ID: 1098378594

View in Genome Browser
Species Human (GRCh38)
Location 12:69844242-69844264
Sequence GCTCTAGGACCTGCCTGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 173}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098378594_1098378601 6 Left 1098378594 12:69844242-69844264 CCACATCAGGCAGGTCCTAGAGC 0: 1
1: 0
2: 0
3: 11
4: 173
Right 1098378601 12:69844271-69844293 CCATCTCCTATTTCTACCTGGGG 0: 1
1: 2
2: 8
3: 228
4: 3244
1098378594_1098378606 18 Left 1098378594 12:69844242-69844264 CCACATCAGGCAGGTCCTAGAGC 0: 1
1: 0
2: 0
3: 11
4: 173
Right 1098378606 12:69844283-69844305 TCTACCTGGGGGAGCAGGTTGGG 0: 1
1: 0
2: 0
3: 19
4: 231
1098378594_1098378610 26 Left 1098378594 12:69844242-69844264 CCACATCAGGCAGGTCCTAGAGC 0: 1
1: 0
2: 0
3: 11
4: 173
Right 1098378610 12:69844291-69844313 GGGGAGCAGGTTGGGGCCGGTGG 0: 1
1: 0
2: 3
3: 72
4: 760
1098378594_1098378604 13 Left 1098378594 12:69844242-69844264 CCACATCAGGCAGGTCCTAGAGC 0: 1
1: 0
2: 0
3: 11
4: 173
Right 1098378604 12:69844278-69844300 CTATTTCTACCTGGGGGAGCAGG 0: 1
1: 1
2: 0
3: 12
4: 156
1098378594_1098378602 7 Left 1098378594 12:69844242-69844264 CCACATCAGGCAGGTCCTAGAGC 0: 1
1: 0
2: 0
3: 11
4: 173
Right 1098378602 12:69844272-69844294 CATCTCCTATTTCTACCTGGGGG 0: 1
1: 0
2: 4
3: 12
4: 152
1098378594_1098378599 5 Left 1098378594 12:69844242-69844264 CCACATCAGGCAGGTCCTAGAGC 0: 1
1: 0
2: 0
3: 11
4: 173
Right 1098378599 12:69844270-69844292 CCCATCTCCTATTTCTACCTGGG 0: 1
1: 1
2: 4
3: 9
4: 175
1098378594_1098378597 4 Left 1098378594 12:69844242-69844264 CCACATCAGGCAGGTCCTAGAGC 0: 1
1: 0
2: 0
3: 11
4: 173
Right 1098378597 12:69844269-69844291 GCCCATCTCCTATTTCTACCTGG 0: 1
1: 0
2: 2
3: 14
4: 101
1098378594_1098378607 19 Left 1098378594 12:69844242-69844264 CCACATCAGGCAGGTCCTAGAGC 0: 1
1: 0
2: 0
3: 11
4: 173
Right 1098378607 12:69844284-69844306 CTACCTGGGGGAGCAGGTTGGGG 0: 1
1: 0
2: 1
3: 23
4: 312
1098378594_1098378605 17 Left 1098378594 12:69844242-69844264 CCACATCAGGCAGGTCCTAGAGC 0: 1
1: 0
2: 0
3: 11
4: 173
Right 1098378605 12:69844282-69844304 TTCTACCTGGGGGAGCAGGTTGG 0: 1
1: 0
2: 0
3: 19
4: 230
1098378594_1098378609 23 Left 1098378594 12:69844242-69844264 CCACATCAGGCAGGTCCTAGAGC 0: 1
1: 0
2: 0
3: 11
4: 173
Right 1098378609 12:69844288-69844310 CTGGGGGAGCAGGTTGGGGCCGG 0: 1
1: 3
2: 9
3: 87
4: 854
1098378594_1098378611 27 Left 1098378594 12:69844242-69844264 CCACATCAGGCAGGTCCTAGAGC 0: 1
1: 0
2: 0
3: 11
4: 173
Right 1098378611 12:69844292-69844314 GGGAGCAGGTTGGGGCCGGTGGG 0: 1
1: 0
2: 0
3: 33
