 11:129916749-129916771 TTCTATAAGGTGGAGGGGGTTGG - Intronic
1090895252 11:130966406-130966428 TTGTATATGGTGAAAGGTAGGGG + Intergenic
1092068926 12:5616755-5616777 CTGTATAAGGTGATGGGTGAGGG - Intronic
1092199903 12:6574651-6574673 TAGTGTATGGTGATGGGGGTCGG + Intronic
1092512807 12:9175280-9175302 TTGTATATGGTGAAAGGAAGGGG - Intronic
1092636591 12:10457561-10457583 TTCTATATGGTGAAAGGTAAGGG + Intergenic
1092636807 12:10460109-10460131 TTGTATATAGTGTAGGGAAAGGG + Intergenic
1092674843 12:10904496-10904518 TTGTATATGGTGAAAGGTAAAGG - Intronic
1092751182 12:11720547-11720569 TTGTATATGGTGAAAGGTAAGGG - Intronic
1093092845 12:14940517-14940539 TTTTATATGGTGAAAGATGAGGG - Intergenic
1093230977 12:16541525-16541547 TTGTGTATGGTTAGTGGGGAAGG - Intronic
1093481725 12:19611079-19611101 TTGTATATGGTGAAAGGAAGGGG + Intronic
1094212957 12:27911308-27911330 TTGACTATGATGAAGAGGGAAGG - Intergenic
1094353002 12:29547037-29547059 TTGTAAAGGGTGAATGGGGTGGG + Intronic
1095051638 12:37559855-37559877 TTGTATATGGTGAAAGGTAGGGG - Intergenic
1095402609 12:41832591-41832613 TTGTAAAGGGTAACGGGGGAAGG - Intergenic
1095617180 12:44204870-44204892 TTGTATATGGTGAAAGGAAGGGG - Intronic
1096608476 12:52784928-52784950 GTTTATATGTTGAAGGGGGCTGG + Intergenic
1096900040 12:54867650-54867672 TTGTATATGGTGAAAGGAAAGGG + Intergenic
1096920445 12:55079838-55079860 TTGTATATGGTGAAAGGTAGGGG - Intergenic
1096963532 12:55604685-55604707 TTGTATATGGTGTAAGGAAAGGG - Intergenic
1097339149 12:58417578-58417600 TTGTTGATGGTGAAGTTGGAAGG + Intergenic
1097527733 12:60759382-60759404 TTGAAGATGGAGAAGGGGGCAGG - Intergenic
1098035409 12:66296877-66296899 TTGTATTGGGGGAATGGGGAGGG - Intergenic
1098371418 12:69764311-69764333 TTGTATATGGTGAAGGGGGATGG + Intronic
1098563319 12:71902547-71902569 TTGTATATGGTGAAAGGTAGGGG - Intronic
1098583255 12:72126672-72126694 TTGTATATGGTGAAAGGTACAGG - Intronic
1098717982 12:73856505-73856527 TTGTATATGGTGTAAAGGAAGGG + Intergenic
1098738081 12:74132893-74132915 TTGTATATGGTGAAGTGTATGGG + Intergenic
1099059006 12:77882399-77882421 TTGTATATGGTGAAAGGTAAAGG - Intronic
1099096490 12:78380292-78380314 TTGTGTTTGGGGAAGGAGGAAGG - Intergenic
1099114192 12:78603586-78603608 TTGTATATGGTGAATAGTAAGGG - Intergenic
1099271680 12:80518649-80518671 TTGTATATGGTGAAAGATGGAGG + Intronic
1099381773 12:81963350-81963372 TTGTATATGGTGAAAGGTAGGGG - Intergenic
1099400556 12:82198422-82198444 TTGTATATGGTGATGGGCAGGGG - Intergenic
1099600852 12:84735574-84735596 TTGTATATGGTGAAAGGTAGGGG - Intergenic
1099617090 12:84949770-84949792 TTGTATATGGTGAAAGGAAGGGG - Intergenic
1099627368 12:85091672-85091694 TTGTATATGGTGAAAAGTAAAGG + Intronic
1099768804 12:87025669-87025691 TTGTATATGGTGAAAGGGAGAGG - Intergenic
1100424228 12:94468217-94468239 TTGTATATGGTGTTGGGTAAGGG - Intergenic
1100483907 12:95006148-95006170 TGGTATATGGTGTAGGGTAAAGG + Intergenic
1100627507 12:96350689-96350711 TTGTATATGGTGTAAGGTAATGG - Intronic
1100683987 12:96965549-96965571 TTGTATATGGTGGAAGGTAAAGG - Intergenic
1100948947 12:99823760-99823782 TTGTATATGGTGAAAGGTTAAGG + Intronic
1100952831 12:99871091-99871113 TTGTATATGGTGAAAGGTAGGGG + Intronic
1101167928 12:102058230-102058252 TTTTATATGGTAAAGGATGAGGG - Intronic
1101861682 12:108487365-108487387 TTGTATATGGTGAAAGGAAGGGG - Intergenic
1101861710 12:108487704-108487726 TTGTATATGGTGAAAGGAAGGGG - Intergenic
1102436107 12:112925286-112925308 TTGTATGAGGAAAAGGGGGAGGG - Intronic
1102597347 12:114002953-114002975 TTGTATTTGGAGATGGGGGAGGG - Intergenic
1102864865 12:116366477-116366499 TAGCATATCATGAAGGGGGAGGG - Intergenic
1103179372 12:118895948-118895970 TTGTATATGGTGAAAGGAAGGGG - Intergenic
1104173597 12:126306489-126306511 TTGTATATGGTGAAAGGTATGGG + Intergenic
1105343292 13:19548680-19548702 TTGTATATGGTCAAAGGTGGGGG - Intergenic
1105537018 13:21275416-21275438 TTGTATATGGTCAAAGGTGGGGG + Intergenic
1105672238 13:22632221-22632243 TTGTATATGGTGTAAGGAAAGGG + Intergenic
1105963447 13:25363844-25363866 TGGGATGGGGTGAAGGGGGAGGG + Intergenic
1106388190 13:29308374-29308396 TTGTATATGGTGAAAGGAAGGGG - Intronic
1107020881 13:35749902-35749924 TTGTATATGGTGAAAGAGGGGGG + Intergenic
1107309954 13:39066036-39066058 TTGTATATGGTGTAAGGCAAAGG + Intergenic
1107487602 13:40844565-40844587 TTGTATATGGTGAAAGGCATAGG - Intergenic
1107790805 13:44000240-44000262 TTGTTTTTGGTGAAGTGGAATGG + Intergenic
1108155713 13:47583018-47583040 TTGTATATGGTGAAAGGTAGGGG - Intergenic
1108195210 13:47986719-47986741 TTGTATATGGTGTAGGGAAGGGG + Intronic
1108231450 13:48347156-48347178 TTGTATATGTTTAAGGGTGAAGG + Intronic
1108636421 13:52339394-52339416 TTGTGTATAGTGTAAGGGGAGGG + Intergenic
1108659017 13:52565977-52565999 TTGTATATGGTGAAAGGTATAGG + Intergenic
1108787150 13:53918564-53918586 TTGTATATGGAGAAGAGGAAGGG + Intergenic
1109078729 13:57870576-57870598 TTGTATATGGTGAAAGGTCAGGG - Intergenic
1109145622 13:58775730-58775752 TTGTATATAGTGAAAGGTAAAGG - Intergenic
1109450528 13:62508133-62508155 TTGTATATGGTGAAAGGTAGGGG + Intergenic
1109473864 13:62851533-62851555 TTGTATATGGTGAAAGAGAGGGG + Intergenic
1109573337 13:64221335-64221357 TTGTATATGGTGTAAGGAAAGGG + Intergenic
1110012223 13:70351222-70351244 TTGTATATGGTGTAAGGAAAGGG + Intergenic
1110063453 13:71070004-71070026 TTGTATATGGTGAAAGGAAGGGG + Intergenic
1110504127 13:76264937-76264959 TTGTATATAGTGAAAGGTAAGGG - Intergenic
1110966266 13:81701164-81701186 TTCTATATGGAGAAAGGGGTTGG + Intergenic
1111053331 13:82914880-82914902 TTGTATATGGTGAAAGATAAGGG - Intergenic
1111389560 13:87575173-87575195 TTGTGTATGGTGGAGTGGGGTGG - Intergenic
1111642151 13:90982061-90982083 TTGTATATGGTGAAAGGAAGGGG - Intergenic
1111857525 13:93657419-93657441 TTGTATATGGTGAAAGGAAGGGG - Intronic
1111861563 13:93713903-93713925 TTGTATATGGTGAAAGGTATGGG - Intronic
1111898099 13:94166602-94166624 TAATGTATGGTGCAGGGGGAGGG - Intronic
1111899557 13:94184095-94184117 CTGTATATGGTGAAAGGTAAAGG - Intronic
1112194397 13:97210952-97210974 TTGTGTATGGAGAAGAGGGGTGG + Intergenic
1112264411 13:97909808-97909830 TTGTATATGGTGAAATGTAAGGG + Intergenic
1112479189 13:99758261-99758283 TGGCATCAGGTGAAGGGGGAAGG + Intronic
1113283337 13:108815483-108815505 TTGAAGATGGTGGAAGGGGAGGG + Intronic
1113712056 13:112472324-112472346 TTGTATATGGTGAAAGGAAGGGG - Intergenic
1114848440 14:26352703-26352725 TTGTATATGGTGAATGGCAGGGG + Intergenic
1114991051 14:28290450-28290472 TTGTATATGGTGAAAGGAAGGGG + Intergenic
1115182452 14:30645004-30645026 TTGTATATGGTGAAAGGAAGGGG + Intronic
1115344810 14:32331048-32331070 TGCTAGATGGTGATGGGGGAAGG + Intronic
1115391930 14:32863600-32863622 TTGTATATGGTGAAAGGAAGGGG + Intergenic
1115629461 14:35229466-35229488 TTGTATATGGTGAAAGGTAAAGG + Intronic
1115858943 14:37662580-37662602 TTGTATATGGTGAAAGGAAGGGG + Intronic
1116026267 14:39519193-39519215 TTGTATATGGTGAAAGGTAAAGG - Intergenic
