ID: 1098373875

View in Genome Browser
Species Human (GRCh38)
Location 12:69791226-69791248
Sequence CTGTAAACTCAGAAGAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 372}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098373875 Original CRISPR CTGTAAACTCAGAAGAAACA AGG Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
900879102 1:5367713-5367735 CTGTAAACTTTAAAGGAACATGG - Intergenic
900964721 1:5949981-5950003 TTTTAAACACAGAAGAAAAATGG + Intronic
902340664 1:15781583-15781605 CTGTTAACTAAGAAGAAAAATGG + Intronic
902720177 1:18298801-18298823 CTGTAAGCTCCGAAGAGGCAGGG - Intronic
902832599 1:19027140-19027162 ATGGAAACTCAGAAAATACAGGG + Intergenic
903303933 1:22399458-22399480 CTGTAAAATGAGAAGAATAATGG - Intergenic
904585285 1:31576628-31576650 GTGTAGACAGAGAAGAAACAGGG + Intronic
904929263 1:34073360-34073382 GTGTAAACTAATTAGAAACATGG - Intronic
905431877 1:37930720-37930742 TTGTAAACTGAGAGGAAACGAGG - Intronic
905997268 1:42392129-42392151 CTCTAAACTCTGAAGAAATGTGG - Intronic
906850752 1:49247583-49247605 CTGGAATCTCAGAAAAAAAAGGG - Intronic
907012917 1:50979734-50979756 CTGTCCACTGAGAAGGAACAGGG - Intergenic
907071078 1:51535405-51535427 CTTTAAAGACAGAAGAAACTAGG - Intergenic
907536543 1:55165944-55165966 CTCCAAACTGAGAAGAAAAAAGG + Exonic
908704963 1:66943201-66943223 TTGAAAACTCAGAAGAGAAAAGG + Intronic
908826792 1:68141044-68141066 ATGTAAAATCAGGAAAAACAGGG - Intronic
908923927 1:69230380-69230402 CTGTGAACTCAGATGAGTCAAGG - Intergenic
909299045 1:73987711-73987733 ATGTTAGATCAGAAGAAACATGG - Intergenic
909376861 1:74950949-74950971 CTGTAAAATCAAAAGAAAGTTGG - Intergenic
910465621 1:87496200-87496222 CTGTTAACACAGAAGAGACCAGG + Intergenic
912759813 1:112356895-112356917 CTGAAGACCCAGAAGACACAGGG + Intergenic
912972710 1:114299023-114299045 CTGGGAACTGAAAAGAAACAAGG - Intergenic
913184774 1:116360242-116360264 CTGGAAACTCTGGAGGAACAGGG + Intergenic
914360433 1:146931282-146931304 CTGTTAACACAGAAGAGACCAGG + Intergenic
914493314 1:148168616-148168638 CTGTTAACACAGAAGAGACCAGG - Intergenic
915681451 1:157585644-157585666 CAGGAAACTCACAAGAAGCAGGG - Intronic
916308609 1:163368932-163368954 CTCAAAACTCAGAAGAAATTAGG + Intergenic
916947753 1:169745790-169745812 CTAAATACTCAGAAGAAATAAGG + Intronic
917408214 1:174731859-174731881 TTTTAAAATCAGAAAAAACAAGG + Intronic
919061586 1:192640902-192640924 TTGAAAACACAGAAGAAAGAAGG - Intronic
919729264 1:200902448-200902470 CAGTAAACTCAGAAGACAGTGGG + Intronic
920079508 1:203362114-203362136 CTGTGACCTCAGAATCAACAAGG + Intergenic
920809232 1:209266538-209266560 TTCTAAACTGAGAGGAAACAGGG - Intergenic
922005882 1:221530260-221530282 CTGTAAAGGAAGAAGAGACAGGG - Intergenic
1062790609 10:302099-302121 CTATAAACTAATAAGAAAAAAGG + Intronic
1063295125 10:4797496-4797518 ATGTTAAATCAGTAGAAACACGG - Intronic
1064142047 10:12798843-12798865 CTGTGCACACAGAAGAATCAGGG + Intronic
1064727225 10:18292748-18292770 CTGTAAACTCTTAAAAAATAAGG + Intronic
1067300467 10:45003497-45003519 CAGTAGACTCAGAAGAAGCTTGG + Exonic
1068028472 10:51678491-51678513 CTGTAAACTTATCAAAAACAAGG - Intronic
1068439522 10:57032888-57032910 CTGTAAAATCAAAAGCAAGATGG - Intergenic
1070012238 10:72487435-72487457 CTGTAACCACAGATGAAACATGG + Intronic
1070515146 10:77198123-77198145 GTGAAAATTCAGGAGAAACAAGG + Intronic
1071144605 10:82553417-82553439 CTGTAGACTCCAAAGAAAGATGG - Intronic
1071605619 10:86985757-86985779 CAAGAGACTCAGAAGAAACAGGG - Intergenic
1071710905 10:88048199-88048221 ATGTAAAATCAGAGGAGACAGGG - Intergenic