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098378594 Original CRISPR GCTCTAGGACCTGCCTGATG TGG (reversed) Intronic
901649642 1:10736262-10736284 TCTCTAGGACCTGAGTGATGGGG - Intronic
903767243 1:25742656-25742678 ACACTAGGACCTGCCTCATAAGG - Intronic
904800299 1:33087842-33087864 GCTATAAGAAGTGCCTGATGAGG - Intronic
906213255 1:44024079-44024101 GCTCTCTGACCTGCTAGATGAGG + Intronic
906293417 1:44634578-44634600 ACTCTGGGACCAGACTGATGGGG - Intronic
907851966 1:58263564-58263586 GGTCTAGCAACTGCCTTATGAGG - Intronic
914702427 1:150147471-150147493 GCTCTGGCACCTATCTGATGAGG + Intergenic
916584299 1:166136834-166136856 GGTCTAGAAGATGCCTGATGGGG + Intronic
918590381 1:186234514-186234536 GCTCTCTGACCTTCCTGATGTGG + Intergenic
918826454 1:189330727-189330749 GGTCAAGGACCTGCTTGAGGAGG + Intergenic
921864413 1:220072942-220072964 GCTTTAGGATCTGCCTTCTGAGG - Exonic
923192337 1:231631411-231631433 CCTGAAGGACCTGCCTGAGGCGG - Intronic
1063191625 10:3700050-3700072 GCTCTTGGAGACGCCTGATGAGG - Intergenic
1063466100 10:6245817-6245839 GCACTCAGACCAGCCTGATGTGG + Intergenic
1064867355 10:19895981-19896003 GCTCCAGGACCTTCCTGGAGTGG - Intronic
1064898212 10:20262844-20262866 CCTGGAGGACCTGCCTGGTGAGG - Intronic
1067805002 10:49386233-49386255 GCTCTAGGACCAGCCCTCTGTGG + Intronic
1069022156 10:63501124-63501146 GCTCTTGAACCTGCCAGACGCGG + Intergenic
1069592508 10:69650801-69650823 GCCCTAGGACAGGCCTGATGAGG + Intergenic
1073097504 10:100988699-100988721 TCTCTGGGAGCTGCCTGATCAGG + Exonic
1073989163 10:109243569-109243591 GCACCAGGCCCTGCCTGATCTGG + Intergenic
1075498097 10:122945438-122945460 CCTGAAGGACCTGCCTGAGGTGG - Intronic
1075705572 10:124498167-124498189 GCTCCAGGGCCTCCCTGACGGGG - Intronic
1080590008 11:33714911-33714933 CCTGAAGGACCTGCCTGCTGAGG + Intronic
1080671568 11:34384120-34384142 CCTCTTGGGCCTGGCTGATGGGG + Intergenic
1083727456 11:64636050-64636072 GCTCCAGGACCTTCCTGCTTTGG - Intronic
1084009694 11:66340657-66340679 GCCAGAGGACCTGCCTGTTGGGG - Intronic
1084191699 11:67502349-67502371 GACCTATTACCTGCCTGATGGGG - Exonic
1085522511 11:77146737-77146759 GCCCCAGGACCTGCCTTCTGGGG - Intronic
1086569155 11:88263021-88263043 CCTGGAGGACCTGCCTGGTGAGG + Intergenic
1090768279 11:129895659-129895681 GCTCCAGGACCCGCCCGCTGTGG - Intergenic
1091074880 11:132606304-132606326 GCCCCAGGAACTGCCTGCTGGGG + Intronic
1091457703 12:620076-620098 GCTTTAGGGCTTGCCTGATCTGG - Intronic
1097156035 12:57013079-57013101 GCTCTAGCAGGTGCCTGATTTGG + Intronic
1098378594 12:69844242-69844264 GCTCTAGGACCTGCCTGATGTGG - Intronic
1098601476 12:72336513-72336535 GCTCTAGGACCTGTTTCTTGGGG - Intronic