1116292178 14:43057994-43058016 TTGTATATGGTAAAAGGTTAAGG + Intergenic
1116395272 14:44440961-44440983 TTGTATATGGTGAAAGGTAGAGG - Intergenic
1116482621 14:45410024-45410046 TTGTATATGATGAAAGGTAAGGG + Intergenic
1116489486 14:45489421-45489443 TTGTATATGGTGAGAGATGAGGG + Intergenic
1117023798 14:51599310-51599332 TTGTATATGGTGAAAGGGAGGGG - Intronic
1118180748 14:63490249-63490271 TTGTATATGGTGAAAGGTGTAGG - Intronic
1118888218 14:69884606-69884628 TTGTATATGGTGAGAGATGAGGG + Intronic
1119128286 14:72148653-72148675 TTGAATATGGTGTGGGGGCAGGG + Intronic
1119826518 14:77661255-77661277 TAGTGTCTGGTGAAGGGGGCTGG + Intergenic
1120029040 14:79619376-79619398 TTGTATATGGTGAGAGGTGTAGG + Intronic
1120131614 14:80814575-80814597 TTGTATATGGTGAGAGGTAATGG - Intronic
1120147454 14:80994698-80994720 TTGTATATGGTGTAAGGAGAGGG - Intronic
1120367103 14:83584861-83584883 TTATATATGGTGAAGGGTAGGGG + Intergenic
1120576117 14:86183118-86183140 TTGTACATGGTGAAAGGGAGAGG + Intergenic
1121720044 14:96102928-96102950 TTGGCTATGGTGGTGGGGGATGG + Intergenic
1121930161 14:97964928-97964950 TTGTTTATGGGGTAGGGAGAAGG - Intronic
1122259657 14:100507078-100507100 TTGTATATGGTGAAAGGCAGGGG + Intronic
1122600647 14:102920016-102920038 TGGTGGATGGTGAATGGGGATGG - Intergenic
1124412740 15:29450401-29450423 TTGTATATGGTGAAGGGAACGGG + Intronic
1124590954 15:31052408-31052430 TTGTATATGGTGTAAGGTAAGGG - Intronic
1124790921 15:32725809-32725831 TTGTATAAGGTGTAGGGAAAGGG + Intronic
1125234389 15:37495614-37495636 TTGCCAGTGGTGAAGGGGGAAGG - Intergenic
1125238374 15:37543667-37543689 TTGTATATAGTGAAAGGTAAGGG - Intergenic
1125316248 15:38434959-38434981 TTGTATATGGTGAAAGATAAAGG + Intergenic
1125400085 15:39292941-39292963 TTGTATATGGTGTAGGGAAGGGG + Intergenic
1125408608 15:39381223-39381245 TTGTATATGGTGAAAGGAAGGGG - Intergenic
1126155409 15:45561179-45561201 TTGTATATGGTGTAAGGTAAGGG - Intergenic
1126227213 15:46285037-46285059 TTATATATGGTGAAAGGAAAGGG + Intergenic
1126429680 15:48568810-48568832 TTGTATATGGTGTGAGGTGAGGG - Intronic
1126455203 15:48853807-48853829 TTGTATATGGTGAAAAGTAAGGG - Intronic
1126500705 15:49340936-49340958 TTGTATATGATGAAAGGAAAGGG + Intronic
1126659803 15:51021514-51021536 TTGTATATGGTGAAAGGTAGAGG + Intergenic
1126876564 15:53048432-53048454 TTGTATATGGTGTAAGATGAAGG + Intergenic
1127743877 15:61943608-61943630 TTGTATATGGTGAAAGGTAGGGG - Intronic
1127765321 15:62180301-62180323 TTGTATATGGTGAAAGATGGGGG - Intergenic
1127781081 15:62316702-62316724 TTGTACATGGTGAAGAGAAAAGG + Intergenic
1128826973 15:70728195-70728217 TTGTATATGGTGAAAGGTAGGGG - Intronic
1130397777 15:83518913-83518935 TTGTATATGGTGGAAGGTGGTGG + Intronic
1130546865 15:84863164-84863186 TTATGTATGGGGCAGGGGGAAGG - Intronic
1130773666 15:86952852-86952874 TTGTATATAGTGAAAGGTAAGGG + Intronic
1132900154 16:2249557-2249579 TTTTATATGGTAAAGTGGGGAGG - Intronic
1135906513 16:26516954-26516976 TTGGATATGGGGGAGGGGGTAGG + Intergenic
1135911248 16:26563060-26563082 ATGTATATGGTGTAAGGAGAGGG - Intergenic
1136033918 16:27524157-27524179 GTGTCTGTGGTGAAAGGGGAAGG + Intronic
1136677940 16:31930944-31930966 TTGTATATGGTGTAAGGGATGGG - Intergenic
1137258132 16:46795090-46795112 TTGTATATGGTGTAAGGTAAGGG - Intergenic
1137465198 16:48701726-48701748 TTGTATATGGTGAATGGTAGGGG + Intergenic
1137850273 16:51734940-51734962 CTGTATATGGTGAGGGGTTAGGG - Intergenic
1137998645 16:53249338-53249360 TTGTATATGTTAAATGGGGAAGG + Intronic
1138715978 16:59022544-59022566 TGGTATATAGTAAAGAGGGATGG - Intergenic
1139196711 16:64927730-64927752 TTTTATATGGTGAAAGGTAAGGG - Intergenic
1139263124 16:65614432-65614454 TTGTATAAGGTGAAAGGTAATGG + Intergenic
1139980173 16:70851003-70851025 TTGTATATGGTGAAAAGTAAGGG - Intronic
1140001492 16:71029776-71029798 TTGTAGATGGAGCAGAGGGAAGG + Intronic
1140178218 16:72686766-72686788 TTGTATATGGTGTAAGGTAAGGG + Intergenic
1140491570 16:75341255-75341277 TGGTATGTGGTGCAGGTGGACGG - Intronic
1140589907 16:76339285-76339307 TGTTATATGTTGAATGGGGAGGG - Intronic
1140636684 16:76923224-76923246 TTGTATATGGTGTAAGGAAAAGG + Intergenic
1141332518 16:83124682-83124704 TTGTATATGGTGAAAGCTGTGGG + Intronic
1141958538 16:87389490-87389512 TGGCATATGGAGATGGGGGAGGG - Intronic
1142006648 16:87692495-87692517 TTGGGAATGGTGGAGGGGGATGG - Intronic
1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG + Intronic
1142923548 17:3212609-3212631 TTCTATTTGAAGAAGGGGGAGGG + Intergenic
1143346885 17:6256271-6256293 ATGTATGTGGAGAAGAGGGAGGG + Intergenic
1143725927 17:8846133-8846155 TTGTATATGGGGAAGGGTAGTGG + Intronic
1144314584 17:14047976-14047998 GTGTGTATGTTGTAGGGGGAAGG - Intergenic
1144336339 17:14272639-14272661 TTGTATATGATGTAGGGTAAGGG + Intergenic
1145372276 17:22316762-22316784 TTGTATATGGTGAAAGGTAGGGG - Intergenic
1146808660 17:35885801-35885823 TTGGATATAGGGTAGGGGGACGG + Intergenic
1149112629 17:53051251-53051273 TTGTATATGATGAAAGGTAATGG - Intergenic
1149136834 17:53376772-53376794 TTGTATATGGTGAAAGGTAGGGG + Intergenic
1149141815 17:53440274-53440296 CTGTGTATGGTGAGGGGGGATGG - Intergenic
1149718224 17:58815894-58815916 TTCTATATGGAGTAAGGGGAAGG - Intronic
1150739915 17:67771108-67771130 TTGAAGATGGTGAAGTGGGCTGG - Intergenic
1150745121 17:67810549-67810571 TTGGATGAGGTCAAGGGGGAAGG - Intergenic
1150885049 17:69075416-69075438 TTGTATATGGTGAAAGGTGGGGG + Intergenic
1151061996 17:71105720-71105742 TTGTATATGGTAAAGGGTATGGG - Intergenic
1151122973 17:71813466-71813488 CTGTATATGGTGAAAGGAAAAGG - Intergenic
1152128227 17:78460148-78460170 CTGAATAAGGTAAAGGGGGAGGG - Exonic
1153348752 18:4056132-4056154 TTATCTATGGGGAAGGGGGCAGG + Intronic
1153550828 18:6259960-6259982 TTGTATATGGTGAAAGGTAGGGG + Intronic
1153558899 18:6350075-6350097 TTGTATATGGTGTAAGGTAAAGG - Intronic
1153605661 18:6828595-6828617 TTGTATGTGGTGAAAGGTAAGGG + Intronic
1154072930 18:11170261-11170283 TTGTATATGGTGTAAGGCAAGGG - Intergenic
1154397992 18:14009606-14009628 TTGTATATGGTGAAAGGGAGGGG + Intergenic
1154413729 18:14160758-14160780 TTGTATATGATGTAAGGGAAGGG - Intergenic
1156084030 18:33377620-33377642 TTGTATACGGTGAAAGGGAGGGG + Intronic
1157093822 18:44668237-44668259 CTGTCTATTGTGAAGAGGGAGGG - Intergenic
1157448138 18:47763476-47763498 TTGTATATGGTGAAAGGTAGGGG - Intergenic
1158101700 18:53836610-53836632 TTGTACATGGTGAAAGGACAAGG - Intergenic
1158127004 18:54111423-54111445 TTGTATATGGTTAAAGGAGGGGG + Intergenic
1158793778 18:60815964-60815986 TTGTATATAGTGAAAGGTAAGGG - Intergenic
1158823683 18:61190172-61190194 GTGTCTATGTTGCAGGGGGATGG + Intergenic
1159320694 18:66844049-66844071 TCGTATATGGTGAAGGGTAAAGG - Intergenic
1159365356 18:67459198-67459220 TTGTATGTGGTGAAAGGTAAGGG + Intergenic
1159400157 18:67920940-67920962 TTGTATATGGTGTAAGGAAAGGG + Intergenic
1159878754 18:73837952-73837974 TTGTAAATGGCAAAGGGGCATGG - Intergenic
