ID: 1098386264

View in Genome Browser
Species Human (GRCh38)
Location 12:69922041-69922063
Sequence CAGTGAGGATGGAGAGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1634
Summary {0: 2, 1: 3, 2: 30, 3: 242, 4: 1357}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098386260_1098386264 7 Left 1098386260 12:69922011-69922033 CCAAGGGAAAAAAAAGAGTATCA 0: 1
1: 0
2: 6
3: 52
4: 599
Right 1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG 0: 2
1: 3
2: 30
3: 242
4: 1357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098386264 Original CRISPR CAGTGAGGATGGAGAGAAGT GGG Intronic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
901175585 1:7296467-7296489 TAGTGGGGATGGGAAGAAGTGGG + Intronic
901185338 1:7369132-7369154 CAGTGAGGATGGTCTGAAGGGGG + Intronic
901376185 1:8841191-8841213 CAATGAGGCTGGAGAACAGTGGG - Intergenic
901797488 1:11688904-11688926 CAGTGAGGATGACCAGAGGTTGG - Intronic
902539711 1:17145540-17145562 CAGCGTGGCTGGAGAGAAGTGGG - Intergenic
902603229 1:17554224-17554246 CAGTGAGGATGGTGAGGGGCTGG + Intronic
902781213 1:18706122-18706144 GAGTGAGGAGGGAGGGCAGTGGG - Intronic
902908894 1:19580446-19580468 CAGAGAGGATTGAGGGAAGATGG + Intergenic
903064562 1:20691925-20691947 TAGCAAAGATGGAGAGAAGTGGG - Intronic
903286637 1:22281583-22281605 CAGTGAGGAGACTGAGAAGTTGG + Intergenic
903331722 1:22600089-22600111 GAGGGAGGAAGGAGAGAAGGAGG + Intronic
904037722 1:27567787-27567809 CTGTGAAGAGGGAGAGATGTTGG - Intronic
904861918 1:33544673-33544695 GGGGGAGGATGAAGAGAAGTGGG + Intronic
904921849 1:34014129-34014151 CGGTGAAGGCGGAGAGAAGTGGG - Intronic
905188475 1:36214411-36214433 CAGTGGGGATGAAGAAAAGTGGG - Intergenic
905593173 1:39182703-39182725 GAGTGAGGATGTGGAGAAATTGG + Intronic
905776382 1:40669985-40670007 CAAGAGGGATGGAGAGAAGTGGG - Intergenic
905864669 1:41370284-41370306 CAGAGAAGAGGGAGAGAAGAGGG + Intronic
905896941 1:41554095-41554117 CAGGGAGAATGGAAACAAGTTGG - Intronic
906043567 1:42809085-42809107 CAGTGGTGATGGAAAGAAGATGG + Intronic
906125440 1:43424409-43424431 CAGTGAGGATGGAGAGGAGCTGG - Exonic
906218100 1:44056204-44056226 TAGTGAGGCTGGAGAGTAATAGG - Intergenic
906384534 1:45356289-45356311 CAGAGAGCAAGGAGAGGAGTAGG + Intronic
906466350 1:46083788-46083810 TGGTGAGGATGTAGAGAAATTGG + Intronic
906713222 1:47948184-47948206 CAGTGGGGATAGAGAGACTTGGG + Intronic
907024988 1:51108559-51108581 AAGGGAGGATGATGAGAAGTTGG - Intronic
907085299 1:51666998-51667020 CAGAGAGGATGGAGACAAGTTGG + Intronic
907178402 1:52547385-52547407 TAGTGAGGATGTAGAGAAATTGG + Intronic
907181599 1:52575397-52575419 CAGTGAAGATTGTGTGAAGTGGG - Intergenic
907191843 1:52655930-52655952 CCTTGAGGATGGAGAGAAATGGG + Intronic
907289876 1:53406968-53406990 CTGGAAGGATGGAGAGGAGTGGG + Intergenic