1099719488 12:86342315-86342337 CCTGGAGGACCTGCCTGCTGAGG - Intronic
1102278465 12:111599762-111599784 CCTCTGGGGCCTGCCTGGTGTGG + Intergenic
1103737877 12:123071880-123071902 GCTCTAGGACCTTCCTAAGCTGG - Intronic
1104305186 12:127603711-127603733 GCTCTGGGGCCTCCCTTATGAGG - Intergenic
1104749065 12:131227041-131227063 CTTCTAGGACCTGCCTGAGCTGG - Intergenic
1104848969 12:131862079-131862101 GAGCTAGGACTTGCATGATGGGG + Intergenic
1105000152 12:132685737-132685759 TCTCTAGGGCTTGCCTGATATGG + Intronic
1106642199 13:31596566-31596588 GACCAAGGACCTGCCTGATATGG + Intergenic
1109804019 13:67413972-67413994 GCTCTGGGACCTTTCTTATGAGG + Intergenic
1110540999 13:76706931-76706953 GCTCTAGGACTTTGCTGCTGTGG - Intergenic
1110809957 13:79801555-79801577 CCTCTAGGACCTGCCCACTGGGG + Intergenic
1110918373 13:81052154-81052176 TCTCTAGTTCCTGCCTGATCAGG + Intergenic
1111683673 13:91475622-91475644 GCTCCAGGGCCTGGCTGGTGGGG + Intronic
1113882466 13:113635372-113635394 GCCTTAGGACCTGCCAGGTGGGG + Intronic
1115448938 14:33523969-33523991 GCACTAGGATCTGCTTTATGGGG - Intronic
1118380655 14:65214895-65214917 TCTCCACCACCTGCCTGATGGGG - Intergenic
1121330218 14:93044967-93044989 GCTCTAGGATCTGTCAGATCAGG + Intronic
1122325941 14:100880735-100880757 GCTAGAAGAGCTGCCTGATGAGG - Exonic
1122343300 14:101042853-101042875 GCTCCAGGGCCAGCCAGATGAGG + Intergenic
1122965037 14:105119489-105119511 GCTCTCGGCCCTGCCTGTTCAGG - Intergenic
1122985642 14:105210453-105210475 GCGCTGGGGCCTGCCTGCTGCGG + Exonic
1202869047 14_GL000225v1_random:142604-142626 TCTCTAGGATCTGCCTAAAGGGG + Intergenic
1123754529 15:23386597-23386619 GCTTAAGAACCTGCCTGATGGGG + Intergenic
1127225229 15:56919885-56919907 GCCCTAGGACCTGCTAGAAGTGG + Exonic
1128648842 15:69396096-69396118 GATCTGGCACCTGCCTGAGGAGG + Intronic
1129145322 15:73641856-73641878 GCTCTATTACCTGCCAGCTGGGG - Intergenic
1129521117 15:76186871-76186893 GCTCCAGGCTCTGCCTGGTGGGG + Intronic
1134461838 16:14436391-14436413 GCTTAAGAACCTGCCTGATGGGG - Exonic
1137428436 16:48399157-48399179 GCTCTAGGCCCACCCTGGTGGGG - Intronic
1138388431 16:56652355-56652377 GAGCTGGGACCTTCCTGATGGGG + Intronic
1140859136 16:79004140-79004162 TCTCTTGGAATTGCCTGATGTGG - Intronic
1143052128 17:4134962-4134984 GAACTATGACCTGCCTGGTGTGG + Intronic
1144057687 17:11557258-11557280 GCTCTTGAAGCTTCCTGATGAGG - Intronic
1146576790 17:34001312-34001334 TCTCTAGGACCTCCCACATGAGG - Intronic
1146961749 17:36986195-36986217 GCTCAAGGAGCTGACTGATAAGG + Intronic
1147459110 17:40557299-40557321 GCTGGAGGACCTGCCTCACGAGG + Intronic
1148644058 17:49209270-49209292 GGTCTAGGACTTGCCTCAGGAGG - Intronic