1160342657 18:78102597-78102619 TTGTGGAGCGTGAAGGGGGAGGG + Intergenic
1162357722 19:10196519-10196541 TTGTATATGGTGTAAGGTAAGGG - Intronic
1162963756 19:14145542-14145564 GTGGATATGGGGATGGGGGAGGG + Intergenic
1163214629 19:15866968-15866990 TTGTACATGGTGAAAGGTCAGGG - Intergenic
1163239947 19:16055245-16055267 TTGTATATGGTGAAAGGGAGGGG + Intergenic
1163545451 19:17938762-17938784 TTGTATTTTGTGTAGGGGGTGGG + Intronic
1164684011 19:30155130-30155152 AGGTATATGGAGAAGGAGGAGGG + Intergenic
1164851511 19:31488250-31488272 TTGAATATGGTGATGGGGAAGGG - Intergenic
1165572579 19:36787869-36787891 TTGTATATGGTGAAAGGTAGGGG + Intergenic
1165683521 19:37797998-37798020 TTGTATATGGTGAAAGGTAAGGG + Intronic
1165817987 19:38654747-38654769 TTGTTTATGGAGAAAGGGGAGGG - Intronic
1166997179 19:46725189-46725211 GTGTATATCATGAAGGGGGCGGG + Intronic
1202698578 1_KI270712v1_random:144836-144858 TTGTATATGCTGTAAGGTGAGGG + Intergenic
925017288 2:540399-540421 TTGTATATGGTGAAAGGAAGAGG - Intergenic
925071855 2:975612-975634 CTGTATGTGGTGTAGGCGGATGG - Intronic
926300114 2:11596374-11596396 ATGTGTATAGTGAGGGGGGACGG + Intronic
927070242 2:19521166-19521188 TTTTATATGGTGAAAGGTAAAGG - Intergenic
927234985 2:20864731-20864753 TTGTATATGGTGTAGGGAAGGGG - Intergenic
928037282 2:27836464-27836486 TTGTATATGGTGAAAGATAAGGG - Intronic
928046430 2:27937978-27938000 TTGTATATGATGAAAGGTAAGGG + Intronic
928258706 2:29747753-29747775 TTGGATTTGGTGGTGGGGGAGGG - Intronic
928282254 2:29958465-29958487 TTGTATATGGTGAAAGATAAAGG - Intergenic
928525771 2:32138832-32138854 TTGTATATGGTGAAAAGTAAGGG + Intronic
928781599 2:34828842-34828864 TTGTATATGGTGAGAGGTAAGGG + Intergenic
928805856 2:35153903-35153925 TTGTATATGGTGAAAGGAAAGGG - Intergenic
928988322 2:37202944-37202966 TTGTATCTGCTGAAGAGGTAAGG - Exonic
929083386 2:38144274-38144296 ATGTATATGGGGAATGAGGAAGG - Intergenic
929267570 2:39936324-39936346 TTATATATGGTGAAAGGTCAGGG - Intergenic
929748812 2:44688708-44688730 TTCTGTGTGGGGAAGGGGGAAGG - Intronic
929901164 2:46005032-46005054 TTGGGTATGATGATGGGGGAGGG - Intronic
930630187 2:53745206-53745228 GTGTATATGGAGCAAGGGGAAGG + Intronic
930704270 2:54488664-54488686 TTTTTTATGGTGAAGGGAGGAGG - Intronic
930967511 2:57348190-57348212 TTGTAAAAGGTGTAGGGGGCAGG + Intergenic
931534127 2:63253202-63253224 TTGTATATGGTGAAAAGATATGG - Intronic
931576825 2:63726220-63726242 TTGTATATGGTGAAAGGAAGTGG + Intronic
931798485 2:65735278-65735300 TTGTATATGGTGTAGGGAAGAGG + Intergenic
932077665 2:68680080-68680102 TTGTATATAGTGAAAGGTAAGGG + Intronic
932687149 2:73881267-73881289 TTGTATATGGTGTAAGGAAAGGG + Intergenic
932937183 2:76117704-76117726 TTGTATATGGTGTAAGGAAAGGG - Intergenic
933279490 2:80317372-80317394 TTGTATATTCTGAAAGTGGAAGG - Intronic
933455233 2:82511495-82511517 TTGTATATGGTGAAAGGAAGGGG + Intergenic
933619513 2:84521645-84521667 TTGTATATGGTGTAAGGAAAGGG + Intronic
934149571 2:89132907-89132929 TTGTATATGGTGAAAGGAAGGGG - Intergenic
934217726 2:90049121-90049143 TTGTATATGGTGAAAGGAAGGGG + Intergenic
934279825 2:91602617-91602639 TTGTATATGCTGTAAGGTGAGGG + Intergenic
935186608 2:100739881-100739903 TAGAATATGGTGAAGGGGATTGG + Intergenic
935197664 2:100828568-100828590 TTGTATATGGTGAAAGGTAGGGG + Intronic
935483689 2:103625811-103625833 TTGTATGTGGTGAAAGGTAAGGG - Intergenic
935932470 2:108142713-108142735 TTGTATATGGTGAAAGGAAAGGG - Intergenic
936595557 2:113844053-113844075 TTGTATATGGGGGACGGGCACGG - Intergenic
936782014 2:116044823-116044845 TTGTATATGGTGGAAGGAAAGGG - Intergenic
936818517 2:116489777-116489799 GTGTAGATAGTGAAGGGGCAAGG - Intergenic
937752787 2:125498126-125498148 TTGTATATGGTGAAACGTAAGGG + Intergenic
937756928 2:125550841-125550863 TTATATATGGTGAAAGGATAGGG - Intergenic
938035961 2:128035150-128035172 TTGTATATGTTTTAGGGAGACGG + Intergenic
939040731 2:137186398-137186420 CTGTATATGGTGAAAGGTAAGGG + Intronic
939194249 2:138952981-138953003 TTATATATTGTGAAGGGTGGTGG + Intergenic
939240589 2:139554197-139554219 TTGTATATGGTGTAAGATGAAGG + Intergenic
940083809 2:149835264-149835286 TTGTATAAGGTGTAAGGGAAGGG + Intergenic
940449853 2:153823587-153823609 ATGTATATGGTGAAGGTTGGGGG - Intergenic
940930402 2:159422562-159422584 TTGTATATGGTGAAAGGAAGAGG - Intronic
940948104 2:159641730-159641752 TTGTATATGGTGTAAGGAGGGGG + Intergenic
941092131 2:161189807-161189829 TTGTATATGGAGAAAGGCAAGGG - Intronic
941127180 2:161598338-161598360 TTGTATATAGTGGAAGGTGAGGG - Intronic
941276408 2:163496371-163496393 TTGTATAAGGTGTAAGGGAATGG - Intergenic
941338757 2:164279036-164279058 TTGTATATGTTGAGAGGTGAAGG + Intergenic
941487618 2:166101697-166101719 TTGTATATGGTGAAAGGAAGGGG - Intronic
942216586 2:173726626-173726648 TTGTATATGGTGTAAGGAGAGGG - Intergenic
942288653 2:174448030-174448052 TTGTATATGGTGAAAGGCAGGGG - Intronic
942327154 2:174785707-174785729 TTGTATGTGTGGAAGTGGGAGGG + Intergenic
942828365 2:180208306-180208328 TTGTATATGGTGTAAGGAAAGGG + Intergenic
942833946 2:180269731-180269753 TTGTATGTGGTGAAAGGTTAGGG + Intergenic
942943899 2:181652462-181652484 TTGTATATGGTGAGAGGGAGGGG - Intronic
943191870 2:184687194-184687216 TTGCATATGGTGAAAGGTAAGGG + Intronic
943272363 2:185823030-185823052 TTGTATATGGTGTAAGGTAAGGG - Intronic
943392014 2:187281910-187281932 TTGTATATGGTGAAAGAGTGGGG + Intergenic
943489543 2:188533448-188533470 TTGTATATGGTGAAAGGTAAGGG - Intronic
943616981 2:190104155-190104177 TTGTATATGGTGAAATGTGGGGG - Intronic
943868538 2:192961335-192961357 TTCTATATGGAGGAAGGGGATGG - Intergenic
944602619 2:201319329-201319351 TTGTATATGGTGAAAGGTAGGGG - Intronic
944607778 2:201368852-201368874 TTATATATGGTGAAAGGTAAGGG - Intergenic
945193141 2:207211160-207211182 TTGTATATGGTGAAAGGTAGGGG - Intergenic
945263705 2:207869382-207869404 TGGTATATGGAGAAAGGGAAAGG - Intronic
945363519 2:208922395-208922417 TTGTATATGGTGAAAGGTATGGG + Intergenic
945430657 2:209759959-209759981 TTGTATATGGTGAAAGGAAGTGG - Intergenic
945729610 2:213517772-213517794 TTGTATATGGTAAAAGGTAAGGG - Intronic
948331807 2:237173889-237173911 TTGTATATGGTGTTAGGTGAGGG + Intergenic
948416092 2:237805616-237805638 TTGTATATGGTGAAAGGTAGAGG - Intronic
948490761 2:238311298-238311320 TTGTATATGGTGCAAGATGAGGG - Intergenic
949081885 2:242107742-242107764 TTGTATATGGTGAAAGGTAGGGG + Intergenic
1168733467 20:108438-108460 TTATATATGGTGAAGGGCAGGGG - Intergenic
1168907827 20:1420734-1420756 TTGTATATGGTGAAAGGTAATGG + Intergenic
1169081464 20:2799931-2799953 TTGTCTTTGGTGAAAAGGGAAGG + Intronic
1169151701 20:3294661-3294683 GTGTATATGCTGAAGGAAGATGG - Intronic
1169699640 20:8432021-8432043 TTGTATGTGGTGGTGGGGGTGGG + Intronic
1170178312 20:13497954-13497976 TTGTATATGGTGAAAGGTAGGGG - Intronic
1170282193 20:14662306-14662328 TTGTATATGGTGAAAGGAAGGGG - Intronic