1073110722 10:101061679-101061701 CTGTAAAATCAGATGGGACAGGG + Intergenic
1073938943 10:108671099-108671121 CAGTTAACTCAGAAGAATCCAGG + Intergenic
1074326120 10:112453071-112453093 CTGTAAAGTCATCAGAAACAAGG - Intronic
1074923332 10:118041941-118041963 TGGTAAAATCTGAAGAAACAGGG + Intronic
1077750981 11:4969793-4969815 CTGATAACTCAGAAGATACAAGG + Intronic
1079895092 11:26109101-26109123 CTGCAAACACAGAGGAACCAGGG + Intergenic
1080817133 11:35769452-35769474 TTGTAAATTAAAAAGAAACAAGG - Intronic
1082134754 11:48534316-48534338 CTGAAAACACAGAAGTAACTGGG - Intergenic
1083887773 11:65581195-65581217 CTGGCAACTGAGAAGAAAGAGGG - Exonic
1084709681 11:70836204-70836226 CTGCACACTCAGAAGCAGCATGG + Intronic
1085484667 11:76851892-76851914 TTCTAAACTCAGAAGAAACTTGG - Intergenic
1085534333 11:77208974-77208996 CTGAAGAATCAGAAGATACAAGG - Intronic
1085977283 11:81673419-81673441 CTGAACACTCAAAACAAACATGG - Intergenic
1086957885 11:92952818-92952840 CTGAAAGCCCAGAAAAAACAGGG - Intergenic
1088912321 11:114200974-114200996 CTGTAAACTCTGAATAAAATAGG - Intronic
1089529558 11:119117595-119117617 CTGTTGCCTCAGAAGAAACTGGG + Exonic
1090114030 11:123947244-123947266 CTGCAAACTGAGAGGTAACAAGG - Intergenic
1093668513 12:21843870-21843892 CTGGAAAGTCAGAAAAGACAAGG + Intronic
1095160267 12:38906405-38906427 CTCTAAGCTCCGAAGAACCAAGG - Intronic
1095323001 12:40852306-40852328 CTATAAAATAAGAAGAAAAATGG - Intronic
1095813659 12:46398154-46398176 CTAAAAACTCACAAGAAACTAGG + Intergenic
1095919948 12:47518848-47518870 CTGTAAACTCAGTAGGTAAATGG + Intergenic
1096162312 12:49389026-49389048 CTTAAAAATCAGAAGAAAAAAGG - Intronic
1096267768 12:50137742-50137764 CTGTAAACTGAGAAAACATAAGG + Exonic
1098305819 12:69101633-69101655 CTGTAACGTGAGATGAAACATGG + Intergenic
1098373875 12:69791226-69791248 CTGTAAACTCAGAAGAAACAAGG + Intronic
1098579901 12:72087386-72087408 CTGAAGACACAGAAGAAAGATGG + Intronic
1098812218 12:75109312-75109334 CAGTAACCAAAGAAGAAACACGG + Intronic
1099043570 12:77686741-77686763 CTGTAAAGTCAGATGAACCTAGG - Intergenic
1100035002 12:90239773-90239795 CTGAAATCTCAGGAGAACCAGGG - Intergenic
1101389164 12:104284624-104284646 CTGTAAAGACAAAATAAACAAGG + Intronic
1102320663 12:111931128-111931150 TTGGAAACTCATAGGAAACAAGG - Intergenic
1102765962 12:115433251-115433273 CTGGAAGCTTAGAAGACACAGGG + Intergenic
1104409494 12:128546473-128546495 CTGGAAGCTCAGAACAAACAGGG - Intronic
1106638883 13:31561788-31561810 CTGAAAACTCTGAATAAACTAGG - Intergenic
1106790608 13:33151959-33151981 CGTTAAACACAGAGGAAACAGGG + Intronic
1107025620 13:35798399-35798421 CTGTAAACTCAGGAGAAGCATGG + Intronic
1107824286 13:44313482-44313504 CTGTAAAATCAAATAAAACATGG + Intergenic
1108067652 13:46595019-46595041 CTATAAACTCAGAAGAAGCTAGG - Intronic
1109678616 13:65715970-65715992 CTGTAAACTTAGAAAAATAAGGG + Intergenic
1109901329 13:68776051-68776073 CTTGAAAATAAGAAGAAACAGGG - Intergenic
1110483027 13:76005114-76005136 CTGTAAACTACTAAGACACAGGG - Intergenic
1110856200 13:80299427-80299449 CTGTTATCTCTGAGGAAACAAGG - Intergenic
1111249025 13:85579588-85579610 CTGTGAAATTAGCAGAAACAAGG + Intergenic
1112369634 13:98783688-98783710 CTGTGAAGTCAAGAGAAACAGGG + Intergenic
1112674346 13:101681381-101681403 CTGTAAACTCAGAAGCCACAGGG - Intronic
1112712313 13:102143671-102143693 CTATCAAGTCAGTAGAAACATGG - Intronic
1112989989 13:105501456-105501478 CAGTAATGTAAGAAGAAACATGG - Intergenic
1114192070 14:20447282-20447304 GTGGAAAAACAGAAGAAACATGG + Intronic
1114334986 14:21679692-21679714 CTGTAAAGACAGAACAGACAAGG - Intergenic
