ID: 1098376349

View in Genome Browser
Species Human (GRCh38)
Location 12:69819703-69819725
Sequence CTAAAGAAGAGGAGGACTCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098376345_1098376349 -8 Left 1098376345 12:69819688-69819710 CCAAGATTACCAATTCTAAAGAA 0: 1
1: 0
2: 3
3: 16
4: 254
Right 1098376349 12:69819703-69819725 CTAAAGAAGAGGAGGACTCTTGG 0: 1
1: 0
2: 3
3: 14
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098376349 Original CRISPR CTAAAGAAGAGGAGGACTCT TGG Exonic
901980508 1:13030441-13030463 CTGAAGGAGATGAAGACTCTTGG + Intronic
902001580 1:13198490-13198512 CTGAAGGAGATGAAGACTCTTGG - Intergenic
908144892 1:61230467-61230489 CTAATGAAAAGGTGGACTCGGGG - Intronic
908578227 1:65484602-65484624 CGAAGGTACAGGAGGACTCTGGG + Intronic
910103773 1:83608038-83608060 ATAAAGAAAAGAAAGACTCTTGG + Intergenic
911100415 1:94091414-94091436 CAAAAGAAGAGGAGAGCCCTGGG - Intronic
912272488 1:108225376-108225398 CTAAAGACGAGAAGGACCCCTGG - Intronic
912295733 1:108468946-108468968 CTAAAGATGAGAAGGACCCCTGG + Intronic
912951176 1:114121480-114121502 CTAAGCAACAGGAGGACCCTGGG + Intronic
916196956 1:162233406-162233428 CTCAAGTAAAGGAGGACACTTGG - Intronic
916505284 1:165423052-165423074 CTCATGAAGAGGAGGAGTGTTGG - Intronic
922724848 1:227918055-227918077 CTGAGGAAGAGGAGGACCGTTGG - Intergenic
922724868 1:227918122-227918144 CTGAAGAAGAGGAGGACCTGGGG - Intergenic
922724941 1:227918326-227918348 CTGGAGAGGAGGAGGACCCTGGG - Intergenic
924388543 1:243524863-243524885 CTAAAGAGGAGGTGGGCACTAGG + Intronic
924583814 1:245344602-245344624 CTGAAGCAGAGAAGGACTCCAGG - Intronic
924593002 1:245421296-245421318 TTGGAGAAGAGAAGGACTCTGGG + Intronic
924709916 1:246523285-246523307 AGAAAGAACAGGAGAACTCTGGG + Intergenic
1063236730 10:4124994-4125016 CTAAAGACCAGCAGGACTCAAGG + Intergenic
1065739751 10:28786430-28786452 CTAAAGGAGATGCGGGCTCTGGG - Intergenic
1067044410 10:42976232-42976254 CTAAAGCACAGGAGAACTCCAGG + Intergenic
1067324712 10:45256461-45256483 CTAAAAAAGAGTAGGAGTATTGG + Intergenic
1067697940 10:48548896-48548918 CTGAGGAAGAGCAGGGCTCTGGG + Intronic
1067828663 10:49597510-49597532 TTAATGCAGAGGAGGTCTCTGGG - Intergenic
1070819089 10:79344385-79344407 CCAAACTAGATGAGGACTCTGGG - Intergenic
1071123541 10:82308639-82308661 CTAAAAAACAGGAGGAATATTGG - Intronic
1072924543 10:99605060-99605082 CTACAGAACAGCAGGACTTTTGG + Intergenic
1074036393 10:109743230-109743252 CTAAAGATGAGGAAGACTCTGGG + Intergenic
1077296375 11:1828180-1828202 CTAGAGAAGAGGGGGGCTCGAGG + Intergenic
1079363381 11:19788389-19788411 ATGCAGAAGAGGAGGACTCAAGG - Intronic
1080583181 11:33659969-33659991 GGGAAGCAGAGGAGGACTCTGGG - Intronic