1170725290 20:18920689-18920711 TGGCAGATGGTGAAGGGGGCTGG - Intergenic
1170812056 20:19681691-19681713 TTGTATATTCTGAGGGGGAATGG + Intronic
1171085310 20:22233144-22233166 TTCTACATGCTGAAGGGGGATGG + Intergenic
1171546172 20:26003399-26003421 TTGTATATGGTGAAAGGTAGGGG - Intergenic
1171892755 20:30730838-30730860 TTGTATATGGTGTTGGGTAAAGG + Intergenic
1172378338 20:34465069-34465091 TTGTATATGGTGTTGGGTAAGGG + Intronic
1173206560 20:40999352-40999374 TTGTATATGGTGAAAGGTAGGGG - Intergenic
1173369473 20:42422022-42422044 TTGTATATGGTGTAAGGAAAAGG - Intronic
1173767428 20:45625637-45625659 TTGTATAGGGTGAGAGGCGAAGG + Intronic
1173960598 20:47068972-47068994 TTGCATCTGCTGAAGGGGCATGG - Intronic
1176754773 21:10717726-10717748 TGGTAAATGGTGAAGGGGAGTGG - Intergenic
1176859295 21:13997497-13997519 TTGTATATGATGTAAGGGAAGGG + Intergenic
1176886648 21:14264482-14264504 TTGTATATGGTGGTCAGGGAAGG - Intergenic
1177071548 21:16515026-16515048 TTGTATATGGTGAAAAGTAAAGG + Intergenic
1177270073 21:18836290-18836312 TTGTGTATGGTGAAGGGTAGAGG + Intergenic
1177973684 21:27821732-27821754 TTGTACATGGTGAAAGGTTATGG - Intergenic
1178026261 21:28471704-28471726 TTGTATATGGTGAATGGTAAGGG - Intergenic
1178212190 21:30548449-30548471 TTGTATATGGTGTAAGGAAAGGG + Intronic
1178606567 21:34041828-34041850 TTGTATATGGTGTAAGGTAAGGG - Intergenic
1178742819 21:35218723-35218745 TTGTATACTTTGAAGGGGGATGG - Intronic
1179065463 21:38020642-38020664 TCACATATGGTGAAGAGGGAGGG + Intronic
1179378019 21:40869038-40869060 TTGTATATGGTGAAAGGTAAGGG - Intergenic
1180193017 21:46177082-46177104 TTGTATATGGTGTAAGGAAAGGG - Intronic
1181595139 22:23909226-23909248 TTGGATATGGCTAAGGGAGAAGG + Intergenic
1182819562 22:33203578-33203600 TTGTTTATAGTGAGGGGAGAGGG + Intronic
1183025121 22:35059001-35059023 TTGTATATGGTGTAAGGAAAGGG - Intergenic
1183063264 22:35348080-35348102 CTGTAGATGGTGCAGGCGGAAGG + Intergenic
1183277635 22:36910160-36910182 TTGTATATGGTGAAAGGTAAGGG + Intergenic
1184042280 22:41951281-41951303 TTGTCTATGGCATAGGGGGAGGG + Intergenic
1184376584 22:44117328-44117350 CTGTAGAGGGTGAAGGAGGAGGG + Intronic
949367186 3:3295321-3295343 TTGTATATGGTGAAAGGTAATGG - Intergenic
949507872 3:4743732-4743754 TTGTTGAGGGGGAAGGGGGAGGG + Intronic
949758523 3:7441653-7441675 TTGTATATGGTGTAAGGAGGTGG + Intronic
949815203 3:8050876-8050898 CTGTAAATGGTGAAGGAGGGTGG + Intergenic
950740641 3:15048921-15048943 TTCTATATTGTGAAGGGCAAAGG - Exonic
950848520 3:16039066-16039088 TTGTATATGGTGAATGGTAGGGG + Intergenic
951031345 3:17885219-17885241 GTGTTTGTGGTGATGGGGGATGG - Intronic
951269824 3:20610135-20610157 TTGTATATGGTGAATGGTAAAGG - Intergenic
951309072 3:21101661-21101683 TTGTATATGGTGTAAAGAGAGGG + Intergenic
951732449 3:25825195-25825217 TTGTATATGGTGAAAGGGAAGGG - Intergenic
952570235 3:34707034-34707056 TTGTATATGGTGTAAGGAAAGGG - Intergenic
953261561 3:41344296-41344318 TTGTATATGGTGTAAGGAAAAGG - Intronic
953453427 3:43022691-43022713 TTATATATGATGAAAGGGTAAGG + Intronic
953465459 3:43115572-43115594 AGGTATATGGTGAAGGAGAAGGG + Intergenic
953554770 3:43935611-43935633 TTGTATAAGGTGTAAGGAGAGGG + Intergenic
953712005 3:45281366-45281388 TTGTATATGGTGAGGGATAAGGG - Intergenic
953764364 3:45724860-45724882 TTGTATATGGTGTAGGTGTAAGG + Intronic
954601210 3:51871353-51871375 TTGTATATGGTGTAAGGTAATGG - Intergenic
954971712 3:54656799-54656821 TTCTAACTGGGGAAGGGGGAAGG - Intronic
955265496 3:57439512-57439534 TTGTATATGGTGAAAGGTAGGGG - Intronic
955550811 3:60083136-60083158 TTGTATATGGTGAAAGGTAGGGG + Intronic
955881812 3:63554382-63554404 TTTTATATGGTGAAAGGTAAGGG + Intronic
955968809 3:64416175-64416197 TTCTATATGGTGAAAGGTAAGGG - Intronic
956606213 3:71075647-71075669 TTGCATGTGGTGAAGGAGTATGG + Intronic
956825787 3:72996272-72996294 TTTTATATAGAGAAGGGCGAGGG + Intronic
956864898 3:73359565-73359587 TTTTATATGGTGAAAGGTAAGGG - Intergenic
956953996 3:74315779-74315801 TTGTGTATGGTGATAGGGAAGGG - Intronic
957148257 3:76452318-76452340 TTGTGTGGGGGGAAGGGGGAGGG - Intronic
957258873 3:77874682-77874704 TTGACTATGTTGAAGGGGAAGGG + Intergenic
957374638 3:79340155-79340177 TTATATAAGGTGATGGGGAAAGG - Intronic
957536465 3:81511145-81511167 TTGTATATGGTGAAAGGTCGAGG - Intronic
957592647 3:82220446-82220468 TTGTATATGGTGAAAGGTAAGGG + Intergenic
957621536 3:82599354-82599376 TTATATATGGTGAAAGGCCAGGG - Intergenic
957772688 3:84715028-84715050 TTTTATATGGTGAAAGGGAGGGG - Intergenic
958460700 3:94391010-94391032 TTGTATATGGTGAAAGGAAGGGG - Intergenic
958754295 3:98232211-98232233 TTGTATATGTTGAAAGGTAAGGG - Intergenic
959011883 3:101087148-101087170 TTGTATATGGTGAGAGATGAGGG - Intergenic
959047219 3:101487633-101487655 TTGTATATGGTAAAAGGTAAGGG + Intronic
959416133 3:106078040-106078062 TGGTATATGGGGCAGGGGTAGGG + Intergenic
959481507 3:106878310-106878332 TTGTATATGGTGAAAGAAAAGGG + Intergenic
959719821 3:109474014-109474036 TTGTATATGGTGAAAGGTAGGGG + Intergenic
959947654 3:112143906-112143928 TTGTATATGGTGAAAGGTAGGGG + Intronic
959974348 3:112441527-112441549 TTGTATATGGTGAAAGGTAAGGG - Intergenic
960093406 3:113665070-113665092 TTGTATATGGAGGTTGGGGAAGG + Intronic
960683914 3:120278144-120278166 TTGTATATGGTGAAAGGTAAGGG - Intronic
960736499 3:120786574-120786596 TTGTATATGATGAAAGGAGGGGG + Intergenic
960775638 3:121248817-121248839 TTGTATATGGTGAAAGGTAAGGG + Intronic
961634620 3:128325188-128325210 TTGTTCCTGGGGAAGGGGGAAGG + Intronic
962039479 3:131690508-131690530 TTGTATATGGTGAAATGTAAGGG - Intronic
962512174 3:136113448-136113470 TTGTATATGGTGAAAGGAAGGGG - Intronic
962657163 3:137558981-137559003 TTGTATATGGTGAAAGGTAAGGG - Intergenic
963393304 3:144697571-144697593 TTGTATATGGTGAAAGGTAGGGG + Intergenic
963586085 3:147190756-147190778 TTGTATATTGTGTAGGGTAAAGG + Intergenic
963703462 3:148655800-148655822 TTGTATATGGTGAAAGGAAGGGG + Intergenic
963813075 3:149799025-149799047 TTGTATAAGGTGTAAGGGAAGGG - Intronic
963928126 3:150973196-150973218 TTGTTTTTGGTGGTGGGGGAAGG + Intergenic
964003488 3:151805230-151805252 TTGCAAATGGTGAAGAGGGAGGG + Intergenic
964054429 3:152435212-152435234 TTGTATATGGTGTAAGGAGGGGG + Intronic
964080596 3:152750860-152750882 TTGTATATGGTGTGAGGTGATGG - Intergenic
964296110 3:155235226-155235248 TTGTATATGGTGGCGGGGTGAGG + Intergenic
964412048 3:156408031-156408053 TTGTGGAAGGTGACGGGGGAGGG + Intronic
964458464 3:156894861-156894883 TTGTATATGGTGAAAGCAAAGGG - Intronic
964555745 3:157936221-157936243 TTGGATATGGTGAGGAGGAAGGG - Intergenic
965880159 3:173379681-173379703 TTGTATATGGTGAACGGTATAGG + Intergenic
966173788 3:177113185-177113207 TTGTATATGGTGAAAGATAAGGG - Intronic
966304537 3:178515803-178515825 TTGTATATGGTGAAAGGTAGGGG - Intronic
966451899 3:180072928-180072950 CTGTATTTGGAGAAGAGGGAGGG + Intergenic
967398633 3:189035255-189035277 TTGTATATGGTGAAAGGTAGGGG - Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967488028 3:190056925-190056947 TAGTCTATGGTGAAGGGGGAGGG - Intronic
