ID: 1098374720

View in Genome Browser
Species Human (GRCh38)
Location 12:69802814-69802836
Sequence TTAGGTGACCATTTGTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098374716_1098374720 24 Left 1098374716 12:69802767-69802789 CCTGTTACGCACGTTACGGTCTC 0: 1
1: 0
2: 1
3: 1
4: 4
Right 1098374720 12:69802814-69802836 TTAGGTGACCATTTGTTGGAGGG 0: 1
1: 0
2: 1
3: 4
4: 123
1098374715_1098374720 25 Left 1098374715 12:69802766-69802788 CCCTGTTACGCACGTTACGGTCT 0: 1
1: 0
2: 0
3: 0
4: 9
Right 1098374720 12:69802814-69802836 TTAGGTGACCATTTGTTGGAGGG 0: 1
1: 0
2: 1
3: 4
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098374720 Original CRISPR TTAGGTGACCATTTGTTGGA GGG Intronic
900585125 1:3428969-3428991 TTAGGTGACCCTTGGCTGGGAGG - Intronic
904884131 1:33723817-33723839 GTAGGTGCCCATCTGTTGAACGG + Intronic
909789426 1:79655877-79655899 TTAGGTGACAATTTTCTGCATGG + Intergenic
912351150 1:109014945-109014967 TTAGGTGACCCTCTTTTTGAAGG - Intronic
912988657 1:114460634-114460656 TCAGGTTACCCTTTGTTGTAAGG - Intronic
914704104 1:150157456-150157478 TTAGGTGTCCCCTTGTTGGGGGG - Exonic
916533681 1:165682452-165682474 TTAGATGAACATGTGTTTGAAGG - Intronic
920000590 1:202796060-202796082 TGAGACCACCATTTGTTGGAGGG - Intronic
920902000 1:210118782-210118804 TTATCTTACCATTTGGTGGATGG + Intronic
1066608442 10:37208471-37208493 TGTGGTCACCATTTGTTGGCTGG + Intronic
1066664106 10:37765331-37765353 TTTGGAGACCATTTGTTTAAAGG - Intergenic
1073385205 10:103121488-103121510 TTAAGTGAACATTTTTTGGATGG - Intronic
1075293766 10:121254166-121254188 TGAGGTCACCAGTTGCTGGAAGG - Intergenic
1085473579 11:76773691-76773713 GCAGGTAAACATTTGTTGGATGG + Intergenic
1085678715 11:78550236-78550258 TCAGGTTACATTTTGTTGGAAGG - Intronic
1086483813 11:87275401-87275423 TTGGGTGACCATATGTTCTAAGG + Intronic
1089039526 11:115433461-115433483 TTATGTGACCATTTCTTTCAGGG + Intronic
1098374720 12:69802814-69802836 TTAGGTGACCATTTGTTGGAGGG + Intronic
1099728895 12:86472122-86472144 TTAGGGCACCAATTGTAGGATGG + Intronic
1102453082 12:113055989-113056011 GTGGGTGAGCATTGGTTGGATGG - Intergenic
1107041344 13:35951217-35951239 TTAAATAAGCATTTGTTGGATGG + Intronic
1107384451 13:39893119-39893141 TTATCTGGCCATTTGATGGAAGG + Intergenic
1109136143 13:58653886-58653908 TTATGTGACCATTTTTCGGGGGG + Intergenic
1112212749 13:97397066-97397088 TAGGGTGACCTTTTGTTGGAAGG - Intergenic
1117587513 14:57225739-57225761 TTAGGTGGGCATGTGTTGGCGGG - Intronic
1117888919 14:60397047-60397069 TAAGGTGAGCATTCATTGGAAGG - Intronic
1119650862 14:76381857-76381879 TTTTGTGTCCTTTTGTTGGATGG - Intronic
1123166711 14:106332058-106332080 TTACGTGACTCTTGGTTGGAAGG - Intergenic
1123169395 14:106357108-106357130 TTACGTGACTCTTGGTTGGAAGG - Intergenic
1128887847 15:71304740-71304762 TTTGGTTACTTTTTGTTGGAAGG - Intronic
1130132524 15:81156122-81156144 TTAGGGTACAATTTCTTGGAGGG - Intergenic
1133681548 16:8124731-8124753 TTAGGTCACCATTGTTTGCATGG - Intergenic
1139781122 16:69352298-69352320 TTAGGTGACCGTTAGGTGAAAGG - Intronic
1143914922 17:10283781-10283803 TTAGGTGACCATCTTTATGATGG - Intergenic
1147989316 17:44323509-44323531 TGAGGCCACCATTTGCTGGAGGG + Exonic
1153005179 18:491655-491677 TGAGGTGACTATTTGGGGGAAGG + Intronic