1150863993 17:68830789-68830811 GCTCTAATAACTGCCTGTTGAGG + Intergenic
1153355423 18:4129424-4129446 GATAGAGGAGCTGCCTGATGTGG - Intronic
1154181382 18:12142585-12142607 GCTAGAGGACCTGCCAGGTGAGG + Intergenic
1154182522 18:12148999-12149021 GCTAGAGGACCTGCCAGGTGAGG - Intergenic
1156475772 18:37404489-37404511 AGTCCAGGCCCTGCCTGATGGGG + Intronic
1158624082 18:59056803-59056825 GCTCAAGGCCCTGCCCGGTGTGG + Intergenic
1161027474 19:2043184-2043206 GCTCTAGGACGTTCCTGGGGTGG + Exonic
1161153823 19:2722208-2722230 CCTCTGGGATCTGCCCGATGAGG - Intronic
1161218785 19:3108236-3108258 TCTCTAGGAGCTGCCAGGTGAGG + Intronic
1161362804 19:3860613-3860635 TCTCAAGCACCTGCCTGGTGGGG - Intronic
1163712090 19:18852891-18852913 GCTGTAGGGCCCGCCTCATGGGG + Intronic
1165314531 19:35046580-35046602 GGTCTAGGACCTTCCTGGTGTGG - Intronic
1165720282 19:38074079-38074101 GCACTTGGACCTTCCCGATGGGG - Intronic
1168322883 19:55520872-55520894 GCAATAGCACCTGCCTCATGGGG + Intergenic
925005294 2:438742-438764 GCCCTAAGACCTGCCAAATGGGG - Intergenic
928182209 2:29076366-29076388 GCTCTAAGTCCTGCCTGTTTTGG - Intergenic
930295775 2:49551731-49551753 CCTATAGGACCTGCCTGAGAAGG - Intergenic
930345274 2:50172464-50172486 GTTCTAGCACCTGGCTCATGTGG - Intronic
931705305 2:64942075-64942097 GCACTAGCTTCTGCCTGATGGGG + Intergenic
934623691 2:95832027-95832049 TCTCAAGGTCCTGCCTGGTGAGG - Intergenic
935261794 2:101362120-101362142 GCTCAAGGAGCTGCTTGCTGAGG + Intronic
937309793 2:120895034-120895056 CCTTGAGGACCTGGCTGATGGGG + Intronic
938088409 2:128416887-128416909 GCTCCAGACCCTGGCTGATGGGG - Intergenic
938763498 2:134445236-134445258 GCCCTTGGCCCTGCCTGATGGGG - Intronic
941938913 2:171012298-171012320 GTTATAGGACCTACCTGATAGGG - Intronic
942150101 2:173067605-173067627 GGGCTAGGACCTCCCAGATGTGG - Intergenic
943718996 2:191183162-191183184 GCTCCAGGGGCTGCCTGAGGTGG - Intergenic
948807058 2:240457588-240457610 GCTCCAGGCCCTGCCTGCAGTGG + Intronic
1169118213 20:3081000-3081022 GCTCTAGCCCCAGCCAGATGGGG + Intergenic
1170660420 20:18333597-18333619 GGTCAAGGACCTGCTTGAGGAGG - Intergenic
1171282082 20:23909704-23909726 CCTGGAGGACCTGCCTGGTGAGG + Intergenic
1172130122 20:32649918-32649940 CCTCTAGGATCTGGCTGCTGAGG + Intergenic
1172949802 20:38715667-38715689 GGTCTAGGACCAGCCTGAGGCGG - Intergenic
1177626601 21:23670307-23670329 CCTCTAAGACCTGCATGATTGGG - Intergenic
1177902708 21:26935962-26935984 GCACTAGAATCTGCCTGATGGGG - Intronic
1180726854 22:17952738-17952760 TCTGCAGGATCTGCCTGATGAGG + Intronic
1181760279 22:25053601-25053623 GCGCCAGGCCCTGCATGATGGGG + Intronic