1115402372 14:32976819-32976841 CTGAGAAATCAGAAGAATCAAGG + Intronic
1116872437 14:50080999-50081021 CTGGAAATTCTGCAGAAACATGG - Intergenic
1116876562 14:50118061-50118083 CTGTAAACTCTGCAAAAATATGG - Exonic
1117772784 14:59151565-59151587 CTGCAAACCCAGGAGAAACAAGG - Intergenic
1117831965 14:59760711-59760733 CTGTGAGCTCATAGGAAACATGG + Intronic
1118260224 14:64239343-64239365 CTATAAACTCAGAGGGAACTAGG + Intronic
1119746034 14:77044798-77044820 CTGTAAACAGAGAAGCAGCAAGG - Intergenic
1119944534 14:78678752-78678774 CTGGATTCTCAGTAGAAACAAGG - Intronic
1120188144 14:81415869-81415891 CTGAGAACTCAGAAAAAGCAAGG + Intronic
1120261579 14:82191604-82191626 ATGAAAACTCAGAAAAAAAAGGG + Intergenic
1120312101 14:82842162-82842184 CTGTGAACTGTGATGAAACAGGG - Intergenic
1121614283 14:95302458-95302480 ATATAAAGTCAAAAGAAACAGGG + Intronic
1122642843 14:103170710-103170732 CTGAGCACTCGGAAGAAACAGGG + Intergenic
1122879514 14:104683847-104683869 CTGCAGACTCAGAAGAGGCAGGG - Intergenic
1202933778 14_KI270725v1_random:64927-64949 CTGCAAAATATGAAGAAACAAGG + Intergenic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1127183792 15:56455777-56455799 CTGTAATCAGAGAAGAAACCAGG + Intronic
1127580387 15:60333664-60333686 CTGAAAACTCTCAATAAACAAGG + Intergenic
1127769125 15:62216568-62216590 CTGTGTGCTCAGAAGAACCAGGG - Intergenic
1128096672 15:64961455-64961477 CTGTAAAGTCAGGATAATCAGGG + Intergenic
1128851612 15:70963394-70963416 CTGTCAACTCATCAAAAACAAGG + Intronic
1130050441 15:80479713-80479735 CTGAAGGCTCAGCAGAAACAGGG + Intronic
1131209833 15:90485098-90485120 TTGAAAAATCTGAAGAAACATGG - Intronic
1131899936 15:97076988-97077010 CTGTAAAACAAGAAGAACCAGGG - Intergenic
1134090930 16:11391370-11391392 CTGTATACTCAAAAGAAAGCAGG + Intronic
1135645787 16:24160653-24160675 ATGTAAATTCCAAAGAAACAGGG - Intronic
1136467801 16:30457076-30457098 TTGTATTTTCAGAAGAAACAGGG - Intergenic
1136994123 16:35176581-35176603 CTGTAATCTCAGAAGAACACTGG - Intergenic
1140898412 16:79346457-79346479 CTCTGAAATCAGAAGAAAAAGGG + Intergenic
1142025187 16:87808981-87809003 CTGTACACAAAGAAGAAAGAAGG + Intergenic
1145928142 17:28663094-28663116 CTGTAATATCAAAAGTAACAAGG + Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1147175455 17:38653367-38653389 CTTTAAAGTCAAAAGACACATGG - Intergenic
1148026740 17:44593915-44593937 CTGCAAACTCAGAGGCAAAAAGG - Intergenic
1148461679 17:47842609-47842631 CAGTAAAGTCAGAGGATACAAGG - Intergenic
1148774224 17:50086386-50086408 ATGTATAGTCAGAACAAACACGG + Intronic
1149115104 17:53084458-53084480 CTGTAACCCCAGATGAAAAATGG + Intergenic
1150173778 17:63028141-63028163 CTGTAAACCAAGAATGAACAAGG + Intronic
1153225598 18:2897437-2897459 CTGTAAACACAGCAGACACAGGG + Intronic
1153771505 18:8420602-8420624 CTGTAAAAGGAGAAGAGACACGG - Intergenic
1156588328 18:38457701-38457723 ATATAAACTAAGAGGAAACAGGG - Intergenic
1156687809 18:39670895-39670917 CTGAACACTTAGCAGAAACAAGG - Intergenic
1157144060 18:45143112-45143134 CTGTTGACTCACAAGAAAGATGG - Intergenic
1157312498 18:46562609-46562631 CTGTAGACTCAGAGGCCACAGGG + Intronic
1157945202 18:51971574-51971596 CTAAAAACTTTGAAGAAACATGG - Intergenic
1158102847 18:53850009-53850031 TTGTAAACTGAGATGAAACTAGG + Intergenic
1158385702 18:56988701-56988723 TTATAAATTCAGAAGAAGCATGG + Intronic
1158390003 18:57037224-57037246 CTGGAAACACAGAGGAAACTGGG - Intergenic
1159095734 18:63899411-63899433 CTGGAAATTCAGAAGAATGAAGG - Intronic
1159529145 18:69633471-69633493 ATGTATACTAAGAAGATACATGG - Intronic
1160601845 18:80019670-80019692 CTGGAGACTAAGAAGGAACAAGG - Intronic