1153584477 18:6607292-6607314 CTTGGTGACCATTTATTGGGTGG - Intergenic
1160359670 18:78262889-78262911 TTATGTTACCATTTCTTGTAAGG - Intergenic
1165016293 19:32882653-32882675 TTAGGTTACCAGTTGATGCAGGG - Intronic
1165318056 19:35068689-35068711 TGAGGTGACCATGTCCTGGAGGG + Intergenic
1165342301 19:35221692-35221714 TAAGGTGACAATTTGTTCTAAGG + Intergenic
1167603822 19:50469416-50469438 ACAGGTGGCCATTTGTTAGATGG - Intronic
1168003412 19:53467270-53467292 TGAGGTGACCACCTGCTGGATGG - Intergenic
928935473 2:36672342-36672364 TTAGGTGATCATTTGTGTCAAGG + Intergenic
929646066 2:43629418-43629440 TGAGGAGACCTTTTGCTGGATGG + Intergenic
930923105 2:56781926-56781948 TTAGGCGACCGTTGTTTGGATGG + Intergenic
935530597 2:104228522-104228544 TTGTGGGACCATTTGTTTGAAGG - Intergenic
939297686 2:140291012-140291034 TTGTGTGAACATTTGTTGAAAGG + Intronic
939297801 2:140292249-140292271 TTGTGTGAGCATTTGTTGAAAGG + Intronic
945011072 2:205464363-205464385 TAGGGTGGTCATTTGTTGGATGG - Intronic
945673179 2:212826490-212826512 TTGGATGCCCACTTGTTGGAAGG + Intergenic
948117714 2:235505848-235505870 CTGGGAGACCTTTTGTTGGACGG + Intronic
1174133577 20:48362997-48363019 TTAGGTGGCCAGTTGCTGGGTGG + Intergenic
1174440694 20:50550266-50550288 TTAGATAACCATTTGTAGAATGG + Intronic
1174529908 20:51203210-51203232 TTCGGTAAGCATGTGTTGGATGG + Intergenic
1174690066 20:52495247-52495269 CTTGATGACCATATGTTGGATGG + Intergenic
1175163798 20:57028997-57029019 TGAGGTGAGCACTTGTGGGATGG - Intergenic
1175484416 20:59334952-59334974 GGAGGAGACCATTTGTTGAAAGG + Intergenic
1176969424 21:15248677-15248699 TTCAATGAGCATTTGTTGGATGG - Intergenic
1181150953 22:20883212-20883234 TTAGGTGACCCTTAATTTGAGGG + Intronic
1184946142 22:47805482-47805504 TTAGGTGACTGGTTGTTGCATGG + Intergenic
949810849 3:8004527-8004549 TTAGTTGAACACTTCTTGGATGG - Intergenic
951779351 3:26345941-26345963 GTAGGTGAGCACGTGTTGGAGGG + Intergenic
952009750 3:28886931-28886953 TTTGGTGACCATTTGCCAGAAGG - Intergenic
956095426 3:65711098-65711120 TTTGGTGACTAGTTGTTGAATGG - Intronic
956138639 3:66123846-66123868 TTAGGTCACCTTTTGTTACAGGG + Intergenic
957833655 3:85555704-85555726 TTAGGTTGCCATTTGTTCCAAGG + Intronic
958858648 3:99418565-99418587 ATAGATGACCATTTGGTGGTGGG - Intergenic
959343164 3:105157289-105157311 TTAGTTGACAATTTGTTGAGAGG - Intergenic
959408920 3:105996803-105996825 TGAGGTCATGATTTGTTGGACGG + Intergenic
960742289 3:120847938-120847960 TTAGATGAGCATTTATTGGCAGG + Intergenic
960900376 3:122548726-122548748 TTTGGGGTCCATGTGTTGGAGGG - Intronic
963355474 3:144205532-144205554 TTAGGTGACCATACATTGAAGGG - Intergenic
964443635 3:156738134-156738156 TTAGGTCACTATATTTTGGAGGG + Intergenic
965064192 3:163824720-163824742 TGAAGAGATCATTTGTTGGATGG - Intergenic
966678835 3:182618872-182618894 TTAGATGACAACTTGTTAGAGGG - Intergenic
970876120 4:20872085-20872107 TTAGGTGAGCAGATGTTAGAAGG - Intronic
970944020 4:21669148-21669170 CTAGGTGACCCTGTCTTGGAAGG - Intronic
977113681 4:92993781-92993803 TCAGGTAGACATTTGTTGGAGGG + Intronic
980203412 4:129685555-129685577 ACAGATGACCATATGTTGGAAGG - Intergenic
981941791 4:150288813-150288835 TTAAGTTACCATTTCATGGATGG + Intronic
982570365 4:157043058-157043080 TTTGTTAACCAGTTGTTGGAGGG + Intergenic
985367279 4:189245233-189245255 TGAGGGGCCCATTTGTTAGAAGG - Intergenic