967540802 3:190665499-190665521 GTGTATATGGTGAGGGGAGGAGG - Intergenic
967646164 3:191927086-191927108 TTGTATATGGTGAAATGTAAGGG - Intergenic
969030933 4:4213221-4213243 TTGTATATGGTGTAAGGTGAGGG - Intronic
969182757 4:5454828-5454850 TTGTTTCTGGTGAAGTGCGAAGG + Intronic
969449088 4:7262838-7262860 CTGTGTCTGGTGAAGGTGGAGGG + Intronic
969801813 4:9572988-9573010 TTGTGTATGGTGTAAGGGTAGGG + Intergenic
970170623 4:13285969-13285991 TTGTATATGGTGAAAGGAAGGGG + Intergenic
970185818 4:13451761-13451783 TTGTATAGGGTGAGAGGTGAAGG + Intronic
970248211 4:14086198-14086220 TTGTATATGGTGTATGGAGGAGG + Intergenic
970357180 4:15267452-15267474 TTGTATATGGTGAAAGGTAGGGG + Intergenic
970571874 4:17391444-17391466 TTATATATGGTGTAAGGAGAGGG + Intergenic
970887712 4:21005766-21005788 TTGGTTATAGTGAAGGAGGAAGG + Intronic
971260066 4:25048356-25048378 TTGTATATGGTGAAAGGTAGGGG + Intergenic
971526223 4:27621826-27621848 TTGTATATGGTGAAAGGTGGGGG - Intergenic
971696602 4:29912350-29912372 TTGTATATGGTGAAAGGAGAGGG - Intergenic
971706460 4:30049412-30049434 TTGTATATGGTGAAAGGAAGGGG - Intergenic
971818813 4:31525638-31525660 TTGTATATGGTGAAAGGAAGGGG + Intergenic
972455607 4:39251329-39251351 TTGTATAAGGTGTAAGGGGAAGG - Intronic
972970193 4:44565384-44565406 TTGTATATGGTGTAAGGAAAAGG - Intergenic
973116054 4:46460858-46460880 TTGTATATGGTGAGGGATGTAGG - Intronic
973918211 4:55657764-55657786 TAGAATATGCTGAAGGGGCAGGG + Intergenic
974233337 4:59146751-59146773 TTGTATATGGTGTAAGGAAACGG + Intergenic
974234650 4:59165734-59165756 TTGTATATGGTGAAAGGTAGGGG - Intergenic
974599287 4:64055596-64055618 TTTTATATGGTGAAAGGTAAGGG + Intergenic
975508486 4:75166127-75166149 TTGTATAAGGTGAAAGGAAAGGG + Intergenic
975563963 4:75734308-75734330 TTGTATATGGTAAAAGGTAAGGG + Intronic
976011814 4:80498063-80498085 TTGTATATGGTGAAGGGAAGGGG - Intronic
976406966 4:84670856-84670878 TTGAAGATGGTGATGGGGGAGGG + Exonic
976627232 4:87199301-87199323 TTGTATATGGTGTAAGGTGAGGG - Intronic
976650710 4:87431111-87431133 TTTTATATGGTGAAAGGTAAGGG + Intronic
976713403 4:88098024-88098046 TAGTATCTGGGGGAGGGGGAGGG + Intronic
976804700 4:89033898-89033920 TTGTATATGGTGAAAGGTAGGGG - Intronic
976962793 4:90999958-90999980 TTGTGTATGGTGAAAGGAAAGGG + Intronic
977625271 4:99183094-99183116 TTGTATAGGGTGTAAGGTGAGGG + Intergenic
977845841 4:101765732-101765754 TTGTATATGGTGAAAGATAAGGG + Intronic
978226519 4:106341463-106341485 TTGTATATGGTGAAATGTAAGGG + Intronic
978685923 4:111443347-111443369 TTGTATATGGTGAAAGGTAAGGG + Intergenic
979207074 4:118051189-118051211 TTGTATATGGTAAAAGGTAAGGG - Intronic
979219223 4:118201958-118201980 TTGTATATGGTGAAAGGTAGGGG + Intronic
979370430 4:119879427-119879449 TTGTATATGGTGGAAGGGAGAGG - Intergenic
979428682 4:120599840-120599862 TTGTATATGGTGTAAGGGAGGGG - Intergenic
979429039 4:120604428-120604450 TTGTATATGGTGAAAGGTGTGGG - Intergenic
979435136 4:120679294-120679316 TTGTATAAGGTGAAAGATGAAGG - Intergenic
979587174 4:122434046-122434068 TGGTATATGCAGAAGTGGGAGGG - Intergenic
979737922 4:124111621-124111643 TCCTATATGAGGAAGGGGGAAGG - Intergenic
979929085 4:126607734-126607756 TGGTATATGGTTATGGGGCAAGG - Intergenic
979986964 4:127327128-127327150 TTGTGTGTGGGGAGGGGGGAGGG + Intergenic
980151207 4:129050897-129050919 TTGTATAAGGTGTAGGGAGGGGG + Intronic
980580449 4:134743682-134743704 TTGTATATGGTGAGAGATGAGGG - Intergenic
981402289 4:144327434-144327456 TTGTATATGATGAAAGGATAGGG - Intergenic
981466535 4:145078845-145078867 TTGTATATGGTGAAAGGGAGGGG - Intronic
982097455 4:151935791-151935813 TTGTAGATGGAGAAGGGAAAGGG + Intergenic
982315981 4:154032571-154032593 TTGTATATGGTGAAAGGTAGGGG + Intergenic
982446178 4:155492992-155493014 TTGTAAAGGGTGAGAGGGGAAGG + Intergenic
982646572 4:158031334-158031356 TTGTATATGGTGAAAGGAATGGG - Intergenic
983174662 4:164574197-164574219 TTGTATATGGTGAAAGGTAAGGG - Intergenic
983407648 4:167350203-167350225 TTGTATATGGTGAAAGGGAAGGG + Intergenic
983522762 4:168727881-168727903 TTGTATATGGTGAAAGGTAAGGG + Intronic
983578984 4:169288814-169288836 TTGTATTTGTTGAAGAGGCAGGG + Intergenic
983662945 4:170148911-170148933 TTGTATATGGTGAAAGATAAGGG + Intergenic
983952088 4:173654291-173654313 TTGTAAATGATGAAGGTGGCTGG + Intergenic
984132673 4:175897448-175897470 TTGTATATTGAGAAGGGGAGAGG + Intronic
984914987 4:184714880-184714902 TTGTTTTTGGTGATGGGGCATGG - Intronic
986557092 5:9021713-9021735 TTGTATATGGTGAAATGCAAGGG + Intergenic
986675887 5:10185046-10185068 TTGTATATGGTGATAGGTGGGGG - Intergenic
986906809 5:12504345-12504367 TTGTATATGGTGTAAGGAAAAGG + Intergenic
987159144 5:15122377-15122399 TTGTATATGGTGTAAAGTGAGGG + Intergenic
988273858 5:29054997-29055019 TTGTACAGGGTGAAGATGGATGG - Intergenic
988305800 5:29493047-29493069 TTGTATATGGTATAAGGGAAGGG + Intergenic
988651474 5:33156718-33156740 TTGTATATGGTGAAAGGGAAGGG + Intergenic
988894945 5:35662600-35662622 TTGTATATGGTGTAAGGGAGGGG + Intronic
989032402 5:37132945-37132967 TTGTATATGGTGAAAGGTAGGGG + Intronic
989348926 5:40461958-40461980 TTGTATATGGTGAAGGATAGAGG - Intergenic
989459329 5:41679069-41679091 TTGTATATGGTGAAAGGTAAGGG + Intergenic
989545898 5:42672623-42672645 TTGTATATGGTGAAAGGTAGGGG - Intronic
989758103 5:44980643-44980665 TTGTATATGGTGAAAAGTAAGGG - Intergenic
990022625 5:51146304-51146326 TTGTATATGGTGGAAGGAGGGGG + Intergenic
990359392 5:55002929-55002951 TGGGATGTGGGGAAGGGGGAGGG + Intronic
990649788 5:57885354-57885376 TTGAATATGGGGAAAGTGGAAGG + Intergenic
990821408 5:59844767-59844789 TTATGTATGGAGAAGGTGGAGGG + Intronic
990918994 5:60941966-60941988 ATATATATGGTGCAGGGGAAAGG + Intronic
991118981 5:62988970-62988992 TTGTATATGGTAAAAGGTAAGGG - Intergenic
991388156 5:66113190-66113212 TTGTATATGGTGTAAGGAAATGG - Intergenic
991407551 5:66316352-66316374 TTGTATATGGTGACAGGTGGGGG + Intergenic
991541569 5:67735379-67735401 TTGTATATGGTGTGAGGTGAGGG - Intergenic
992053036 5:72958355-72958377 TTGTGTATGGTGCAAGGGAAAGG + Intronic
992355781 5:75981686-75981708 TTGTAAATGGTGTAAGGGAAAGG - Intergenic
992922537 5:81541739-81541761 TTGTATATGGTGAAAGGTAGGGG - Intronic
993339564 5:86706643-86706665 TTGTATAAGGTGCAAGGGAAGGG + Intergenic
993555860 5:89337148-89337170 TTGTATATGGTGAATGTTAAGGG - Intergenic
993734806 5:91463942-91463964 TTGTATATGGTGTAAGGAAAGGG - Intergenic
994111497 5:96009965-96009987 TTGTATATGGTGAAAGGTAAGGG + Intergenic
994259818 5:97644062-97644084 TTGTATATGGTGAAAGGTAGAGG - Intergenic
994309760 5:98255393-98255415 TTGTATATGGTGTAAGGAAAAGG + Intergenic
994381931 5:99081331-99081353 TTGTATATGGTGAAAGGAAGGGG + Intergenic
994424887 5:99572934-99572956 TTGTACATGGTGAAGATGTAGGG - Intergenic
994441086 5:99803688-99803710 TTGTATATGGTGAGAGGGAGGGG - Intergenic
994643897 5:102445742-102445764 TTGTATATGGTGAAAGGTAGGGG + Intronic
