ID: 1098371576

View in Genome Browser
Species Human (GRCh38)
Location 12:69766188-69766210
Sequence GGGTGTTTACCTTTCTAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 207}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098371576 Original CRISPR GGGTGTTTACCTTTCTAGCA AGG Intronic
906877026 1:49550836-49550858 GGATGTCTAGGTTTCTAGCAAGG + Intronic
908989936 1:70074377-70074399 GGGTGTTTAATCTTCTAGAATGG + Intronic
909138162 1:71828709-71828731 GAGTTTCTAACTTTCTAGCAAGG + Intronic
909673788 1:78216147-78216169 GGATGTCTAGGTTTCTAGCAAGG - Intergenic
910297433 1:85664083-85664105 GACTGTTAACCTATCTAGCAAGG + Intronic
911322570 1:96433200-96433222 GGATGTTTAGATCTCTAGCAAGG + Intergenic
911689282 1:100813604-100813626 GGGTGTCTAGGTCTCTAGCAAGG - Intergenic
913337252 1:117719871-117719893 GGATGTCTAGATTTCTAGCAAGG - Intergenic
917055433 1:170976766-170976788 GACTGTTGACCTGTCTAGCAAGG + Intronic
918158502 1:181873872-181873894 GGGTGTCTAGGTCTCTAGCAAGG - Intergenic
918660265 1:187079512-187079534 GAGTGTTTACATTTCTGTCAAGG + Intergenic
918873640 1:190009642-190009664 GGATGTCTAGGTTTCTAGCAAGG - Intergenic
921787965 1:219254805-219254827 GGCTGTTGGCCTCTCTAGCAAGG + Intergenic
923458889 1:234189675-234189697 GGATGTCTAGCTCTCTAGCAAGG - Intronic
923648384 1:235846984-235847006 GGATGTCTACGTCTCTAGCAAGG - Intronic
923661776 1:235963363-235963385 GGATGTCTACGTCTCTAGCAAGG - Intergenic
923808502 1:237287343-237287365 GGATGTCTACGTCTCTAGCAAGG + Intronic
923874845 1:238035870-238035892 GGATGTCTACGTCTCTAGCAAGG - Intergenic
1063561150 10:7129358-7129380 GGATGTCTAGATTTCTAGCAAGG + Intergenic
1066206528 10:33194776-33194798 GTGTGTTTGTCTTTCTAGCCAGG - Intronic
1068059356 10:52047656-52047678 GGTTGCCTACCTTACTAGCATGG + Intronic
1069507731 10:69016493-69016515 TGATGTTTACCTTTATAGCCAGG + Exonic
1070797817 10:79227263-79227285 GGGTGTTTAACCTACCAGCAAGG - Intronic
1071015736 10:80995695-80995717 GGATGTTTAGATCTCTAGCAAGG + Intergenic
1071370473 10:84945948-84945970 GGTTGGTTTCCTCTCTAGCAGGG + Intergenic
1071384923 10:85110150-85110172 GGATGTATACCTTTTCAGCAGGG + Intergenic
1072815044 10:98499108-98499130 GGGTGTTTAGGTCTCTAGCAAGG - Intronic
1072885373 10:99267908-99267930 GGGTGTTTAGGTCTCTAGCAAGG - Intergenic
1073943198 10:108721171-108721193 GGATGTTGACCTCCCTAGCAAGG - Intergenic
1074635574 10:115312640-115312662 GGGTGTCTACATTTCTAGCAAGG + Intronic
1074937083 10:118192240-118192262 GGGGGTTTTCCATTCTAGCCAGG - Intergenic
1078816224 11:14824740-14824762 GGGTGTTGGCCTCTCTAGCAAGG - Intronic
1080402440 11:31948496-31948518 GGATGTTTAGGTCTCTAGCAAGG - Intronic
1080585731 11:33681366-33681388 GGATGTCTAGGTTTCTAGCAAGG + Intergenic