1161833964 19:6632341-6632363 TTCTGAACTCAGAAGAAAAACGG + Intergenic
1161931810 19:7345587-7345609 CTGTAAGCTCAGAAGAAGTCAGG - Intergenic
1163493127 19:17628683-17628705 CGGTTAACACAGATGAAACATGG + Intronic
1163861189 19:19743732-19743754 CAGAACACTCTGAAGAAACAGGG - Intergenic
1163924004 19:20321589-20321611 CTGGGCACTCAGAAGAACCAGGG - Intergenic
1164010362 19:21198175-21198197 CTGAATACTCATAATAAACAGGG + Intergenic
1164913080 19:32027862-32027884 CTGAAAATGCAGAAGGAACAGGG + Intergenic
1167784319 19:51625065-51625087 CTGTAAACACAGAAGAGAAGGGG + Intronic
1168546497 19:57254845-57254867 CTGTAAACTAATGAGAAAGATGG - Intronic
1168641240 19:58033279-58033301 ATGTAAACTCAAGAAAAACAAGG - Intergenic
925504323 2:4543903-4543925 CTGTAACCTCATATGAAAGAAGG + Intergenic
925722137 2:6839625-6839647 CTGGAGACTAAGAAGGAACAAGG - Intergenic
926756789 2:16242979-16243001 CTGTAAAGCCAGAAGAGACAGGG - Intergenic
926811699 2:16760730-16760752 ATGAAAAATCAGAAGCAACATGG - Intergenic
926962497 2:18373813-18373835 CTGTAACAGGAGAAGAAACATGG + Intergenic
927370569 2:22350260-22350282 CTATTAACTATGAAGAAACAGGG - Intergenic
928690831 2:33797092-33797114 CTCTTAACTCAGAAGAAGCTGGG + Intergenic
929341880 2:40829564-40829586 CTCTAAAATCAGAAGAACCTGGG + Intergenic
929438784 2:41949172-41949194 CTGTTAAACCAGAAGAGACAGGG + Intronic
930599531 2:53427053-53427075 TTATAAGCTAAGAAGAAACAAGG + Intergenic
930771671 2:55136179-55136201 ATGTACACTAAGAAGCAACAGGG + Intergenic
931973461 2:67616174-67616196 CTGGGAACTCAGAAGGAACTAGG + Intergenic
932343914 2:70983486-70983508 CAGAAAACTCAGAAGATACTGGG + Intronic
932368871 2:71171332-71171354 GTGTAAGCTCAAAAGAAAAATGG + Intergenic
932635576 2:73385599-73385621 CTGTAAGCTCACAATAAACCGGG - Intergenic
933332597 2:80913401-80913423 CAGTAAAGTTTGAAGAAACATGG + Intergenic
933411901 2:81936420-81936442 CTGTAAGCTCAGAAGATATAAGG - Intergenic
933457641 2:82536818-82536840 GTGTAAAATCAGGAGAAAAATGG + Intergenic
933656945 2:84896250-84896272 CTGAAAATTCAGAAAAATCATGG + Intronic
934697917 2:96413569-96413591 CTGTACACCCAGCAGACACATGG + Intergenic
936028155 2:109049606-109049628 TTGTTAAATCAGAAGAAAGAGGG - Intergenic
937638236 2:124181098-124181120 ATGTGAACACAGAAGAAACTTGG - Intronic
938230369 2:129654089-129654111 TTGTTACCTCAGAAGAAAAAAGG + Intergenic
939742036 2:145920011-145920033 TTGCAAACTCAGAAGGAAAAGGG + Intergenic
940662765 2:156568107-156568129 CCTTAAACTCAGAAGGAAGAAGG + Intronic
941372397 2:164681658-164681680 CTGGAAACTAAGAATAAACTGGG + Intronic
941540560 2:166778247-166778269 CTGCAAACTCAAAAGAGACTAGG - Intergenic
941577750 2:167255686-167255708 CTGAAAACTAAGATGAAATAAGG - Intronic
941749311 2:169118613-169118635 CTATAAACTAAGAAGACAAAGGG + Intergenic
941884842 2:170517266-170517288 GTGTAAATTAATAAGAAACATGG + Intronic
942691329 2:178588506-178588528 CTGTAATATCAGAAAAAACAAGG + Intronic
943417308 2:187624398-187624420 ATGTAAAATGAGAAGAAATATGG + Intergenic
944781754 2:203025720-203025742 CTGTGAACTCAGAGGACACTTGG + Intronic
946411130 2:219515683-219515705 CAGTAGCCTCAGAAGAAAAAGGG - Intronic
947000958 2:225455604-225455626 ATGTAAAGTGAGAATAAACATGG + Intronic
948743389 2:240065250-240065272 CAATAAATTCAGAAGAAAAAAGG - Intergenic
1168860250 20:1041057-1041079 GTTGAAACTCAGAAGATACAAGG - Intergenic
1170540932 20:17387389-17387411 CTGCAACCTCACGAGAAACACGG - Intronic
1173173816 20:40748815-40748837 GTGTAAACCCAGAAAAAAGAAGG + Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1176595178 21:8687083-8687105 CTGCAAAATATGAAGAAACAAGG + Intergenic