1080819977 11:35796506-35796528 CAAAAGAAGATGAGGAAACTGGG + Intronic
1081905219 11:46664966-46664988 TTAAAGATGGGGAGGACTATGGG + Intronic
1084702502 11:70796499-70796521 CTCAGGAAGAGGAGGACTGGAGG + Intronic
1084941802 11:72617074-72617096 CCAAAGACAAGCAGGACTCTGGG - Intronic
1086107264 11:83158528-83158550 CCACAGAAGAGGAGGACTACAGG - Intronic
1087111654 11:94476318-94476340 CAAAGGAAGATGAGAACTCTTGG - Exonic
1090997525 11:131880350-131880372 CTAGAGAAGGAGAGGACTCAAGG + Intronic
1091877409 12:3947316-3947338 GGAAAGAAGAGGAGTATTCTAGG - Intergenic
1093087315 12:14880680-14880702 CTAAAGGAGAGGAGGAGTGAGGG + Intronic
1096059979 12:48689129-48689151 GAAAAAAAGAGAAGGACTCTTGG - Exonic
1096232884 12:49906466-49906488 CTACAGAAGAGGAGGAGTTTGGG + Intergenic
1096687111 12:53295530-53295552 TTAACGAAGAGGAAGTCTCTCGG - Exonic
1097935129 12:65239977-65239999 CAAAAGAAGAGGAGGAAACAAGG + Exonic
1098376349 12:69819703-69819725 CTAAAGAAGAGGAGGACTCTTGG + Exonic
1101529378 12:105560162-105560184 CTGAAAAATAGAAGGACTCTAGG + Intergenic
1102808717 12:115805127-115805149 CTAAGGAAGAAGGGGAGTCTAGG - Intergenic
1103360781 12:120352355-120352377 CACAAGAAGAAGAGGATTCTGGG - Intronic
1104300807 12:127563260-127563282 CTACAGCAGAGGAGCACCCTGGG + Intergenic
1106168131 13:27266913-27266935 GTGAACAAGAGGAGGACCCTTGG + Intergenic
1108642442 13:52395371-52395393 GTAAAGAAGAGGAAGACTTCTGG + Intronic
1108862244 13:54875788-54875810 CTTAAGAAGATGAGGACAATTGG + Intergenic
1124026745 15:25973891-25973913 ATAAAGAAGAGCAGGACCTTTGG + Intergenic
1124349682 15:28945899-28945921 GTGATGAGGAGGAGGACTCTGGG + Intronic
1125842985 15:42822933-42822955 AGAAAGAAGAGAATGACTCTAGG + Intronic
1126138242 15:45413215-45413237 TCCAACAAGAGGAGGACTCTGGG - Intronic
1126395044 15:48205931-48205953 CTAAACAATAGGAGGTCACTAGG + Intronic
1126675639 15:51157591-51157613 CTCAAGGAGAGGTGGAATCTTGG - Intergenic
1126890436 15:53198804-53198826 CTCAACAAGATGAGCACTCTGGG + Intergenic
1129526471 15:76219060-76219082 CTAAAGAAGAAAAGGATTCTAGG + Intronic
1129896049 15:79106691-79106713 CTAAAGATGAGGAGGTCCCCAGG - Intergenic
1132382612 15:101377020-101377042 CCAAAGAAAACGAGGGCTCTTGG + Intronic
1133140548 16:3740715-3740737 ATAAAGGAAAGGTGGACTCTGGG + Intronic
1133671716 16:8028646-8028668 AGAAATAAGAGGAGGACTCTAGG + Intergenic
1133673283 16:8045241-8045263 CTAAAGAAGAGGTAGATTATGGG - Intergenic
1135797763 16:25461801-25461823 CCAAAGAGGATGAGGACACTTGG - Intergenic
1135968936 16:27058299-27058321 ATCAAGAACAGGAGGACTCTTGG - Intergenic
1139271301 16:65685820-65685842 TTAAAGAAGAGGAGAAGGCTTGG - Intergenic
1139273207 16:65702817-65702839 CAAAGGAAGATGAGGTCTCTAGG + Intergenic