1086203422 11:84231019-84231041 GTGTGTTTAATTTTTTAGCAGGG - Intronic
1087797976 11:102474132-102474154 AGGTGGTTACGTTTATAGCAAGG + Intronic
1087817282 11:102673501-102673523 GCCTGTTGACCTCTCTAGCAAGG + Intergenic
1088413646 11:109565886-109565908 GGATGTCTACATCTCTAGCAAGG + Intergenic
1093468959 12:19480821-19480843 GGGTGTCTACCTCTTTAGCAAGG + Intronic
1094263308 12:28526638-28526660 GGATGTCTAGGTTTCTAGCAAGG + Intronic
1096826955 12:54286644-54286666 GGTTGTTTACTTTTCTAGGGAGG + Intronic
1098145317 12:67491267-67491289 GAGTGTTGACATTTCTAGCAAGG - Intergenic
1098371576 12:69766188-69766210 GGGTGTTTACCTTTCTAGCAAGG + Intronic
1098960778 12:76738026-76738048 GGTTGTTTAGGTTTCTTGCAAGG + Intergenic
1099273873 12:80550538-80550560 CGGTGTTTCCCTTTCCAGGATGG + Intronic
1101911993 12:108866973-108866995 GGTTGTTGGCCTTTCTAGCCTGG + Intronic
1107361348 13:39620563-39620585 GGATGTCTAGATTTCTAGCAAGG - Intergenic
1108111155 13:47074304-47074326 GCATGTTGACTTTTCTAGCAAGG - Intergenic
1109069535 13:57747108-57747130 GGTTGTCTACTTTTCTTGCAAGG + Intergenic
1109325970 13:60868552-60868574 GGATGTTGACCTCTCTAGCTAGG + Intergenic
1109869799 13:68319897-68319919 GGATGTTAACCTGTCTAGCAAGG + Intergenic
1110375833 13:74793127-74793149 GGATGTTTAGATCTCTAGCAAGG + Intergenic
1110748220 13:79080678-79080700 GGATGTCTAGTTTTCTAGCAAGG - Intergenic
1114787244 14:25614966-25614988 GAATGTTGACCTTTCTAGTAAGG + Intergenic
1116328685 14:43568046-43568068 AGGTGTCTACATTTCTAGAATGG - Intergenic
1116504692 14:45664331-45664353 GACTGTTGACCTCTCTAGCAAGG + Intergenic
1116873025 14:50085560-50085582 GGTTGGTTACCTTTATAACAAGG + Intronic
1118165730 14:63333735-63333757 GGGTGTCTAGGTCTCTAGCAAGG - Intergenic
1119266683 14:73266887-73266909 GGGTGTCCACCTTTCTGCCAGGG + Intronic
1119931049 14:78547389-78547411 GGGTTTTTACCATTTTAGCCAGG + Intronic
1126212475 15:46115181-46115203 GGCTGCTTACCTGACTAGCAGGG + Intergenic
1127929978 15:63588819-63588841 AGGTGGTTACCTTTTTAGCATGG + Intronic
1132035996 15:98485369-98485391 TGCTGTTTTCCTTGCTAGCAGGG + Intronic
1138192261 16:55023416-55023438 GGATGTCTAGCTCTCTAGCAGGG - Intergenic
1138827296 16:60335615-60335637 GGGAGTTTCACTTTCTAGTAGGG + Intergenic
1139947422 16:70650733-70650755 GAGAGTCTACCTTTCTAACAAGG - Intronic
1146936593 17:36816053-36816075 GGGTGTTTACTTTCTTAGCAGGG + Intergenic
1149122245 17:53183908-53183930 GGGTGTCTATGTCTCTAGCAAGG + Intergenic
1150818622 17:68416501-68416523 GGATGTCTAGGTTTCTAGCAAGG + Intronic
1151581455 17:74981608-74981630 GGGACTTTACCTTTCTGGCTGGG - Intergenic
1153785535 18:8530651-8530673 GACTGTTGACCTCTCTAGCAAGG - Intergenic
1156893223 18:42214299-42214321 GGATGTTTACGTCCCTAGCAAGG + Intergenic
1159453904 18:68637451-68637473 GGATGTCTAGGTTTCTAGCAAGG + Intergenic