1178606946 21:34046066-34046088 AAGTAACTTCAGAAGAAACAAGG + Intergenic
1182290283 22:29272167-29272189 GTGTAAAGTTAGCAGAAACAAGG - Intronic
1183498502 22:38164022-38164044 CTGGTATCTCAGCAGAAACAGGG - Intronic
1184830023 22:46979331-46979353 CTGTCACTTCAAAAGAAACAAGG - Intronic
1185021094 22:48376433-48376455 CCTAAAACTCAGAAGAAAAAAGG + Intergenic
949383443 3:3471126-3471148 ATGTACACTCTGCAGAAACAGGG + Intergenic
949500388 3:4674671-4674693 TTGTTAACTCAGAAGTAACAAGG - Intronic
951661446 3:25071011-25071033 CTCAAGACTCAGAAGAAGCATGG - Intergenic
953258982 3:41319335-41319357 TTGAGAACTCAGTAGAAACAAGG - Intronic
953654901 3:44842608-44842630 CTTGAAACTTAGAAGAAACTGGG + Intronic
954092408 3:48295517-48295539 ATGTCAAATCTGAAGAAACACGG - Intronic
954476193 3:50748305-50748327 CTCTAAACTCAGAAACCACAGGG - Intronic
954594207 3:51811394-51811416 CTGTATACTAAGAGGAGACAAGG - Intergenic
955191285 3:56763936-56763958 ATATTAACTAAGAAGAAACACGG + Intronic
956089826 3:65654206-65654228 CTGCAAACTGAGAAGAATCAGGG - Intronic
956148861 3:66220719-66220741 CTGTAAACCCAGAAGAGGCGTGG - Intronic
956518041 3:70072192-70072214 CAGTAAACCCAGAAAAAACCTGG - Intergenic
957122218 3:76109627-76109649 CTGCAATCTCAAGAGAAACATGG - Intronic
958789730 3:98637529-98637551 CTGTAATCCCAGAAGAAAAAAGG + Intergenic
959104979 3:102055231-102055253 CTGTTGACTAAGAATAAACAGGG + Intergenic
960155878 3:114296836-114296858 GTGTAAACTGAGAAGATAAAAGG + Intronic
960160056 3:114340462-114340484 CAGTAAACTGAGGAAAAACAAGG - Intronic
960254902 3:115501514-115501536 TTGTAAACACTGAAGAACCAAGG + Intergenic
961103524 3:124221861-124221883 CTGGAAACTCAGCAGAAATTGGG + Intronic
962938132 3:140100481-140100503 TTTTAAACTCAAAAGATACAAGG + Intronic
963225230 3:142855586-142855608 GTGTGACCTGAGAAGAAACAAGG - Intronic
966170224 3:177071749-177071771 TAGTAAACCCAGAAGAAAAAGGG + Intronic
966300056 3:178468900-178468922 CTGTAAACTTAGAAACAAGATGG + Intronic
966580879 3:181561458-181561480 CTGGGAACTCAGAAGTAATAAGG + Intergenic
968560851 4:1280988-1281010 CTATAAACACAAAAGAAACAGGG + Intergenic
969201950 4:5613534-5613556 CTGTAAACTGGGAATAAACTGGG + Intronic
971893927 4:32564802-32564824 CCAGAAACTCAGAAGAAGCATGG - Intergenic
972361363 4:38328428-38328450 CTGTAACCTGAGAAGAGAAAAGG - Intergenic
972854429 4:43089924-43089946 CAGAAAATTCAGAGGAAACATGG - Intergenic
972884513 4:43469312-43469334 CTGAGCACTCAGAAGAACCAGGG + Intergenic
973074508 4:45905430-45905452 CAGTAAAATCAGAAGCAAAAAGG + Intergenic
973810699 4:54567164-54567186 CTGTAATCTCTGAAGAGTCAAGG - Intergenic
974212359 4:58795583-58795605 CTGTAAATTGAGAAGAAAGAAGG + Intergenic
974390015 4:61254275-61254297 TTGTAAACTCAGAAGCCTCATGG + Intronic
974503554 4:62737347-62737369 CTAAAAACTCTCAAGAAACAAGG + Intergenic
975825399 4:78314556-78314578 TTCTAAACACAGTAGAAACACGG - Intronic
976343537 4:83972797-83972819 CTGTCAACTCAGAACCAATATGG + Intergenic
977557912 4:98503431-98503453 CTGGAAACTCAGAAGGAACCAGG + Intronic
978524521 4:109652094-109652116 ATGTACACCCAGAAGAAAGACGG - Intronic
979215553 4:118159658-118159680 CAATAAACTCAGGAGAAAAATGG + Intronic
979966983 4:127087208-127087230 CTGTAAAATCAGAAGCAAGTTGG - Intergenic
980726910 4:136774202-136774224 CTGTAAAGTCAGAATCTACAGGG - Intergenic
981296250 4:143135321-143135343 TTTTAAACTAAGAAGAATCAAGG - Intergenic
981898812 4:149836887-149836909 CTGTATTTTCAGTAGAAACAGGG - Intergenic
982568990 4:157025029-157025051 TTCTAAACTCAGAAGTATCATGG - Intergenic
982997620 4:162369644-162369666 CTGTAACTTCAGAAAAAAAAGGG + Intergenic