1141990171 16:87604783-87604805 CCGAAGAGGAGGAGGAGTCTGGG + Intronic
1146419457 17:32669476-32669498 CTAAAGAAGTGGTAGACTCAGGG - Intronic
1146503067 17:33381004-33381026 TTAAAGAAGAGCTGGAATCTCGG + Intronic
1147383393 17:40068758-40068780 CTAAAGAAGAGATCGGCTCTTGG + Intronic
1150425438 17:65073643-65073665 CAAAAGAAGAGGAAGAGGCTGGG + Intergenic
1151297104 17:73193480-73193502 CTAAGGAAGGTGAGGACTCGCGG - Intronic
1152648179 17:81479900-81479922 CTCAGGAGGGGGAGGACTCTTGG - Intergenic
1152779257 17:82219176-82219198 CTGCAGAAGAGGAGGACACCCGG + Intergenic
1156999728 18:43510146-43510168 TTTATGAAGAGGAGGAATCTTGG + Intergenic
1157024748 18:43829414-43829436 CAAAAGAAAAGGAGGACCCTAGG + Intergenic
1157453625 18:47806911-47806933 GTAAAGAAAAGGAGGAGTCAAGG - Intergenic
1159624094 18:70671460-70671482 CTATAAAAGAGGAGGATTCATGG - Intergenic
1163708728 19:18832721-18832743 CGAACGAAGTGGAGGACTCGAGG - Intronic
1164438733 19:28255029-28255051 CTGGAGAAAAGGAGGACTCTTGG - Intergenic
925767968 2:7255681-7255703 CTGAAGAAAATGCGGACTCTTGG - Intergenic
928451994 2:31385815-31385837 GTAAAGAAGAGGAGAGCTCCAGG - Intronic
932288491 2:70555346-70555368 CTACAGAAGGGGAGGAATCAGGG + Intergenic
932760969 2:74439188-74439210 CTAGAGAAGAGAAGGACTCTGGG - Intronic
933168736 2:79101357-79101379 CTCAAGAAGAGGAGAGCTATAGG - Intergenic
938368503 2:130754896-130754918 TTTAACAAGAGGAGGACTGTGGG + Intergenic
943718509 2:191178527-191178549 CTAAAGAAGAGGAGGAAAGAAGG - Intergenic
945268296 2:207913130-207913152 CTAAGGAAGAGGAGTTGTCTTGG + Intronic
948087469 2:235263529-235263551 GTAAAGGAGAGGAGGACTATGGG - Intergenic
1170556715 20:17520717-17520739 GGAAGGAAGAGGAGGAGTCTGGG - Intronic
1170879545 20:20283996-20284018 TTAAGGAAGAGGTGGAATCTTGG + Intronic
1170919773 20:20666889-20666911 CAAAAGAAGAGGAGGAGGCAGGG + Intronic
1173018521 20:39248127-39248149 CAATAGAAGAGGAGGGCACTTGG + Intergenic
1173451652 20:43169700-43169722 CTAGAGAAGAGGAGGGATATTGG - Intronic
1175726673 20:61323205-61323227 CTAACGAAGAGAAGTCCTCTAGG - Intronic
1179246325 21:39637168-39637190 CTAAAACAGAGGAGCACTGTTGG + Intronic
1182221490 22:28762256-28762278 GTAAATAAGATGAGGACGCTGGG - Intergenic
1183228919 22:36568814-36568836 CTGAAGAAGGGCAGGGCTCTTGG + Intronic
1183525365 22:38319395-38319417 CTGAAGAAGAGGAGGGCTTTGGG - Intronic
1183774321 22:39953392-39953414 CTAAGGGAGAGGAGGACTCTGGG - Intronic
1184986258 22:48137698-48137720 CTGAAGACAAGGAGAACTCTCGG - Intergenic
950609083 3:14113484-14113506 CCAAAGAAGAGGAGATCACTTGG + Intronic
951664116 3:25103030-25103052 CTAGAGAAGAGGACTCCTCTAGG + Intergenic
952153456 3:30617986-30618008 ATAAAGAAGAGGAGAATTCAAGG + Intronic
952159467 3:30679288-30679310 TAAAGGAAGAGGAAGACTCTGGG + Intronic