907342063 1:53742248-53742270 TAGTGAGGATGGAGAGGAGGAGG - Intergenic
907347070 1:53791015-53791037 GGAGGAGGATGGAGAGAAGTAGG - Intronic
907600286 1:55761912-55761934 CAGGGAGAATGGAGTCAAGTTGG + Intergenic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
907795970 1:57717426-57717448 CATTGAGGATGTAGAGAAAGGGG + Intronic
907839509 1:58142760-58142782 CAGGAAAGATGGAGAGAGGTAGG - Intronic
908427898 1:64026134-64026156 GAGTGAGAATGAAGACAAGTTGG - Intronic
908522227 1:64955515-64955537 CAGTGTAGAAGGAGAGAAATAGG + Intronic
908771501 1:67600979-67601001 CAGCAAGGATGTAGAGAAATTGG - Intergenic
908838852 1:68257684-68257706 CAGTGGAGATGAAGAGAAGTTGG - Intergenic
908876721 1:68686095-68686117 CAGAGAGAATGGAAACAAGTTGG - Intergenic
908969318 1:69807895-69807917 CAGGGAGAATGGAGCCAAGTTGG - Intronic
909008023 1:70300185-70300207 AAATGAGAATGAAGAGAAGTTGG + Intronic
909307641 1:74101417-74101439 CAGAGAGGATGTGGAGAAATAGG + Intronic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
909914235 1:81298052-81298074 CAGAGAAGATGGAGAGGACTGGG + Intergenic
910642159 1:89474781-89474803 CAGTGAGAATGGAACCAAGTTGG + Intergenic
910693827 1:89991628-89991650 CAGTGGGGATGAAGAGGAGGGGG + Intergenic
910726438 1:90344835-90344857 TAGTGACGATGGAGGGAAGTGGG - Intergenic
910827668 1:91427042-91427064 CAGGGAGAATGGAATGAAGTTGG - Intergenic
910974189 1:92888666-92888688 TGGTGAGGATGTGGAGAAGTAGG - Intronic
911172925 1:94789183-94789205 TAGTGAGGATGTAGAGAAAGGGG + Intergenic
911509944 1:98799173-98799195 TGGTGAGGATGGAGAGAAAGAGG - Intergenic
911632821 1:100201447-100201469 CAGGGAGAATGGAAACAAGTTGG + Intronic
911656897 1:100454322-100454344 CCCTGAGGATGGAGACAAGGAGG + Intronic
911688930 1:100809102-100809124 CAGTGGGGATGCAGAGCAGTGGG + Intergenic
911825152 1:102474028-102474050 CAGTGGGGATAGAGAGAGGAAGG - Intergenic
911837544 1:102640535-102640557 AAGGGAGGATAAAGAGAAGTTGG - Intergenic
912025647 1:105167905-105167927 CAGAGAGGATGTGGAGAAATAGG + Intergenic
912330473 1:108815817-108815839 CAGTGAGGATGGAGGGAAACTGG - Intergenic
912380937 1:109247972-109247994 CTGGCAGGATGGATAGAAGTAGG - Intergenic
912499078 1:110110027-110110049 CAGTGGGGATGCAGAGGAGGAGG + Intergenic
912586274 1:110769366-110769388 CGATGAGGATGGGAAGAAGTTGG - Intergenic
912592583 1:110840341-110840363 TGGTGAGAATGTAGAGAAGTTGG + Intergenic
912663772 1:111560840-111560862 TTGGGAGGATGGAGAGAAATTGG - Intronic
912949933 1:114113681-114113703 CACTGGAGATGGAGAGAGGTGGG - Intronic
913174090 1:116257942-116257964 CAGTGAGGATGTGGAGAAATTGG + Intergenic
913274636 1:117124879-117124901 CAGTGGGGATGGAAAGAAATCGG - Intergenic
913429475 1:118775101-118775123 TGGTGAGGATGAAGAGAACTTGG - Intergenic
913462366 1:119101073-119101095 AGGGGAGGATGAAGAGAAGTGGG + Intronic