983115631 4:163812583-163812605 TTGTAAATTCAGAAGAGACAGGG - Intronic
983225565 4:165082906-165082928 TTGTATACTCAGTAGAGACAGGG + Intronic
984104270 4:175525456-175525478 ATGTCAACTCAGAAAGAACATGG - Intergenic
984248998 4:177309650-177309672 CTGTAAAAGCAGAAGAAATTGGG - Intergenic
985712001 5:1434633-1434655 CAGTAAACTGAGAAGAAATGTGG - Intronic
985717261 5:1469602-1469624 TTGTAATTTTAGAAGAAACAGGG - Intronic
985869201 5:2540564-2540586 GTGAAAACTTAGAAGACACAGGG - Intergenic
986696888 5:10365104-10365126 CTGTGAGATCAGAAGAAGCAGGG - Intronic
987499284 5:18686502-18686524 CTGCAAAATCAGGAGAAACCTGG - Intergenic
988308081 5:29519859-29519881 CTGAAAACTCAAAAGAAATAGGG - Intergenic
988457386 5:31398471-31398493 CTGAGAACTCAGAAGAACCAGGG - Intergenic
989076573 5:37569943-37569965 CTGGAAATACAGAAGAAATAGGG + Intronic
989112745 5:37922969-37922991 CTGAGAACTCAGAAGGAAGAAGG - Intergenic
989566614 5:42907391-42907413 TTGTTAACTCAGAAGGCACAAGG + Intergenic
989567946 5:42919775-42919797 TTGTCAACTCAGAAGGCACAAGG - Intergenic
990906073 5:60804719-60804741 TTGTAAACTCAGAAAAATAAGGG + Intronic
991202263 5:64008296-64008318 CTGTAAACACTGAGGAAGCATGG - Intergenic
991589729 5:68237777-68237799 CTGTAAACTCAACAGAACCGGGG + Intronic
991694695 5:69259718-69259740 CTTTAAACTTAGCAAAAACAAGG - Intronic
993327608 5:86561467-86561489 CAGTAAAATCAGAAGCATCAAGG + Intergenic
993684071 5:90916608-90916630 TTGTGAACGCTGAAGAAACAAGG - Intronic
994187721 5:96833870-96833892 CAGGAAAATCAGAAGACACATGG - Intronic
995240837 5:109884320-109884342 GTGAAAACTCAGACGAAACTCGG - Intronic
995405698 5:111793100-111793122 CTGTAAATTCAAATGAAACATGG + Intronic
995653735 5:114401455-114401477 CTGTTAACTGAGAAATAACAAGG + Intronic
995865090 5:116681840-116681862 CTGAAAACACCGAAGAAACGAGG - Intergenic
996183281 5:120446924-120446946 CCATAAACAAAGAAGAAACATGG + Intergenic
996257702 5:121426087-121426109 CTGTAAAATCAAAAGCAACTTGG + Intergenic
996304841 5:122035281-122035303 CTGGACACTCAGGAGAAAGATGG - Intronic
996876821 5:128249608-128249630 CTGTATTTTTAGAAGAAACAGGG + Intergenic
998273520 5:140728975-140728997 CTGTAATCCCAGGAGAATCATGG - Intergenic
1000502102 5:162064853-162064875 ATGAAAGCTCAAAAGAAACAGGG - Intergenic
1000516241 5:162238952-162238974 CTGTACCCTAAGAGGAAACAGGG + Intergenic
1000636296 5:163647325-163647347 CTGTAAACCAAGAAAAAAGAAGG - Intergenic
1000699717 5:164433696-164433718 CTGGAAACTCAGAACATACCAGG - Intergenic
1001168953 5:169398844-169398866 CTGAAGACCCAGAAGAAATAGGG + Intergenic
1001352753 5:170985916-170985938 ATGTAAATTCAGAAGAATGAAGG - Intronic
1001715725 5:173814267-173814289 CTCTAAAAGCAGCAGAAACAAGG - Intergenic
1002664704 5:180814531-180814553 GTGTAAAATGAGAAGACACAAGG - Intronic
1003331463 6:5132754-5132776 GAGTAAACTCAAAAGAAACTGGG - Intronic
1003396095 6:5753220-5753242 CTGCAAACTTTGAAGAAAGATGG + Intronic
1004099515 6:12594476-12594498 CTGTAAACTAAGAGGCAAAATGG - Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005132913 6:22532314-22532336 CTTTAACTTCAGAAGGAACATGG + Intergenic
1005866204 6:29939308-29939330 CTGGGAATTCACAAGAAACATGG - Intergenic
1007087089 6:39156182-39156204 TTGTAAACTCCTAAGCAACAAGG + Intergenic
1007764585 6:44153065-44153087 CTGTAAACTCAGGAAAGACTTGG + Intronic
1007832626 6:44650405-44650427 CTGTATATTCAGTAGAGACAGGG - Intergenic
1008487936 6:52055497-52055519 CTGAAAACTCAGAAGCACAAAGG - Intronic
1008489587 6:52072258-52072280 CACAAAACTCAGAGGAAACATGG + Intronic
1008562248 6:52734721-52734743 CTGTACAGTCTGCAGAAACATGG - Intergenic