985768400 5:1794145-1794167 CTTGGTTACCATTTGTTGCAGGG + Intergenic
988382905 5:30522137-30522159 GTAGGTGACAATTTCTTAGATGG - Intergenic
989140648 5:38198250-38198272 TTATGTGACCATGTGTCTGATGG + Intergenic
990397153 5:55393997-55394019 TTAGTTGACCATTTCTTGGATGG + Intronic
990550779 5:56876154-56876176 TTAGATAATTATTTGTTGGAGGG + Intronic
992369797 5:76131083-76131105 CTCTGTTACCATTTGTTGGAAGG + Intronic
992881347 5:81113575-81113597 AGAGGTGAACATTTGGTGGATGG + Exonic
994725591 5:103431651-103431673 TCAGGTGATCATTTGGGGGATGG - Intergenic
998026998 5:138826149-138826171 TTAGCTGATCATTTTTTGTAAGG - Intronic
999994126 5:157075692-157075714 TTAGGAAGCCATTTCTTGGATGG + Intergenic
1001181881 5:169527842-169527864 TTAGGAGAGAAATTGTTGGAAGG - Intergenic
1007138381 6:39545495-39545517 CTAGTTGACCAGTTCTTGGAAGG - Intronic
1008328655 6:50218584-50218606 TTATGTGACAATTTTTTGCATGG - Intergenic
1009824613 6:68850479-68850501 TTAGGTGACACTTTGTGGGAGGG + Intronic
1009827132 6:68881001-68881023 TTAAGTGGTCATTTGTTGGTTGG + Intronic
1010891211 6:81313067-81313089 TAAGGAGACAATTTGTTGGGTGG - Intergenic
1016627961 6:146194791-146194813 TAAGGTTATCAATTGTTGGAGGG + Intronic
1017383087 6:153852614-153852636 TTAGGTGACCTTGTGTCTGACGG + Intergenic
1018384507 6:163290781-163290803 TTAAGTGACCATTGTGTGGAAGG - Intronic
1018781136 6:167066620-167066642 TTCTGTGACCAAATGTTGGAGGG - Intergenic
1019715402 7:2536514-2536536 GGAGGTGCCCTTTTGTTGGAGGG + Intergenic
1019741416 7:2676626-2676648 GGAGGTGCCCTTTTGTTGGAGGG - Intergenic
1021106104 7:16641475-16641497 TATGGTTACCATTAGTTGGATGG - Intronic
1021457645 7:20846961-20846983 TTAGCTTGCCATTTGTTGGCTGG + Intergenic
1024358163 7:48439277-48439299 TGAGGTGCCCATTTTTTGGCTGG + Intronic
1026504759 7:70973062-70973084 TTAGTTGCCCATTTGCTGGAGGG + Intergenic
1030775446 7:113529500-113529522 TTTGGTGTTTATTTGTTGGAGGG - Intergenic
1032902652 7:136327775-136327797 ATATATGACCATTTGTTGGCTGG - Intergenic
1033434785 7:141322987-141323009 TTATGTGCCCTTTTGTTGTAAGG + Intronic
1039440019 8:37588567-37588589 ATAGGTGACCATGGCTTGGATGG + Intergenic
1039835792 8:41255363-41255385 TTCGGTGACTTTTTGTTGGGAGG - Intergenic
1041569967 8:59326572-59326594 TTAGGTGTACTTTTGCTGGAGGG + Intergenic
1042168254 8:65967585-65967607 TTAAGTTACCATTTGTCAGACGG - Intergenic
1044574019 8:93749215-93749237 ATAGGTGACCATTTCTTCTATGG + Intergenic
1046096606 8:109570046-109570068 TTAGAAGACCTTTTGTTAGAAGG - Intergenic
1046818578 8:118612063-118612085 TTAGTTGACCGTTTCTTGTATGG - Intronic
1047109333 8:121771533-121771555 TTTGATGACCTTTTCTTGGAAGG + Intergenic
1047788103 8:128174133-128174155 TTAGGTGCCTATTTGGTGTAAGG - Intergenic
1058834918 9:108852427-108852449 GGAGATGACCATGTGTTGGAGGG + Intergenic
1058929789 9:109707845-109707867 TTATGAGATCATTTATTGGATGG - Intronic
1060164743 9:121401987-121402009 TTTGGTGACTATTTTTTAGAGGG - Intergenic
1061715695 9:132517562-132517584 TTAGGTACACATTTGTTGAAAGG - Intronic
1186713424 X:12225226-12225248 TTAAGTAAACATTTGATGGAAGG + Intronic
1196230382 X:113214791-113214813 TTCAGTGGCCAATTGTTGGATGG + Intergenic
1197371873 X:125636529-125636551 CTAGGTGACAATATGTTGCAGGG - Intergenic
1199425598 X:147697582-147697604 ATAGCTGACCATTTCTTTGAGGG + Intergenic