952728480 3:36614767-36614789 CTAAAGATGACAAGGACTTTTGG - Intergenic
953037275 3:39224072-39224094 CTAAAGGAAAGGAGAGCTCTTGG - Intergenic
954314019 3:49791420-49791442 CTTAGGAAGAGGGGGACTCACGG + Exonic
957863364 3:85989407-85989429 CTCAAGAAAACGAGGACACTGGG + Intronic
958798307 3:98730058-98730080 ACAAAGAAGGAGAGGACTCTTGG - Intergenic
959324874 3:104924448-104924470 GAAAAGAAGAGAATGACTCTAGG + Intergenic
962565280 3:136651741-136651763 CTCAAGAAGGGGAGGAAACTTGG + Intronic
964382685 3:156113571-156113593 CAAAAGAAGATGAGAACTCTTGG - Intronic
968568074 4:1325557-1325579 CTCTAGAAGAGCAGGACTCTGGG - Intronic
969907864 4:10414166-10414188 CTAAAGAACAGTAGGACTGGTGG - Intergenic
971009599 4:22418783-22418805 CTGCAGAACAGGAGGCCTCTGGG - Intronic
971449707 4:26788341-26788363 ATTAAGAAGAGGTGGATTCTAGG - Intergenic
976140225 4:81983815-81983837 CTAAAAGAGAGGAGGCCTTTTGG + Intronic
977286545 4:95114743-95114765 TGATAGAAGAGGATGACTCTGGG + Exonic
978676834 4:111328150-111328172 ATAAATAACAGGAGGAATCTTGG + Intergenic
979903521 4:126254485-126254507 AGAAAGAAGAGGAGGAATGTGGG - Intergenic
982463745 4:155704526-155704548 CTTAAGAGGAGGGGGACTCAGGG + Intronic
982499015 4:156130688-156130710 CTAGAGAAGAGGCTGAATCTAGG + Intergenic
982951232 4:161698631-161698653 CTAAAGAAGAGGAGAAGGCCAGG + Intronic
986612202 5:9580455-9580477 TCAAAGAAGAGGAGGACACAGGG - Intergenic
992577287 5:78127978-78128000 CCAAAGCAGTGGAAGACTCTAGG - Intronic
993308065 5:86294612-86294634 CTAAAGATGAGAAGGACCCCTGG + Intergenic
996333762 5:122360746-122360768 TTGTAGAAGAGGAGAACTCTGGG + Intronic
998566997 5:143224785-143224807 CAAAAGAAGAGGAAGACTCCAGG + Exonic
999209114 5:149872389-149872411 ATAATGAAGATGAGGACACTGGG - Intronic
1001600834 5:172927045-172927067 CTAAGGAGGGCGAGGACTCTAGG - Intronic
1001765393 5:174241952-174241974 CTCAAGAAGAGGAGCATTCCCGG + Intronic
1003347947 6:5288041-5288063 ATAAATATGAGGAGGGCTCTGGG - Intronic
1004792643 6:19044474-19044496 CTATAGCAGAGAAGGACTTTGGG - Intergenic
1005709075 6:28486138-28486160 CTAAAGAAGTGGAATACCCTAGG + Intergenic
1007235931 6:40391567-40391589 TGAATGAAGAGGAGGAGTCTGGG + Exonic
1007635576 6:43297970-43297992 CCTAAGAAGAGGAGGCCCCTGGG - Intronic
1008413691 6:51214371-51214393 CTAAAGAACAGGAGAAAGCTGGG - Intergenic
1012457519 6:99423982-99424004 TTAAAGAAGATGAGGTCACTAGG - Intronic
1013189087 6:107786711-107786733 CTAAGGAATAGGAGGAGTCCTGG - Intronic
1013727172 6:113113363-113113385 TTAAGGAAGAGCAGGAGTCTAGG + Intergenic
1014914447 6:127129031-127129053 CTAAAAACAAGGAGGACTCTAGG - Intronic
1015947919 6:138521931-138521953 AGAAAGAAGAGGAGGAGCCTTGG + Intronic
1019600414 7:1880495-1880517 CTCAAGGAGGGGAGGACTTTGGG - Intronic
