ID: 1098385129

View in Genome Browser
Species Human (GRCh38)
Location 12:69910385-69910407
Sequence AACGGCATTGGGCAGTCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 54}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098385129 Original CRISPR AACGGCATTGGGCAGTCGGG AGG Intronic
901492854 1:9605437-9605459 GAGGGCACAGGGCAGTCGGGGGG + Intronic
904156680 1:28489476-28489498 AACTGCCTTGGGCATTTGGGAGG + Intronic
914976880 1:152373994-152374016 AATTTCATGGGGCAGTCGGGAGG + Intergenic
922014703 1:221633530-221633552 AACGCCATTTTCCAGTCGGGGGG + Intergenic
922612398 1:226940198-226940220 AGCGGCATTCGGCAGGCGGACGG + Intronic
922974760 1:229775015-229775037 AACAGAATAGGGCAGTGGGGTGG - Intergenic
924490857 1:244536081-244536103 AAGGGCACTGGGCAGTCCTGAGG - Intronic
1065650504 10:27884445-27884467 CACAGCATGGGGCAGTCAGGAGG + Intronic
1068043720 10:51859674-51859696 AAAGGGATTGGGGAGTAGGGTGG - Intronic
1070160234 10:73862306-73862328 AAGTGCATTGGGAAATCGGGGGG - Intronic
1089306230 11:117528020-117528042 AACGGCCTTGTGAAGTCTGGAGG - Intronic
1091097638 11:132839233-132839255 AACGGCCTTGGGAAATCAGGTGG + Intronic
1093192450 12:16091150-16091172 TACGTCATTGGGCAGCGGGGAGG - Intergenic
1098385129 12:69910385-69910407 AACGGCATTGGGCAGTCGGGAGG + Intronic
1098387736 12:69936427-69936449 CAAGGCATTGGGCAGGGGGGAGG - Intronic
1101983367 12:109426832-109426854 AAAGGCAATAGGCAGTGGGGAGG + Intronic
1102304181 12:111792242-111792264 AACGCCATTGGGCACTGGGGGGG - Intronic
1123049618 14:105534705-105534727 AAAGGCAGTGGGCAGGTGGGGGG + Intergenic
1128062702 15:64745342-64745364 AACAGCATTGGGCACAGGGGAGG - Intronic
1129412986 15:75360042-75360064 AACTGCAGTGAGCAGTCAGGTGG + Intronic
1135388003 16:22061448-22061470 AAGGGAATTGTGCAGTCGTGTGG - Intronic
1141920550 16:87132841-87132863 CAGGGCATTGGGAAGGCGGGTGG - Intronic
1143866310 17:9926372-9926394 AGCTGCAGTGGGCAGTCGAGTGG - Intronic
1158837009 18:61341423-61341445 AACGGCATTAGGCGGGGGGGGGG - Intronic
1165117715 19:33538916-33538938 AAGGGCAGTGGGCAGGCAGGAGG - Intergenic
1166700598 19:44879460-44879482 GAGGGCATGGGGCAGGCGGGGGG + Intronic
927784614 2:25965060-25965082 AGGGGCATTGGACAGACGGGTGG - Intronic
929563409 2:42969666-42969688 AAGGGCAAGGGGCAGTCAGGAGG + Intergenic
929681189 2:43995472-43995494 GACTGCTTTGGGAAGTCGGGTGG - Intronic
939870275 2:147519143-147519165 ATCAGGATTTGGCAGTCGGGTGG - Intergenic
1175779961 20:61676055-61676077 AATGTAATTGGGCAGTCGGTGGG + Intronic
1175964883 20:62655476-62655498 GAAGGCCTTGGGCAGTAGGGGGG + Intronic
1184486127 22:44780730-44780752 AATGGCATTGGCCAGTGGTGGGG - Intronic
1185110165 22:48896298-48896320 AAGGGCAGTGGGCAATGGGGTGG + Intergenic
950944333 3:16928999-16929021 AATGGGATTGGGCAGGGGGGTGG + Intronic
955082887 3:55674107-55674129 CTCTGCATCGGGCAGTCGGGAGG - Intronic
962217080 3:133531883-133531905 AACTGCACTGGGCATTAGGGTGG + Intergenic
965469082 3:169067715-169067737 AACTGTATTGGGAAGACGGGAGG + Intergenic
967196515 3:187030963-187030985 GAAGGCAGTGGGCAGTGGGGAGG + Intronic
968612917 4:1565141-1565163 AAAGGCTGTGAGCAGTCGGGTGG - Intergenic
969931693 4:10637035-10637057 ATCTGCAATGGGCACTCGGGAGG - Intronic
975182550 4:71363501-71363523 AAGGGTATGGGGCAGTTGGGGGG - Intronic
983348377 4:166556400-166556422 AAGGGTAGTGGGCAGTTGGGAGG - Intergenic
987398338 5:17447191-17447213 AGTGGCATTGGGTAGTCAGGAGG + Intergenic
1008594433 6:53027255-53027277 AAATGCATTGGGCAGTCTGAAGG - Intronic
1024705883 7:51959297-51959319 TAAGGCATTAGGCAGTCAGGAGG - Intergenic
1026399638 7:69996564-69996586 ACTGGCAGTGGGCAGTGGGGAGG - Intronic
1033559320 7:142516186-142516208 AAGGGCTCTGGGCAGTCTGGGGG + Intergenic
1037838799 8:22229970-22229992 ACCGGCATTTGGCTGTGGGGTGG - Intronic
1044588401 8:93889895-93889917 ACCTGCATTGTGCATTCGGGTGG - Intronic
1187873492 X:23783565-23783587 AACGGAATGGGGCGGGCGGGCGG - Intronic
1192153727 X:68727757-68727779 AAAGACATGGGGCAGGCGGGGGG - Intergenic
1192548198 X:72030879-72030901 ACCTGCATTGGGTAGTTGGGTGG - Intergenic
1192855538 X:75006514-75006536 AAGGGTATTGGGGAGTTGGGCGG - Intergenic
1197729230 X:129795726-129795748 AACTGCATTGGGCATTGGGAAGG + Intergenic
1199670785 X:150146606-150146628 ACCTGCATTGGGCAGTATGGTGG + Intergenic