1184395469 22:44233807-44233829 GATCAAGGAACTGGCTGATGTGG + Intergenic
953139262 3:40212361-40212383 ACAGTAGTACCTGCCTGATGGGG - Intronic
954706272 3:52482295-52482317 GCACTCGGGCCTGCCTGAAGGGG + Intronic
955379466 3:58425334-58425356 TTTCTAGGAGCTGTCTGATGGGG - Intronic
961394481 3:126577658-126577680 GCTCAAGGCCCTGCCTAGTGGGG - Intronic
964255680 3:154772275-154772297 CCTGGAGGACCTGCCCGATGAGG + Intergenic
964427722 3:156570891-156570913 GCTATAGCACTTGCCTCATGAGG + Intergenic
965009179 3:163063536-163063558 GCTCTAGATCCTGCCCAATGAGG - Intergenic
967789992 3:193538385-193538407 TCTCTAGGATCTGTCTGATTTGG - Intronic
968423171 4:502318-502340 GTTCTAGCTCCTCCCTGATGGGG - Intronic
969470837 4:7388376-7388398 GTTCTGGGACCCGCCCGATGGGG + Intronic
972231146 4:37073971-37073993 GCTCCAGGCACTGCATGATGTGG + Intergenic
972654974 4:41055465-41055487 GTTCCAGGACTTGCCTGATAAGG + Intronic
973071580 4:45866459-45866481 CCTCAAGGACTTGTCTGATGAGG - Intergenic
982268226 4:153559846-153559868 GCTGTAAGACCTGCGTGGTGTGG + Intronic
985049042 4:185971459-185971481 TCTCTAGGAGATCCCTGATGAGG + Intergenic
985769136 5:1798035-1798057 GCTGTGGGCCCTGCCTGAGGAGG + Intergenic
988935991 5:36083373-36083395 GCTGGAGGACATGCCTGATGAGG - Intergenic
991511295 5:67379404-67379426 GCTCAAAGTCCTTCCTGATGAGG - Intergenic
991928720 5:71730636-71730658 TCTCTAGCACCTGCCTGCTAAGG - Intergenic
992946978 5:81820758-81820780 ACTGTAGGAACTGTCTGATGAGG + Intergenic
995428649 5:112050470-112050492 CCTGGAGGACCTGCCAGATGAGG - Intergenic
996491979 5:124108440-124108462 GGTCTAGGACCTGCTTCAGGTGG - Intergenic
998282115 5:140821910-140821932 GCCCTAGGTCCTGCGCGATGCGG - Exonic
998978719 5:147676652-147676674 GCTGTAGGAGGTGCCTGATTAGG - Intronic
999052145 5:148534432-148534454 CCTGGAGGACCTGCCTGGTGAGG - Intronic
1000998508 5:167982627-167982649 CCTCCAGGAGCTGCATGATGTGG - Intronic
1001650766 5:173314443-173314465 CCTTAAGGACCTGCCTAATGGGG + Intergenic
1002905500 6:1445625-1445647 GCTATAGGACCTTCCTGGGGTGG + Intergenic
1003198537 6:3937618-3937640 TCTCTGGGACCTGCTTGATTAGG - Intergenic
1006268700 6:32947723-32947745 GCTCTGGAACCTGACTGCTGGGG - Intronic
1010677014 6:78756799-78756821 GCTCAGGGACCTGCTTGAGGAGG - Intergenic
1011042594 6:83047458-83047480 GCTCCCGTACCTCCCTGATGTGG + Intronic
1015197261 6:130537246-130537268 CCTGGAGGACCTGCCTGGTGAGG - Intergenic
1019154004 6:170026640-170026662 GCTCCTGGACCTGCCTGTTCAGG + Intergenic
1023266293 7:38409689-38409711 GCTCTGGGACCCGGCTGCTGAGG - Intronic
1023909161 7:44541464-44541486 ACCCTAGCACCTGCGTGATGAGG - Intergenic
1024135847 7:46407100-46407122 GACCTAGGAGCTGCCTTATGTGG + Intergenic