1159612767 18:70545106-70545128 GGATGTCTAGATTTCTAGCAAGG + Intergenic
1162718731 19:12649289-12649311 GGGTGATTCCCTTTCTATCGAGG + Intronic
1163888019 19:19985630-19985652 GGGTGTCTAGATCTCTAGCAAGG - Intergenic
1164342572 19:24421820-24421842 GGATGTTTCCATTTCTACCATGG - Intergenic
1164342762 19:24424716-24424738 GGATGTTTCCTTTTCTACCATGG - Intergenic
1164342952 19:24427612-24427634 GGATGTTTCCTTTTCTACCATGG - Intergenic
1164343142 19:24430508-24430530 GGATGTTTCCATTTCTACCATGG - Intergenic
1164343884 19:24441917-24441939 GGATGTTTCCTTTTCTACCATGG - Intergenic
1164344081 19:24444983-24445005 GGATGTTTCCTTTTCTACCATGG - Intergenic
1167287716 19:48607922-48607944 GAGTGTTTACCTTCCCAGCTTGG - Intronic
927005069 2:18840073-18840095 GGATGTTTATTTCTCTAGCAAGG + Intergenic
927176626 2:20414224-20414246 GGGTGTCTAGATCTCTAGCAAGG + Intergenic
928342254 2:30454752-30454774 GGTTGTTTACATTTTTAACATGG + Intronic
929398853 2:41556022-41556044 GGGTGTCTAGGTTTCCAGCAAGG - Intergenic
930939328 2:56995875-56995897 GGCTGTTGGCCTCTCTAGCAAGG + Intergenic
931501726 2:62876090-62876112 GAATGTTGACCTCTCTAGCAAGG - Intronic
933362878 2:81310271-81310293 GAATGTGTACCTCTCTAGCAAGG - Intergenic
934810696 2:97274320-97274342 GACTGTTGGCCTTTCTAGCAAGG - Intergenic
934826996 2:97433619-97433641 GACTGTTGGCCTTTCTAGCAAGG + Intergenic
935102666 2:100011570-100011592 TGGTGTTTATATTTCTTGCAGGG - Exonic
936885542 2:117306878-117306900 GGATGTTTAAATCTCTAGCAAGG + Intergenic
936899158 2:117464968-117464990 GGATGTCTAGATTTCTAGCAAGG + Intergenic
937410678 2:121672048-121672070 GGATGTTTAGATCTCTAGCAAGG - Intergenic
937572598 2:123382133-123382155 GGATGTCTAGGTTTCTAGCAAGG - Intergenic
939392696 2:141589401-141589423 TTGTGTTTACCTTTATAGCTCGG + Intronic
939468853 2:142593729-142593751 GGGTGTTGATCTTTCTAAGATGG - Intergenic
941055084 2:160778087-160778109 GTATGTTGACCTCTCTAGCAAGG - Intergenic
941627585 2:167846208-167846230 GGGTGTCTAGGTCTCTAGCAAGG - Intergenic
943285560 2:185994427-185994449 GGATGTTTACATTTGTATCATGG - Intergenic
943356225 2:186859397-186859419 GGTTGTTTTCTTTTCTGGCAGGG + Intergenic
945346982 2:208730425-208730447 GAATGTCTACCTTTCTAGCAAGG + Intronic
1170720874 20:18878149-18878171 GGATGTTTAGATCTCTAGCAAGG + Intergenic
1175479250 20:59300185-59300207 GGGTGTTATCTTTTCTATCAGGG - Intergenic
1176760519 21:10780121-10780143 AGATGTTTTCTTTTCTAGCATGG - Intergenic
1178505423 21:33158775-33158797 GGTTGTTTACCTTTCAAACTTGG + Intergenic
1179092347 21:38278643-38278665 GGGTGTTACCCTTTCTAGGTAGG - Intronic
1181981599 22:26770733-26770755 GGGTGTTGACATTTGTATCAAGG + Intergenic
1183976012 22:41512802-41512824 GGGTGCTTCCCTTTCTTCCAAGG + Intronic