913933454 1:125009136-125009158 CAGGGAGAATGGAAACAAGTTGG + Intergenic
914191912 1:145419221-145419243 AAGTAGGGAAGGAGAGAAGTAGG + Intergenic
914319043 1:146541726-146541748 CAGTGAAGGTGATGAGAAGTAGG + Intergenic
914416525 1:147488400-147488422 AAGTGAGGATGGGGAGGTGTTGG + Intergenic
915428283 1:155845118-155845140 GAGTGAGGTAGGAGAGAAGCAGG + Intronic
915536100 1:156536486-156536508 GAGAGAGGATGGGGAGAGGTTGG + Intronic
915556370 1:156663135-156663157 CAGGGAGGAGGGAGGAAAGTAGG + Intergenic
915559339 1:156677280-156677302 CACTGAGGATGGACAGACGCGGG + Exonic
915566360 1:156715604-156715626 AAGTGGGGAAGGAGAGAAGTGGG - Intergenic
915644181 1:157255468-157255490 CAGGGAGAATGGAAACAAGTTGG + Intergenic
915739480 1:158107689-158107711 AAGTAAGAATGGAGAGAAGGTGG - Intergenic
915744994 1:158149186-158149208 CAGTGTGGATGGAGAAAAGTGGG + Intergenic
915780055 1:158538257-158538279 CAGTGAGGATGTGGGGAAATTGG - Intergenic
915924408 1:160004991-160005013 CAGTGAGCCTGGAGAGACCTTGG - Intergenic
915996010 1:160564291-160564313 TAGTGAGGATGTAGAGAAACTGG + Intronic
916190587 1:162173917-162173939 TAGAGAGGATGTGGAGAAGTAGG + Intronic
916446926 1:164881150-164881172 CCGGGAGTCTGGAGAGAAGTGGG + Intronic
916522467 1:165577068-165577090 TGGTGAGGATGTAGAGAAGTTGG + Intergenic
916584446 1:166138210-166138232 GAGTGAGGAGGGGCAGAAGTAGG - Intronic
916604714 1:166329453-166329475 TAGTGAGGATATAGAGAAATTGG - Intergenic
916612652 1:166408524-166408546 CAGTGAGAATGGAAACAAGTTGG - Intergenic
916635822 1:166667487-166667509 CAGAGAGGATGTAGAGAAATAGG + Intergenic
916660127 1:166915840-166915862 CAGTGAGGATCATGAGAAGGGGG + Exonic
916764819 1:167850180-167850202 AAGTGAGGATGGATAGAACCAGG + Intronic
916934428 1:169612897-169612919 CAGTGAGGATGAAAAGAATAAGG + Intronic
917033239 1:170718557-170718579 GAGTGAGGATGGGGAGAACAAGG - Intronic
917104278 1:171476736-171476758 CAGTAGGGGTTGAGAGAAGTAGG - Intergenic
917261037 1:173169753-173169775 CAGTGGGGATGAAGAGAGGTTGG + Intergenic
917459086 1:175213017-175213039 CAGTGAGGATGTGGAGAAAAGGG - Intergenic
917509617 1:175659401-175659423 CAGCCAGGATGGGGAGAACTGGG + Intronic
917633443 1:176912971-176912993 CATGGATGGTGGAGAGAAGTTGG - Intronic
917633886 1:176916914-176916936 AAGTGAGGCTGGAGAGAGGCTGG - Intronic
917714126 1:177716903-177716925 TAGAGAGGATGCAGAGAAATAGG + Intergenic
918136924 1:181681945-181681967 AAGTGTGGCTGAAGAGAAGTAGG - Intronic
918174161 1:182029038-182029060 CAGTGAGGATGAAGAGAGAGGGG - Intergenic
918319940 1:183354802-183354824 CTGTGGTGATTGAGAGAAGTAGG - Intronic
918343200 1:183584006-183584028 TAGTGGGGATGGAGAGAAATAGG + Intronic
918422510 1:184378347-184378369 TTGTGAGGATGCAGAGAAATGGG + Intergenic
918492279 1:185094050-185094072 GAGTAAGAATGAAGAGAAGTAGG - Intronic