1025247695 7:57329412-57329434 ACTTTAGGATCTGACTGATGCGG + Intergenic
1027268200 7:76505361-76505383 GCTCTAGGACCTGCCCGGGGAGG - Exonic
1027503240 7:78982018-78982040 GGTTTTGGACCTGCCTGAGGTGG - Intronic
1029324046 7:99790562-99790584 TCTCCAGCACCTGCCTGCTGAGG - Intergenic
1030338140 7:108347680-108347702 GATCCAGGATATGCCTGATGAGG + Intronic
1031627148 7:124004597-124004619 CCTAGAGGACCTGCCTGGTGAGG + Intergenic
1038965456 8:32566483-32566505 GCTCCAGGATCTTCCTGAAGTGG - Intronic
1040905933 8:52469904-52469926 GCTCTAGGAGCTGCCAGGAGGGG - Intergenic
1041561793 8:59226490-59226512 CCTGCAGGACCTGCCTGGTGAGG - Intergenic
1043227371 8:77748840-77748862 GTTGGAGGACCTGCCTGGTGAGG - Intergenic
1047398402 8:124524936-124524958 TCTATAGGTCCTGGCTGATGAGG + Intronic
1047441045 8:124879071-124879093 TCTCTAGGGCCTCTCTGATGAGG + Intergenic
1050939005 9:11435667-11435689 GCTCAAAAACCTGGCTGATGAGG + Intergenic
1052311631 9:27074833-27074855 CCTGGTGGACCTGCCTGATGAGG + Intergenic
1052766976 9:32651086-32651108 CCTAGAGGACCTGCCTGGTGAGG - Intergenic
1056127889 9:83554799-83554821 CCTGGAGGACCTGCCTGGTGAGG + Intergenic
1056442245 9:86632744-86632766 GCTCTGGGGCCGGCCAGATGTGG - Intergenic
1057696087 9:97323894-97323916 GCTCTTGGACGTGCGTGCTGGGG + Exonic
1060116569 9:120946036-120946058 GCTCTAGGTCCTTTCTGGTGTGG + Intergenic
1060250020 9:121978849-121978871 ACTCTAGGACCTCCCAGTTGGGG - Intronic
1062478379 9:136740660-136740682 CCTCCAGGACCTGACTGCTGTGG + Intronic
1203735831 Un_GL000216v2:138538-138560 TCTCTAGGATCTGCCTAAAGGGG - Intergenic
1188628497 X:32318938-32318960 GCTCATTGACCTGCCTCATGTGG + Intronic
1191181208 X:57565606-57565628 GGTCTGGGACCTGCTTGAGGTGG - Intergenic
1191738927 X:64416936-64416958 CCTGGAGGACCTGCCTAATGAGG + Intergenic
1192303868 X:69937326-69937348 GATTTAGATCCTGCCTGATGTGG + Intronic
1193468342 X:81872589-81872611 GCTCTAATAACTGCCTTATGGGG - Intergenic
1193805187 X:85985870-85985892 ACTGGAGGACCTGCCTGGTGTGG - Intronic
1193858922 X:86640151-86640173 GCTGGAGGGCCTGCCAGATGAGG - Intronic
1194463648 X:94204604-94204626 GCTCTACGACCTTCCTGGGGTGG - Intergenic
1194854695 X:98914909-98914931 CCTGAAGGACCTGTCTGATGAGG + Intergenic
1195651810 X:107292602-107292624 GCTCTAGGGCCTGAGGGATGTGG + Intergenic
1197728702 X:129793147-129793169 GCTTTAGGAGCGGCCTGGTGAGG + Intronic
1199307027 X:146279168-146279190 ACTGGAGGACCTGCCTGGTGAGG + Intergenic
1201772073 Y:17624711-17624733 GCTCTAGGACGTGGTTCATGTGG + Intergenic
1201829482 Y:18281275-18281297 GCTCTAGGACGTGGTTCATGTGG - Intergenic
1202625092 Y:56848883-56848905 TCTCTAGGAACTGCCTAAAGGGG + Intergenic