1010480475 6:76346550-76346572 AAGAAAACTCAGAAGAAAAATGG + Intergenic
1010628307 6:78166581-78166603 CTGTAATCTCACATGAAAGAAGG + Intergenic
1010687195 6:78867170-78867192 CGGTAAAGTCAGAAAAGACAAGG + Intergenic
1011172562 6:84522178-84522200 CTGTACAGGCAGGAGAAACAGGG + Intergenic
1012100581 6:95081104-95081126 CCGTAAAGTCAGAAGAAATGAGG + Intergenic
1012914684 6:105156769-105156791 GTGTAGATTCAGAAGAAAAATGG - Intergenic
1014334369 6:120114303-120114325 GTGAATACTCAGAAGTAACATGG + Intergenic
1014401820 6:120999189-120999211 CTGGAGACTCGGGAGAAACATGG - Intergenic
1014651423 6:124043526-124043548 ATATAAACTCACAATAAACAAGG + Intronic
1016315927 6:142786872-142786894 ATTTAACCTCAGAAAAAACAAGG - Intronic
1016672799 6:146728401-146728423 CTGTAGTCTCAGAAAAAACAAGG - Intronic
1017287578 6:152694410-152694432 ATGTAAACAAAGAAGAAAAAAGG + Intergenic
1018109529 6:160521653-160521675 CTGTAAACACACAAGAAAAGTGG + Intergenic
1018703484 6:166446387-166446409 CTGTAGTCTCAGAAGGGACAAGG + Intronic
1019397839 7:832374-832396 CTCAAAACTCACAGGAAACACGG - Intronic
1020718640 7:11712413-11712435 CTGTAAACTCCAAAGCAAAATGG - Intronic
1022913938 7:34927922-34927944 CTCTGAACTGAAAAGAAACAAGG + Intergenic
1023935139 7:44734314-44734336 CTGTAAAAACAAAACAAACAAGG - Intergenic
1024165016 7:46722436-46722458 CTGTCCACCCAGAAGCAACATGG + Intronic
1024186879 7:46958472-46958494 CTGTATACTCAGAAAGATCAGGG + Intergenic
1024509952 7:50196048-50196070 CTGTGACCTCAGGAGAAAAATGG + Intergenic
1024921094 7:54555356-54555378 TTAGGAACTCAGAAGAAACAAGG - Intronic
1026962601 7:74418064-74418086 GTGTAAATTCAGAAGGAACATGG + Intergenic
1027444876 7:78262141-78262163 GTGTAAAGTCAGTAGAACCATGG - Intronic
1027540781 7:79462321-79462343 CTGTAATCTCTGAAGAAAAGTGG + Intergenic
1028736022 7:94213336-94213358 CTCTGAGCTCAGAGGAAACATGG - Intergenic
1028883726 7:95909205-95909227 CTGAAAACTCTGGAGAAACTTGG + Intronic
1029678493 7:102090560-102090582 CTGTATTTTCAGTAGAAACAAGG + Intronic
1029974150 7:104816893-104816915 ATGGAAACCCAGAAGACACAAGG - Intronic
1030389467 7:108908192-108908214 CTGAAAACACAGTAGAAAAATGG - Intergenic
1030646098 7:112063660-112063682 CTGTACAATCATAAGAAAAAAGG + Intronic
1030842921 7:114378376-114378398 CTGAAATATTAGAAGAAACAAGG + Intronic
1031420211 7:121542703-121542725 CTGTATTTTCAGGAGAAACAGGG - Intergenic
1032298439 7:130664483-130664505 CTTGAAACTCAGAAAACACATGG + Intronic
1037251283 8:16897498-16897520 CTTTAACCCCAGATGAAACATGG - Intergenic
1037492136 8:19406738-19406760 CTGCAAACAGAGAAGAAACGAGG + Intronic
1037602741 8:20411768-20411790 CTGTAAACTCATAATGAACACGG - Intergenic
1040824057 8:51598412-51598434 ATGAAAACTCTCAAGAAACAAGG - Intronic
1040884079 8:52240464-52240486 CTGTTAAACCAGAAGAAAGAAGG - Intronic
1041036793 8:53799807-53799829 CTGTAAACTCAGATGGCAGAGGG - Intronic
1041543331 8:59011736-59011758 CATTAAACTCAGAAGAAAGGTGG - Intronic
1041671311 8:60494193-60494215 CTGGGCACTCAGAAGAACCAGGG + Intergenic
1041825258 8:62088376-62088398 CTCTAAACTGAGAAGAGAAAGGG + Intergenic
1042037475 8:64551647-64551669 CTGTATTTTCAGTAGAAACAGGG + Intergenic
1042522233 8:69725827-69725849 CTGAAAATCCAGAGGAAACAAGG - Intronic
1043115113 8:76241265-76241287 TTGTAACCACAGATGAAACATGG - Intergenic
1043424122 8:80131893-80131915 CTGTCAAGTCAGAAGAACTAGGG + Intronic
1043589417 8:81810698-81810720 TTTTAAACTCAGAAGACACTTGG + Intronic
1043646856 8:82532251-82532273 CTAAAAACTCTGAATAAACAAGG - Intergenic
1043932799 8:86109934-86109956 CTGTTATCTCAGGATAAACATGG + Intronic
1044086204 8:87945125-87945147 CTGGAAACACAGAAGAAACTTGG + Intergenic