995387889 5:111608473-111608495 TTGTATATGGTGAAAGGTAGGGG + Intergenic
996293547 5:121884124-121884146 TTGTATATGGTGAAAGATAACGG - Intergenic
996589278 5:125127804-125127826 TTGTATATGGTTATGGGGTGGGG - Intergenic
996783559 5:127214576-127214598 TTGTATATGGGGAAAGGTAAGGG + Intergenic
996850584 5:127947127-127947149 TTGTATATGGTGTAAGGACAGGG + Intergenic
997048113 5:130344689-130344711 TTGTATATGGTGTAAGGAAAGGG + Intergenic
997202157 5:132017295-132017317 GTGTATGTGGTGAGGGGGGTGGG + Intergenic
998003522 5:138642464-138642486 TTTTTTATGGTGTGGGGGGATGG - Intronic
998189060 5:140007061-140007083 TTGTTTGTGGTAACGGGGGAAGG + Intronic
998648872 5:144094913-144094935 TTGTATTTGGTGCAGGGGTCAGG - Intergenic
998803901 5:145899730-145899752 TTGTATATGGTAAAAGGTAAAGG - Intergenic
999114069 5:149146487-149146509 TTGTATATGGTGAAAGGTAAGGG + Intronic
999386408 5:151157195-151157217 TTGTGTGTGGTGTCGGGGGAGGG - Intronic
999552773 5:152707366-152707388 TTGTATAAGGTGTAAGGGTAAGG + Intergenic
999591490 5:153152766-153152788 TTCTATATGGTGAAGGGTAGGGG - Intergenic
999874809 5:155792222-155792244 TTATATATGGTGAAAGGTAAGGG - Intergenic
1000134413 5:158332516-158332538 TTGTATATGGTGAAAGAAGAGGG + Intergenic
1001357950 5:171049641-171049663 TTGTATATGGTGAAGGCTAGGGG + Intronic
1001850556 5:174960826-174960848 TTGTATATGGTGTGAGAGGAGGG + Intergenic
1002355186 5:178622275-178622297 TTATATAAGGGGAAGGGGGAAGG - Intronic
1002369934 5:178743496-178743518 TTGTATATGGGGAAAGGTAAGGG - Intergenic
1002592670 5:180301951-180301973 TTGTTTAGGGTGGAGTGGGAAGG + Intronic
1003944415 6:11060598-11060620 TTGTATATGGTGTAAGGGATGGG + Intergenic
1004109654 6:12704619-12704641 TTGTATATGGTGAACGGTAGGGG - Intergenic
1004164666 6:13245821-13245843 TTGTATATGGTGTAAGGAGCAGG + Intronic
1004793620 6:19056553-19056575 TTGTATATGGTGAAAAGTAAGGG - Intergenic
1005313311 6:24580319-24580341 TTGCATATGGTTATGGGGGGTGG - Intronic
1005518756 6:26579635-26579657 TTGTATATGGTGAAAGGTATGGG + Intergenic
1005803583 6:29451170-29451192 TTGCATATGGTGAAAGGAAAGGG - Intronic
1005824880 6:29626862-29626884 TGGCATATGGTGATTGGGGAAGG - Intronic
1005899355 6:30204578-30204600 TTGTGTATGGGGAAGGGGAGCGG - Intronic
1007350007 6:41264974-41264996 TTGTATATGGTGAAAGATGGGGG - Intergenic
1007455050 6:41970662-41970684 TTGTCTTTGGTGAAGAGGGAAGG - Intronic
1008315524 6:50035164-50035186 TTTTATATGGTGAAAGGTAAGGG - Intergenic
1009340901 6:62553732-62553754 TTGTATATGGTGTAAGGAAAGGG - Intergenic
1009547308 6:65036299-65036321 TTGTATATGGTGAAAGGTAAGGG - Intronic
1009599267 6:65777007-65777029 TTGTATATGGTGAAAGGAAAGGG - Intergenic
1009700964 6:67180411-67180433 TTATCCATGGTGGAGGGGGAGGG + Intergenic
1009704517 6:67229485-67229507 TTGTATATGGTGAAAGATGGGGG - Intergenic
1009915629 6:69992073-69992095 TTATATATGGTGAAAGGAAAGGG + Intronic
1009949232 6:70376361-70376383 TTGTATATGTTGAATGGAGTAGG - Intergenic
1010012353 6:71063207-71063229 TTGTATATGGTGAAAGATAAGGG + Intergenic
1010143071 6:72633853-72633875 TTGTATATGGTGAAAGGTAGGGG - Intronic
1010179140 6:73065106-73065128 TGGTAGATGGTGAATGGGGCTGG - Intronic
1010346862 6:74821192-74821214 TTGTATATGGTGAGAGAGAAGGG - Intergenic
1010531261 6:76970177-76970199 TTGTATATTTTGAAGGGGAATGG - Intergenic
1010611670 6:77961342-77961364 TTGTATATGGTGAAAGGCAGGGG + Intergenic
1010612501 6:77971151-77971173 TTGTATATGGTGAAAGGCAGGGG - Intergenic
1010665787 6:78628920-78628942 TTGTATATGGTGTAAGGAAAGGG + Intergenic
1011181079 6:84621769-84621791 TTGTATATGATGAGGGAGAAGGG - Intergenic
1011396075 6:86910119-86910141 TTGTATATGGTGAAAGGATGGGG - Intergenic
1011425808 6:87228601-87228623 TTGTATATGGTGCAGGAATAGGG + Intronic
1012070786 6:94612870-94612892 TTGTATATGGTGAAAAGGTAGGG - Intergenic
1012570573 6:100722005-100722027 TTGTATATAGTGAAAGGTAAAGG + Intronic
1012642499 6:101636917-101636939 TTCTATGTGGTGAAGTGGGAAGG + Intronic
1013284567 6:108670068-108670090 TTCTATATGGAGATGGGAGAAGG + Intronic
1013479361 6:110540302-110540324 TTGTATACGGTGAAAGGTAAGGG + Intergenic
1013625208 6:111930168-111930190 TTGTATATGGTGTAAGGAAAGGG + Intergenic
1013787771 6:113800904-113800926 GTGTAGGTGGAGAAGGGGGACGG + Intergenic
1014179491 6:118369394-118369416 TTTTATATGGTGAAAGGAAAGGG - Intergenic
1014782183 6:125576954-125576976 TTGTATATGGTGAAAGGTAGAGG + Intergenic
1014819325 6:125969177-125969199 TTGTATATGGTGAAAGGTAGGGG + Intronic
1014862957 6:126493012-126493034 TTGTATAGGGTGAAAGGTGGGGG + Intergenic
1014872756 6:126615859-126615881 TTGTATATGATGAAAGGTAAGGG - Intergenic
1015045476 6:128770555-128770577 TTGGATATGGTGAAAGGAAAGGG - Intergenic
1015711844 6:136150381-136150403 TTGTATATGGTGAGAGATGAGGG + Intronic
1015711883 6:136150930-136150952 TTGTCTTTGGTGAAGGGAGAAGG + Intronic
1015774141 6:136796380-136796402 TTGTATATGGTGATGGGTAGGGG + Intergenic
1016543910 6:145198694-145198716 TTGAATATGGTGAACAGGTAAGG + Intergenic
1016572072 6:145524941-145524963 TTGTATATGGTGAAAGTTAAGGG + Intronic
1016664254 6:146616601-146616623 TTGCATATGGTGAAAGGTGGGGG + Intronic
1016808313 6:148235208-148235230 ATGTGTATGGTGGAGGTGGATGG + Intergenic
1017276937 6:152580683-152580705 TTGTATATGGTGAAAGGAAGGGG + Intronic
1017277901 6:152591478-152591500 TTGTATATGGTGAAAGGTAGGGG - Intronic
1017352110 6:153454588-153454610 TTGTATATGGTGAAAGGTAGGGG + Intergenic
1017355351 6:153499441-153499463 TTGTATATGGTGAAAGGTAGGGG - Intergenic
1017580741 6:155862117-155862139 TTGTATATGGTGAAAGGTAGGGG + Intergenic
1017953966 6:159162664-159162686 TCTTCTATGGAGAAGGGGGAAGG + Intergenic
1018570168 6:165201599-165201621 TTGTATATGGTGAAAGGAAGGGG - Intergenic
1018959343 6:168436208-168436230 TTGTATATGGTGAAAGGTAGGGG - Intergenic
1019356369 7:582045-582067 GTTTACATGGTGAATGGGGATGG - Intronic
1020362082 7:7337845-7337867 TTATATATGGTGAAAGGTAAGGG + Intergenic
1020573981 7:9902306-9902328 TTGTATAAGGTGTAAGGAGAGGG + Intergenic
1020651078 7:10877167-10877189 TTGTATATGGTGAAAGGAAGGGG + Intergenic
1020841856 7:13227740-13227762 CTGTATATGGTAAAGTGTGATGG + Intergenic
1020940684 7:14531992-14532014 TTGTATATGGTTTAAAGGGAAGG - Intronic
1021197775 7:17691910-17691932 TTGGATGTGGTGCTGGGGGAGGG - Intergenic
1021345951 7:19528792-19528814 TTGTATATGGTGTAAGGAAAGGG - Intergenic
1021752862 7:23821825-23821847 TTATATATGGTGAGAGGTGAGGG + Intronic
1021809466 7:24389441-24389463 TTGTGTTGGGAGAAGGGGGAAGG - Intergenic
1024332173 7:48166659-48166681 TTGTATATGGTGAAATGTGGAGG - Intergenic
1025092884 7:56077988-56078010 TTGCATCTGGGGAAGGGGAAGGG - Intronic
1026869072 7:73839982-73840004 AGGTATATGGTGACGGGGGTTGG + Intronic
1027641089 7:80734645-80734667 TTGTATATGGTAAAAGGTAAGGG - Intergenic
1027949465 7:84795925-84795947 TTGTATATGGTGAAAGATGGGGG + Intergenic
1028933250 7:96438141-96438163 TTGTATATGGTGAAAGGCAGGGG - Intergenic
1029099236 7:98114634-98114656 CTGCATCTGGTGAAGGGAGACGG + Intronic