949504794 3:4717237-4717259 GGATGGTTACCCATCTAGCAAGG + Intronic
951067498 3:18284020-18284042 TGGTGTTTCCCTCTCTAGCCAGG - Intronic
951268716 3:20600511-20600533 GAATGTTGACCTCTCTAGCAAGG + Intergenic
951849721 3:27125792-27125814 TGGTGTTTACATTTCCAGCAAGG + Intronic
952522265 3:34173512-34173534 GGATGTTTAGATCTCTAGCAAGG + Intergenic
952689706 3:36190998-36191020 GGATGTTTAGGTCTCTAGCAAGG + Intergenic
955012724 3:55035267-55035289 CGGTATTGACTTTTCTAGCAGGG + Intronic
959452318 3:106518756-106518778 GACTGTTGACCTCTCTAGCAGGG - Intergenic
962192030 3:133320626-133320648 GGATGTCTAGATTTCTAGCAAGG - Intronic
963088382 3:141459417-141459439 GGCTGTCTAGCTTTCTAGCCTGG + Intergenic
964142344 3:153418521-153418543 GGATGTAGACCTTTCTAGCAAGG + Intergenic
964305799 3:155338374-155338396 AGGTGTTTACCTTAGTAGCAGGG - Intergenic
965036515 3:163446117-163446139 GAATGTTAGCCTTTCTAGCAAGG - Intergenic
965123922 3:164599494-164599516 GGGTGTTTACTTATTTACCAAGG + Intergenic
966229784 3:177639600-177639622 GGATGTCTAGATTTCTAGCAAGG + Intergenic
967447635 3:189585217-189585239 GGGTGTTAAACTCTCTTGCAAGG - Intergenic
968819682 4:2841202-2841224 GAGTGTTTAACTTTCTAACTAGG - Intergenic
970170898 4:13289572-13289594 GAATGTTGACCTCTCTAGCAAGG + Intergenic
970541511 4:17085179-17085201 GTGTTTTTGCCTTTATAGCAGGG + Intergenic
973034513 4:45389626-45389648 GCATGTTGACCTCTCTAGCAAGG + Intergenic
974095949 4:57364388-57364410 GTTTCTTTCCCTTTCTAGCAGGG - Intergenic
974841380 4:67303311-67303333 GGGTTTTCACCTTGCTAGCCAGG - Intergenic
977393981 4:96449319-96449341 GGCTGTTGACTTCTCTAGCAAGG + Intergenic
977822759 4:101493900-101493922 GGATGTCTACCTCTCTAGGAAGG + Intronic
979357133 4:119717332-119717354 GGTTGTCTACATCTCTAGCAAGG - Intergenic
979584695 4:122402529-122402551 GGATGTCTACATCTCTAGCAAGG + Intronic
982800165 4:159696429-159696451 GGATGTCTAGCTGTCTAGCAAGG + Intergenic
983136177 4:164083501-164083523 GGCTATTTTCCTTTCTAACATGG - Intronic
983962931 4:173776847-173776869 GGGTGTCTAGATCTCTAGCAAGG + Intergenic
984020288 4:174476847-174476869 GGATGTCTAGATTTCTAGCAAGG - Intergenic
986320736 5:6630898-6630920 GGGTTTTTACCTTGCTAGCCAGG - Intronic
986539692 5:8830657-8830679 GGATGTCTAAATTTCTAGCAAGG - Intergenic
986985153 5:13492723-13492745 GAATGTTCACCTCTCTAGCAAGG + Intergenic
987042946 5:14079822-14079844 AGGTGTTTTTCTGTCTAGCAGGG + Intergenic
987299985 5:16588617-16588639 GAATGTTTGCCTTTCTGGCAGGG - Intronic
989912341 5:49672095-49672117 GGATGTTTCCATTTCTACCATGG - Intergenic
989913239 5:49686404-49686426 GGATGTTTCCTTTTCTACCATGG - Intergenic
989913608 5:49692198-49692220 GGATGTTTCCTTTTCTACCATGG - Intergenic
989913798 5:49695093-49695115 GGATGTTTCCTTTTCTACCATGG - Intergenic