1044302455 8:90601428-90601450 CTGTCAACTTCAAAGAAACAAGG - Intergenic
1045116557 8:98989321-98989343 ATGGAAAATCAAAAGAAACAGGG - Intergenic
1045629062 8:104095260-104095282 CAGAAAACTAAGAAGAAGCAAGG - Intronic
1045803474 8:106128560-106128582 CTGTTTACTCATAAGAAAAATGG + Intergenic
1046675725 8:117105871-117105893 CTGGAAATGCAGAAGAAATAGGG - Intronic
1047029351 8:120860266-120860288 ATGGAAACACAGAAGAAACCTGG - Intergenic
1047460177 8:125056066-125056088 CTGTTGAATCAGAATAAACATGG + Intronic
1047607532 8:126489862-126489884 CTGCAGACTCAGAAGAGACTTGG - Intergenic
1048361544 8:133701340-133701362 CTGTAAACTCAGAAGTAAAGGGG - Intergenic
1049330619 8:142048541-142048563 CTGTAAACTTATAAGAAATTAGG + Intergenic
1049564422 8:143330901-143330923 GTGTATACTCAGAACACACAGGG + Intronic
1050575562 9:6991493-6991515 CTCTAAACACAGAAAAAATAAGG - Intronic
1050754501 9:8984588-8984610 CTGAGAAGTCAGAAGAAAAATGG - Intronic
1051078121 9:13264800-13264822 CTGTTAACTCACACCAAACATGG + Intronic
1051341079 9:16111253-16111275 CTGTACAGTCACTAGAAACATGG + Intergenic
1052025446 9:23568913-23568935 TTGTAAACTCCAAAGAAAGAGGG + Intergenic
1052680165 9:31680950-31680972 CTCCAAACCCAGAATAAACAGGG + Intergenic
1056202247 9:84288179-84288201 CTGCAATTTCAGAAGAAAGAAGG + Intronic
1056695140 9:88842320-88842342 CTGTAAAGTCAGATGAAAGATGG - Intergenic
1057369708 9:94459407-94459429 CTGTAAACTCGGCAGAAAGTGGG + Exonic
1057665568 9:97042387-97042409 ATGTAAATGCAGAAGAAATATGG + Intergenic
1058747532 9:108006766-108006788 CTGTAAACACAGAGAAATCAAGG - Intergenic
1058934049 9:109751346-109751368 CTGTAAAATCAACAGAAACGGGG - Intronic
1059662568 9:116416473-116416495 TTGGAAACTTAAAAGAAACAGGG + Intergenic
1059737755 9:117119339-117119361 CTGCAAACTCAGAAGCAATTGGG - Intronic
1186373691 X:8973991-8974013 TTCTAAAATCAGAAGAAAAATGG + Intergenic
1186427818 X:9478078-9478100 CTGTAAAATCAGGATAACCATGG + Intronic
1187788084 X:22916122-22916144 ATGTAAAATGAGAATAAACATGG - Intergenic
1188234664 X:27713210-27713232 CAGGAAAATAAGAAGAAACAAGG + Intronic
1189203561 X:39218570-39218592 GTGGAATCTAAGAAGAAACAAGG - Intergenic
1189637102 X:43023057-43023079 CTGTAAAATCAAAAGAAAGTTGG + Intergenic
1191598374 X:62973776-62973798 CTGTAAAATCAAAAGCAACTTGG + Intergenic
1192075296 X:67989108-67989130 CTGAAAACTCAGAAGAGGAATGG + Intergenic
1192127100 X:68511833-68511855 CTGCAAACTGAGAAGAGTCAGGG - Exonic
1193408662 X:81136306-81136328 CTATAAACTCACAAGGAAAAAGG - Intronic
1194810752 X:98384175-98384197 CTGTAAACTCTGTAAGAACAAGG + Intergenic
1195614342 X:106900909-106900931 CTGTGGACAGAGAAGAAACATGG + Intronic
1196392488 X:115223231-115223253 CTATAAACTCAGAATACATAAGG + Intronic
1196645608 X:118115000-118115022 CAGCAATCTCAGAAGAAACCAGG - Intronic
1197002680 X:121456661-121456683 CTGTAAACTCAAAACATACCTGG + Intergenic
1197481987 X:126997753-126997775 CTCTCAAATCAGAAGACACATGG + Intergenic
1198021947 X:132667605-132667627 CTGCAAAGCCAAAAGAAACAAGG + Intronic
1198102691 X:133435875-133435897 CTGTAAACTCATGGGAGACAAGG + Intergenic
1198267230 X:135021406-135021428 CTGCAAATTCAGAAGAGAAATGG + Exonic
1198270311 X:135051058-135051080 CTGCAAATTCAGAAGAAAACAGG + Exonic
1198503984 X:137282609-137282631 CTTTAAACTCTGAAAAAGCAAGG + Intergenic
1199782807 X:151078553-151078575 CTGTTTACTCAGAAGTAAAATGG - Intergenic
1201343750 Y:12960340-12960362 CTGTCACTTCAGAACAAACAAGG + Intergenic
1202028462 Y:20549451-20549473 CTAGAGACTAAGAAGAAACAAGG - Intergenic
1202114988 Y:21463942-21463964 CAGTAAACTGAAAAGAACCACGG + Intergenic