1029925681 7:104313933-104313955 TTGTAGATGATGAAGTGGGTGGG + Intergenic
1030112759 7:106040681-106040703 TTATAGATGGTGCAGGTGGAGGG - Intergenic
1030246801 7:107391654-107391676 TTGTATATGGTGCAAGGTAAGGG + Intronic
1030371890 7:108709855-108709877 TTGTATATGGTGAAAGGTAGGGG + Intergenic
1030473100 7:109992696-109992718 TTCTATATGGTGAAAGGTGAAGG + Intergenic
1030531185 7:110713081-110713103 TTGTATATGGTGAAAGGTAAGGG + Intronic
1030959538 7:115899565-115899587 TTGTATATGGTGAAAGGTAAGGG - Intergenic
1031128411 7:117802314-117802336 TTGTATATGTTGAAAGGTGTGGG - Intronic
1031174332 7:118330411-118330433 CTGTCTCTGGTGAAGGGGCAGGG + Intergenic
1031315995 7:120257828-120257850 TTGTATTTGGTAATGGGAGAGGG + Intergenic
1031381808 7:121095205-121095227 TGGGCTATGGAGAAGGGGGATGG + Intronic
1031394521 7:121256400-121256422 TTGTATATGGTGAAAAGTAAGGG - Intronic
1031741482 7:125437200-125437222 TTGTATATGGTGAGGGGTAGAGG + Intergenic
1031780464 7:125955457-125955479 TTGTATATGGTGAAAGGTAGGGG - Intergenic
1032249792 7:130245836-130245858 TTGTATATGGTGTAAGGAAAGGG - Intergenic
1032778361 7:135139744-135139766 TTGTATATGGTGAAAGGAAGGGG + Intronic
1032968913 7:137136025-137136047 TTGTATATGGTGAAAGGAAGGGG - Intergenic
1033203600 7:139396291-139396313 CTGGATATGGTGGCGGGGGACGG + Intronic
1033491812 7:141851759-141851781 TTGTATATGGTGAAGGGAAGGGG - Intergenic
1033984772 7:147211622-147211644 TTGTATATGGTGAAAGGCAGAGG - Intronic
1034198999 7:149269592-149269614 TTGCATATGGTGAAAGGTAAGGG + Intronic
1034696077 7:153055053-153055075 TTGGATATGGTGAAGGAGGAGGG + Intergenic
1034847657 7:154462033-154462055 TTGTATATGGTGAGAGGGAAGGG + Intronic
1034873209 7:154701855-154701877 TTGTATAAGGTGATGGCAGATGG - Intronic
1035009264 7:155698425-155698447 AACCATATGGTGAAGGGGGATGG + Intronic
1035103759 7:156423770-156423792 TTGTATATGGTGAAAGGTAGGGG + Intergenic
1036045473 8:5135182-5135204 TTGATTATGGTCAAGGGAGAGGG + Intergenic
1036247643 8:7132733-7132755 TTGTATATGGTGTAAGGGAGGGG + Intergenic
1036463493 8:8974735-8974757 TTGGGGAGGGTGAAGGGGGAGGG - Intergenic
1036507316 8:9367260-9367282 TAGTACATTGTGAATGGGGAAGG - Intergenic
1036666494 8:10746647-10746669 TTGTATATGGTGTAAGGCAAAGG + Intronic
1037225581 8:16585538-16585560 TTGTATATGGTGCAAGGAAAAGG + Intergenic
1038258508 8:25972395-25972417 TGGTATATTTTGGAGGGGGATGG + Intronic
1038808998 8:30820780-30820802 TTGTATATGGTGAAAGCTGGGGG + Intergenic
1038859478 8:31371334-31371356 TTGTATATGGTGTAGGGAAAGGG + Intergenic
1039335557 8:36585428-36585450 TTGTATATGGTGAAAGGTAGGGG + Intergenic
1039640459 8:39214861-39214883 TTGTATATGGTGAGAGGGAGGGG + Intronic
1040961716 8:53041061-53041083 TTGTATATGGTGTAAGGAAAAGG + Intergenic
1041470739 8:58205789-58205811 TTGTATATGGTGTAAGGAAAGGG + Intergenic
1041728480 8:61041005-61041027 TTGTATATGGTGAAAGGTAGGGG + Intergenic
1042808480 8:72798008-72798030 TTGTATATGAAGAAGGGAAATGG - Intronic
1042858086 8:73287299-73287321 GAGTATTTGGTGATGGGGGATGG - Intergenic
1042859918 8:73302069-73302091 TGGTACATGGTTAAGAGGGAAGG - Intronic
1042976278 8:74473468-74473490 TTGTATATGGTGTATGGAAAGGG + Intronic
1043140440 8:76581998-76582020 TTGTATTTGCTTAAAGGGGAAGG + Intergenic
1043189090 8:77194401-77194423 TTGTATATGGTGAAAGGTAGGGG - Intergenic
1043214094 8:77563558-77563580 TTGTATATGGTGTAGAGAAAGGG - Intergenic
1043247277 8:78020670-78020692 TTGTATATGGTGTAGGGGAGAGG + Intergenic
1043610671 8:82059133-82059155 TTGTATATGATGAAAGGTGGAGG + Intergenic
1043768782 8:84170388-84170410 TTGTATATGGTGAAAGTAAAGGG + Intergenic
1043819575 8:84845817-84845839 TTGTATATGGTGAAAGGTTGTGG + Intronic
1044026792 8:87183072-87183094 TTGAATATGGTGAAAGGGCAGGG + Intronic
1044473396 8:92598604-92598626 TTGTATATGGTGAAAGGAAGGGG - Intergenic
1044597088 8:93970022-93970044 TTGTATATGGTGAAAGGTAGGGG + Intergenic
1045611898 8:103853555-103853577 TTGCATATGGTGAAAGGTCAGGG + Intronic
1045909119 8:107384792-107384814 TTGTATAAGGTGAAAGGTGGGGG + Intronic
1046140260 8:110082504-110082526 TTGTATATGGTGAAAGGAAGTGG + Intergenic
1046236772 8:111434427-111434449 TTGTATATGGTGAAAGGAAAGGG + Intergenic
1046255290 8:111689010-111689032 TTGTATATGGTGTAAGGGAGGGG + Intergenic
1046526409 8:115387010-115387032 TGGGATAGGGTGAGGGGGGAGGG - Intergenic
1046684720 8:117212276-117212298 TTGTATATGGTGTAAGGAAAGGG - Intergenic
1046705405 8:117444456-117444478 TTGTGTTTGGAGAAGGTGGAAGG + Intergenic
1046889560 8:119407385-119407407 TTGTATATGGTCAAAGGTAAGGG - Intergenic
1047147356 8:122218260-122218282 TTGTATATGGTTAAAGGTAAGGG - Intergenic
1047278293 8:123422815-123422837 TTGTATATGGTGAAAGGGAGGGG + Intronic
1047834713 8:128675953-128675975 TTGTATATGGTGAAAGGTAAAGG + Intergenic
1048124630 8:131620018-131620040 TTGTATATGGTGAAAGGTAGGGG - Intergenic
1048241372 8:132744990-132745012 TTGTATATGGTGAAAGGTAGAGG - Intronic
1048871844 8:138805418-138805440 TTGTGTATGGTGGTGTGGGATGG + Intronic
1050054749 9:1640156-1640178 TAGTATGTGGTGTAGGGGGTGGG - Intergenic
1050301835 9:4266538-4266560 TTGTGTATGCTGAAGAGGGTGGG - Intronic
1050403016 9:5276434-5276456 TTGTATATGGTGAAAGGAAGGGG - Intergenic
1051491566 9:17672634-17672656 CTGTATTGGGTGAAGGGGGTGGG - Intronic
1051508117 9:17847333-17847355 TTGAACCAGGTGAAGGGGGAGGG - Intergenic
1051933185 9:22411478-22411500 TTGGATATGGTGAAAGGTAAGGG - Intergenic
1052005673 9:23345584-23345606 TTGTGTATGGTGAAGGGTAAGGG - Intergenic
1052077946 9:24167442-24167464 TTTTATATGGTGTGGGGGTACGG + Intergenic
1052176308 9:25467196-25467218 TTGTATATGGTGCAAGGGAGGGG + Intergenic
1052263450 9:26544712-26544734 TTGTATTTGGTGAAAGGAAAGGG - Intergenic
1052281626 9:26739883-26739905 TTGTATATGGTGAAGGGAAGGGG - Intergenic
1052483334 9:29061650-29061672 TTGTATATGGTGTAAGGTAAGGG - Intergenic
1052586589 9:30436969-30436991 TTGTATATGGTGAAAGGAAGGGG - Intergenic
1052707885 9:32015374-32015396 TTGTATATGGTGAAAGGTAGGGG + Intergenic
1053168735 9:35863209-35863231 GTGTATGTGTTGGAGGGGGAAGG - Intergenic
1053225350 9:36350395-36350417 TTGAATATTGTGGAGGAGGAAGG - Intronic
1053587363 9:39473524-39473546 TTGTATATGGTGTAAGGTAAGGG + Intergenic
1053798631 9:41748771-41748793 TTGTATATGGTGAAAGGTAGGGG + Intergenic
1054146572 9:61566190-61566212 TTGTATATGGTGAAAGGTAGGGG - Intergenic
1054187046 9:61960816-61960838 TTGTATATGGTGAAAGGTAGGGG + Intergenic
1054466306 9:65497259-65497281 TTGTATATGGTGAAAGGTAGGGG - Intergenic
1054578938 9:66891712-66891734 TTGTATATGGTGTAAGGTAAGGG - Intronic
1054651462 9:67627706-67627728 TTGTATATGGTGAAAGGTAGGGG - Intergenic
1055107019 9:72523611-72523633 TTGAATAGGCTGAAGGAGGAGGG + Intronic
1055190289 9:73512042-73512064 TTGTATATGGTGAAAGGAAGGGG + Intergenic
1055342640 9:75301109-75301131 TTGTATATGGTGAAAGGTAGAGG + Intergenic
1055415517 9:76078449-76078471 TTGTATATGGTGAAAGGTAGGGG + Intronic
1056571732 9:87822781-87822803 TTGTATATGGTGAAAGGTAGGGG - Intergenic