989914356 5:49703781-49703803 GGATGTTTCCTTTTCTACCATGG - Intergenic
989915108 5:49715371-49715393 GGATGTTTCCTTTTCTACCATGG - Intergenic
989915476 5:49721161-49721183 GGATGTTTCCTTTTCTACCATGG - Intergenic
991157977 5:63460582-63460604 GGCTGTTGGCCTCTCTAGCAAGG - Intergenic
992898785 5:81271570-81271592 GGGTGTCTAGATCTCTAGCAAGG - Intergenic
994063739 5:95510872-95510894 GGGTGATTACCTATCTATGAAGG + Intronic
994304187 5:98181837-98181859 GGATGTTTAGGTCTCTAGCAAGG - Intergenic
994635330 5:102339207-102339229 GGGTGTCTACCCTTCTCGCTGGG - Intergenic
995115572 5:108474331-108474353 GGGTGTCTAAATCTCTAGCAAGG - Intergenic
996579431 5:125014987-125015009 GGGTCTTTACATTTCTAGGTAGG - Intergenic
997761074 5:136447679-136447701 GGATGTTTAGGTCTCTAGCAAGG - Intergenic
998941000 5:147281714-147281736 GGATGTCTAGATTTCTAGCAAGG - Intronic
999566981 5:152874886-152874908 GATTGTTAGCCTTTCTAGCAAGG - Intergenic
1000135888 5:158350428-158350450 TGGTGTTTGCCTATCTGGCAGGG + Intergenic
1004600340 6:17143961-17143983 GGATGTCTAAATTTCTAGCAAGG + Intergenic
1004776792 6:18856305-18856327 GGATGTCTACCTCTCTAGCAAGG + Intergenic
1009694741 6:67087858-67087880 GAGTGTTGACCTCTCTAGGAAGG + Intergenic
1010976060 6:82314663-82314685 GGATGTCTAGCTCTCTAGCAAGG - Intergenic
1011005394 6:82638717-82638739 GGGTGTCTAGCTCTGTAGCAAGG - Intergenic
1011225334 6:85098488-85098510 GGATGTTTATATTTCTTGCAAGG - Intergenic
1012203297 6:96433124-96433146 GGGTGTCTAGATCTCTAGCAAGG + Intergenic
1016947935 6:149551480-149551502 GGATGTCTAGGTTTCTAGCAAGG + Intergenic
1018009550 6:159656877-159656899 GGATGTCTACGTCTCTAGCAAGG - Intergenic
1018762606 6:166904849-166904871 TGGTGTTTACCTTCTTAGCTGGG - Intronic
1020265210 7:6556034-6556056 GTGTGTTTCTCTTTATAGCAGGG + Intergenic
1020607681 7:10359084-10359106 GAATGTGTGCCTTTCTAGCAAGG + Intergenic
1021481106 7:21118196-21118218 GGATGTCTAACTCTCTAGCAAGG + Intergenic
1023144516 7:37136332-37136354 GGTTGTCTAGATTTCTAGCAAGG - Intronic
1023837953 7:44079546-44079568 AGGTGCTTACCATCCTAGCAGGG - Intronic
1025063189 7:55828850-55828872 GGATGTGTACCTCTCTAGCAAGG + Intronic
1028431425 7:90751140-90751162 GGATATTCACCTCTCTAGCAAGG - Intronic
1028936724 7:96473292-96473314 GGATGTCTACGTCTCTAGCAAGG + Intergenic
1038265010 8:26032338-26032360 GGGTTTTCACATTTCTAGCCAGG - Intronic
1040723561 8:50354007-50354029 GGGAGTTTCCCTATCTAGAAAGG + Intronic
1040972496 8:53152012-53152034 GTGTGTTTACCTTTCAATTAAGG - Intergenic
1044162279 8:88934737-88934759 GACTGTTAACCTCTCTAGCAAGG + Intergenic
1044793680 8:95873750-95873772 GAATGTTTGCCTTTCTAGCTAGG - Intergenic
1045319290 8:101069690-101069712 GGGTGGTTATCTTTCCAGGAAGG + Intergenic
1047548279 8:125840816-125840838 GAATGTTACCCTTTCTAGCAAGG - Intergenic