1024382721 7:48717549-48717571 CTAAAGGAGAGGAAGACTAGAGG - Intergenic
1029090794 7:98046510-98046532 AAAAAGAAGAGGAGGACTGAGGG + Intergenic
1031802565 7:126266689-126266711 ATAAATAACAGGAGGACTCTTGG + Intergenic
1032780355 7:135160912-135160934 AGAAAGTAGAGTAGGACTCTAGG + Intronic
1033417919 7:141180569-141180591 CTAAAGGAAGGGAGGCCTCTGGG - Intronic
1035200416 7:157260521-157260543 CTAAAGAGCAGGAGGACTGCAGG + Intronic
1035349161 7:158232636-158232658 CAAAAAAAAAGGAGGACTATAGG + Intronic
1036137630 8:6176268-6176290 CTACAGCAGAGGTGGAGTCTGGG + Intergenic
1038481041 8:27902002-27902024 CACAACATGAGGAGGACTCTGGG - Intronic
1039976226 8:42367489-42367511 CTAATGAAGATGAGAGCTCTAGG + Intronic
1044293138 8:90496176-90496198 CTAACAAAGAGGAGGAATTTGGG - Intergenic
1044617173 8:94154613-94154635 CTGAAGAGGGGGAGTACTCTTGG - Intronic
1044860065 8:96514572-96514594 CTAATGTACAGAAGGACTCTAGG + Intronic
1046097111 8:109575280-109575302 CTAAGGCAGAGAGGGACTCTGGG + Exonic
1046426201 8:114053324-114053346 CTAAAGCAGAGCATGACTATAGG - Intergenic
1047478276 8:125256627-125256649 TTAAAAAAGAAGAGGACTGTTGG + Intronic
1048172843 8:132124137-132124159 ATAAAGAACAGAAGGAATCTTGG - Exonic
1050020600 9:1280315-1280337 CTAAAGTAGAGGGGGGATCTTGG + Intergenic
1052193238 9:25682389-25682411 CAAAAGAATGTGAGGACTCTTGG - Intergenic
1053517415 9:38742830-38742852 CTAAAGAAGAGGAGAGGTCGTGG + Intergenic
1055000918 9:71447656-71447678 GTAAGGCAGAGGAGGATTCTTGG + Intergenic
1055495127 9:76846581-76846603 CGAGAGAAGAGGAAGACTCTCGG + Exonic
1057744793 9:97742270-97742292 CTAAAGAGGAGTAAGACACTGGG - Intergenic
1058596659 9:106622452-106622474 CAAAAGGAGAGAAGGAATCTAGG - Intergenic
1058903266 9:109460210-109460232 CGAAAGAACAGGAGGCCTCAAGG - Intronic
1060134997 9:121144973-121144995 CTGAGAAAGAGGAGGTCTCTGGG - Intronic
1060485058 9:124041402-124041424 CTAAGGGAGAAGAGGACCCTGGG - Intergenic
1060737315 9:126074274-126074296 CCAGACAAGAGGAGGAGTCTAGG + Intergenic
1060756558 9:126218482-126218504 CCCCAGAAGAGGAGGGCTCTCGG + Intergenic
1061987852 9:134140482-134140504 CTACAGAAGAGGAGGTCTTGTGG + Intronic
1062311589 9:135940863-135940885 CCAAAGATGGAGAGGACTCTGGG - Intronic
1062694082 9:137863861-137863883 CTAAAGTAGAGGAAGCCTCAGGG - Intronic
1185527321 X:789979-790001 CCAGAGATGAGGAGGATTCTAGG + Intergenic
1186163674 X:6804666-6804688 TTAAAGAAGAGGATCTCTCTGGG - Intergenic
1191955436 X:66638662-66638684 ATAAAGAAGAGAAGGAGGCTGGG - Intronic
1194664986 X:96667442-96667464 CTAAAGAAAAGAAAGACGCTGGG + Intergenic
1196888143 X:120266655-120266677 TAAAAGTAGAGGAGGCCTCTTGG + Intronic
1198647987 X:138830256-138830278 CAAAAGAAGAGGAGAGCTATAGG + Intronic