1056717124 9:89041117-89041139 TTTTATAGGCTGAAGAGGGAGGG - Intronic
1058077859 9:100668539-100668561 TTGTATATGGTGAAAGGGAGGGG - Intergenic
1058095912 9:100860289-100860311 TTGTATATGGTGAAAGGAAGGGG + Intergenic
1058102631 9:100934263-100934285 TTGTATATGGTGAAAGGTGGGGG + Intergenic
1058172655 9:101701492-101701514 TTGTATATGGTGAAAGGTAGGGG - Intronic
1058238426 9:102523533-102523555 TTGTATATGGTGTAAGGAGGGGG + Intergenic
1058340809 9:103893889-103893911 TTGTATATGGTGAGAGGTGGGGG - Intergenic
1058708212 9:107655195-107655217 TCATATATGGTGTTGGGGGAAGG + Intergenic
1058781660 9:108342895-108342917 TTGTATATGGTGAAAGGTAGGGG - Intergenic
1059010577 9:110454377-110454399 TTGTATATGGTGAAAGGCTGGGG + Intronic
1059077075 9:111204882-111204904 TTGTATATGGTGTAAGGGAGGGG - Intergenic
1059680972 9:116585636-116585658 TTGTATATGGTGAAAGGTAAGGG - Intronic
1059699406 9:116760655-116760677 TTGTGCCTGGGGAAGGGGGAGGG + Intronic
1060066937 9:120510534-120510556 GTGTGTTTGGTGAAGGGTGAGGG - Intronic
1060195852 9:121622858-121622880 GGGTATATGGGCAAGGGGGATGG + Intronic
1062335615 9:136065024-136065046 TTGTATATGGTGTGAGGGAAGGG - Intronic
1203744259 Un_GL000218v1:32270-32292 TTGTATATGGTGTTGGGTAAAGG - Intergenic
1203349038 Un_KI270442v1:60720-60742 TGGAATATGGTGAAGTGGGGTGG + Intergenic
1203565850 Un_KI270744v1:87244-87266 TTGTATATGGTGTTGGGTAAAGG + Intergenic
1185748029 X:2587209-2587231 TTGTATATGGTGAGGGATGGGGG - Intergenic
1186659284 X:11652298-11652320 TTGTATATGGTGAAAGGAAAGGG + Intronic
1187178711 X:16921710-16921732 TTGTATATGGTGAGAGAGGGGGG - Intergenic
1187325604 X:18284234-18284256 TTGTATATGGTGAAAGGTAAGGG - Intronic
1187804076 X:23099020-23099042 TTGTATATGGTGAAAGGAAGGGG - Intergenic
1188035210 X:25309963-25309985 TTGTATATGGTGAAAGGTAGGGG + Intergenic
1188091786 X:25973624-25973646 TTGTATATGGTGAAAGGTAATGG - Intergenic
1188270207 X:28129733-28129755 TTGTATATGGTGTAGGGAAGGGG - Intergenic
1188513346 X:30959897-30959919 TGGTAGAAGGTGAAGGGGAAGGG + Intronic
1188583349 X:31742664-31742686 TTGTATATGGTGTAAGGAGGGGG - Intronic
1188631945 X:32374476-32374498 TTGTATATGGTGAAAGGTAGGGG + Intronic
1188888301 X:35577974-35577996 GTGTATATGGTGAAAGAGAAGGG - Intergenic
1188969304 X:36593767-36593789 TTGTATATGGTGAAAGGAAAGGG - Intergenic
1189233975 X:39473736-39473758 TTGGAGATGGAAAAGGGGGAGGG + Intergenic
1189527663 X:41842041-41842063 TTGTATATGGTGTAGGGTAGAGG + Intronic
1189809391 X:44766990-44767012 TTGTATATGGTGAAAGGCAGGGG - Intergenic
1190027853 X:46942383-46942405 TTGTATATGGTGAAAGGTAAGGG + Intronic
1190052365 X:47159793-47159815 TTGTATATGGTGAGAGGTAAGGG - Intronic
1190450112 X:50571013-50571035 TTGTATATGGTGAAAGGTAGGGG - Intergenic
1190636301 X:52437401-52437423 TTGTATATGGTGAGAGATGAGGG - Intergenic
1191210467 X:57879442-57879464 TTGTATATGGTGAAAGGTAGGGG - Intergenic
1191598277 X:62972599-62972621 TTGTATATGGTGTAAGGAAAAGG - Intergenic
1191614441 X:63153711-63153733 TTGTATATGGTGAAAAGCAAGGG - Intergenic
1191621855 X:63225215-63225237 TTGTATATGGTGAAAAGCAAGGG + Intergenic
1191665927 X:63702629-63702651 TTGTACTTGTTGAAGGGGAAAGG - Intronic
1191831929 X:65424639-65424661 TTGTATATGGTGTAAGGAGAGGG + Intronic
1192307223 X:69974381-69974403 TTGTATATGGTGATGGGTAGGGG - Intronic
1192723080 X:73720753-73720775 TTGTATATAGTGTAAGGGAAGGG + Intergenic
1192837607 X:74818441-74818463 TTGTATATGGTGAAAGGAAGAGG - Intronic
1192942194 X:75924504-75924526 TTGTATATGGTGAAAGGAAGGGG - Intergenic
1193032517 X:76914457-76914479 TTGTATATGGTGAAAGGTAGGGG - Intergenic
1193903532 X:87214576-87214598 TTGTGTATGGTGAAGGGTAGTGG + Intergenic
1194077452 X:89414484-89414506 TTGCATATGGTGAATGGAAAGGG - Intergenic
1194234133 X:91361252-91361274 CCGAAGATGGTGAAGGGGGAAGG + Intergenic
1194260644 X:91690669-91690691 TTGTATATGGTGAAAGGTAGAGG - Intergenic
1194484125 X:94466054-94466076 TTGTATATGGTGTAAGGAAAGGG - Intergenic
1194747412 X:97643349-97643371 TTGTATATGGTGAAAGGTAGAGG - Intergenic
1194805597 X:98323523-98323545 TTGTATATGGTGAAAAGGAGTGG - Intergenic
1194918484 X:99734051-99734073 TTGTATATGGTGAAAGGTAGGGG + Intergenic
1195276839 X:103289449-103289471 TTGTATATGGTGAAAGGCAATGG + Intergenic
1195489926 X:105455493-105455515 TTGTATATGGTGAAAGGTAGGGG + Intronic
1195521151 X:105830829-105830851 TTGTGTAGGGGGAGGGGGGAGGG + Intronic
1195534534 X:105996425-105996447 TTGTATATGGTGAAAGGAAGGGG - Intergenic
1195544023 X:106094957-106094979 TTGTATATGGTGAAAGGAAAGGG + Intergenic
1195548837 X:106143564-106143586 TTGTATATGGTGAAAGGAAAGGG - Intergenic
1195576261 X:106454694-106454716 TTGTATATGGTGAAAGGTAGGGG - Intergenic
1195788188 X:108550962-108550984 TTGTATATGGTGAAAGGCAGGGG - Intronic
1195887918 X:109659837-109659859 TTGTATATGTTGTAAGGTGAAGG - Intronic
1196052194 X:111317394-111317416 TTGTATATGGTGTAAGGAAAGGG - Intronic
1196475219 X:116076618-116076640 TTGTATATAGTGGAAGGGAAGGG - Intergenic
1196514910 X:116598270-116598292 TTGTATATGGTGAAAGATGGGGG + Intergenic
1196544672 X:116947770-116947792 CTGAAGATGGTGAAGGGGGAAGG + Intergenic
1196557243 X:117102199-117102221 TTGTATATGGTGAAAGATGAGGG + Intergenic
1196576919 X:117329294-117329316 TTGTATATGGTGAAATGTAAGGG - Intergenic
1197107182 X:122730721-122730743 TTGTATATGGTGAAAGGAAAGGG - Intergenic
1197166695 X:123385171-123385193 TTGTATATGGTGAAAGGAAGGGG + Intronic
1197349387 X:125364490-125364512 TTGTATATGGTGTAAGGAGGGGG + Intergenic
1197392731 X:125887576-125887598 TTGTATATGGTGAAAGGTAAGGG + Intergenic
1197801357 X:130353084-130353106 TTGTATATGGTGAAAGGTAGGGG + Intronic
1198007632 X:132514321-132514343 TTGTATATGGTGAGAGGTAAGGG - Intergenic
1198068522 X:133124374-133124396 TTGTATATGGTGAAAGGAAGGGG + Intergenic
1198580057 X:138053626-138053648 TTGTATATGTTGAAAGGAAAGGG - Intergenic
1198634925 X:138686973-138686995 TTGTATATGTTGAATGTGGTAGG - Intronic
1198642017 X:138766839-138766861 TTGTATATGGTGAAGGGTAGTGG + Intronic
1198724462 X:139662788-139662810 GTGAATTTGGAGAAGGGGGAGGG - Intronic
1198796441 X:140401480-140401502 TTGTATATGGTGTAAGGAAAGGG - Intergenic
1199015696 X:142812276-142812298 TTGTATATGGTGAATGGTAAGGG - Intergenic
1199166268 X:144679203-144679225 CTGAAGATGGCGAAGGGGGAAGG - Intergenic
1199229491 X:145419641-145419663 TTTTATATGGTTTAGGAGGAGGG + Intergenic
1199282019 X:146012977-146012999 TTGTATATGGTGAAAGGTTGGGG - Intergenic
1199354463 X:146845338-146845360 TTGTATATGGTGAAAGGTAGGGG - Intergenic
1199367483 X:147003936-147003958 TTGTATATGATGAAAGGTAAGGG + Intergenic
1199723624 X:150561207-150561229 TTGTATATGGTGTATGGTTAGGG + Intergenic
1200360726 X:155603741-155603763 TTGTGTATGGTGTAAGGTGAAGG - Intronic
1200430102 Y:3070023-3070045 TTGCATATGGTGAATGGAAAGGG - Intergenic
1201157583 Y:11147251-11147273 TTGTATATGGTGTTGGGTAAAGG - Intergenic
1202588875 Y:26461151-26461173 TTGTATATGGTCAAAGGTGGGGG + Intergenic