1048006355 8:130422405-130422427 GGGAATTTACTTTTCTATCAAGG - Intronic
1049108159 8:140626348-140626370 GGGTCTTTACTTTGCAAGCAGGG - Intronic
1049794855 8:144492526-144492548 GGGGTTTTACCTTGTTAGCAAGG + Intronic
1050201447 9:3149481-3149503 TGGTGTTGCCCTTTCTAGCCAGG - Intergenic
1050687929 9:8192263-8192285 GGATGTCTACCTCTCCAGCAAGG - Intergenic
1050742367 9:8836870-8836892 GGTTGTTTACTTTTCTAGGGAGG - Intronic
1050987853 9:12105458-12105480 GGATGTCTAGATTTCTAGCAAGG - Intergenic
1051920160 9:22255698-22255720 GGATTTTTACCTGTCTAGCAAGG + Intergenic
1052307335 9:27025123-27025145 GGATGTCTACATCTCTAGCAAGG - Intronic
1052357990 9:27525906-27525928 GATTATTTACTTTTCTAGCACGG + Intronic
1053247792 9:36549374-36549396 GGATGTCTAGGTTTCTAGCAAGG - Intergenic
1055156459 9:73068173-73068195 GGATGTTTAGATCTCTAGCAAGG - Intronic
1058534919 9:105949120-105949142 GACTGTTGACCTCTCTAGCAAGG + Intergenic
1059218179 9:112586802-112586824 AGGTGTTGACCTTTCTAGCTTGG + Intronic
1187109143 X:16278157-16278179 GGATGTTTAGATTTCTAGCAAGG + Intergenic
1187681565 X:21772162-21772184 GGGTGTCTAGGTCTCTAGCAAGG - Intergenic
1188869550 X:35357750-35357772 GACTGTTTGCCTCTCTAGCATGG + Intergenic
1189653277 X:43212675-43212697 GTATGTTGACCTCTCTAGCAAGG - Intergenic
1190897177 X:54632305-54632327 GGATGTCTAGATTTCTAGCAAGG + Intergenic
1191774214 X:64794880-64794902 GGATTTGTACCTGTCTAGCAAGG - Intergenic
1191917366 X:66217138-66217160 GGGTGTCTAGATCTCTAGCAAGG - Intronic
1192298196 X:69871854-69871876 GGATGTCTAGCTCTCTAGCAAGG - Intronic
1192756465 X:74051136-74051158 GAATGTTGACCTCTCTAGCAAGG - Intergenic
1192892064 X:75400588-75400610 GACTGTTGACCTCTCTAGCAAGG - Intronic
1193090784 X:77492115-77492137 AGGAGTTTACATATCTAGCAGGG + Intergenic
1193162469 X:78242694-78242716 GGATGTTGACCTCTCTAGCTAGG - Intergenic
1193480280 X:82019103-82019125 GGTTGTTTACTTTTCTTGGAAGG + Intergenic
1193799537 X:85918021-85918043 GTGTGTTGACCTCCCTAGCAAGG - Intronic
1193916609 X:87372073-87372095 GCATGTTTACCTCTCTAGCAAGG - Intergenic
1194212974 X:91091598-91091620 GACTGTTGACCTCTCTAGCAAGG + Intergenic
1194354010 X:92857807-92857829 GGGTGTCTAGGTGTCTAGCAAGG - Intergenic
1194381246 X:93193752-93193774 GGATGTTTAGATCTCTAGCAAGG - Intergenic
1194532952 X:95073180-95073202 GGATGTTTAGATCTCTAGCAAGG - Intergenic
1197519062 X:127474308-127474330 GGATGTCTAAGTTTCTAGCAAGG - Intergenic
1198231237 X:134691648-134691670 GTGTGTTTACATTTCCAGAAGGG - Intronic
1199276081 X:145943920-145943942 GAATGTTGACCTCTCTAGCAAGG + Intergenic
1199464351 X:148119044-148119066 TGTTGTTCACCTTTGTAGCATGG - Intergenic
1200662365 Y:5974873-5974895 GGGTGTCTAGGTCTCTAGCAAGG - Intergenic
1202036274 Y:20640119-20640141 GGATGTCTATCTGTCTAGCAAGG + Intergenic