918657770 1:187049880-187049902 AAGTGAGGATGTGGAGAATTTGG + Intergenic
918719046 1:187829333-187829355 GAGAGAGGATGGGGAGAGGTGGG - Intergenic
918733519 1:188029212-188029234 TAGTGAGGATTTAGAGAAATTGG - Intergenic
918832061 1:189411268-189411290 TAGTGAGGATGTGGAGAAATAGG - Intergenic
918862772 1:189853978-189854000 CAGTGAGGATGAAGAAAAAAAGG - Intergenic
919009402 1:191940321-191940343 CAGAGAGGATGTGGAGAAATAGG + Intergenic
919051178 1:192513349-192513371 CTGTGTGGATGTAGAGAAGTAGG + Intergenic
919521196 1:198590487-198590509 CAGGGAGAATGGAGAGAAAGTGG - Intergenic
919721240 1:200838822-200838844 CAGTTATGATGGAGAGAAGTTGG + Intronic
919749972 1:201031465-201031487 TAGTGAGGATGCGGAGAAGTAGG + Intergenic
920180175 1:204127550-204127572 CTTTGAGGATGGAGAGAAGACGG - Exonic
920274032 1:204790574-204790596 CAGTGGGGATGAAGGGAACTAGG - Intergenic
920626087 1:207601550-207601572 TGGTGAGGATGTAGAGAAATTGG - Intronic
920768693 1:208858952-208858974 CAGTGTGGTTGGAGTAAAGTGGG + Intergenic
920877152 1:209847367-209847389 GAGTGGGGATAGAGAGAAGATGG - Intronic
921304570 1:213782883-213782905 CAGACAGGCTGGAGTGAAGTTGG + Intergenic
921457224 1:215386589-215386611 CAGTGAGGATGTGGAGAAAAGGG + Intergenic
921468064 1:215515220-215515242 CAGGGAGGATGAAGAGAGGTTGG + Intergenic
921829001 1:219706233-219706255 CCGTGAGGTTGCAGAGAAGAAGG + Intronic
921900553 1:220445631-220445653 CAATGAGGATGTGGAGAAATTGG - Intergenic
921980950 1:221258086-221258108 CAGAGAGGATGTGGAGAAATAGG - Intergenic
922026679 1:221756270-221756292 TAATGAGGATAGAGAGAAGAGGG - Intergenic
922180198 1:223227383-223227405 CAGGAAGGAGGGAGAGAGGTAGG + Intronic
922209858 1:223478866-223478888 CAGAGAGTATGGAGAGTATTGGG - Intergenic
922386863 1:225095026-225095048 CAGTGAGGTTGCAGAGAAAAGGG + Intronic
922520356 1:226245351-226245373 TGGTGAGGATGTAGACAAGTAGG - Intronic
922591882 1:226783606-226783628 CACTGAGGATGGAGAACAGTGGG + Intergenic
922655252 1:227376601-227376623 CAGTGAGGAGGAGAAGAAGTTGG - Intergenic
922907754 1:229187711-229187733 CTGTAGGGATGAAGAGAAGTAGG - Intergenic
923007464 1:230062964-230062986 TGGTGAGGATGTAGAGAAATTGG - Intronic
923230481 1:231981929-231981951 CAGTTGGTATGTAGAGAAGTGGG + Intronic
923241985 1:232095069-232095091 CCAGGAGGATGGAGAGAAGGAGG - Intergenic
923275898 1:232396062-232396084 CAGTGAAAGTGGAGAGAAGTAGG - Intergenic
923374642 1:233348630-233348652 CAAGGAAGATGGAGAGAAATCGG - Intronic
923392319 1:233525256-233525278 CAGTGAGGATGCAGAGAACAGGG + Intergenic
923520879 1:234734282-234734304 TAGAGTGGATGGAGAGAGGTGGG + Intergenic
923570328 1:235107704-235107726 CAGTGAGGCTGGAAAGAAGTGGG + Intergenic
924074938 1:240323940-240323962 CAGTGAGGCTTGAGAGAACTTGG - Intronic
924273447 1:242359228-242359250 CTGTGAGGTGGGAGTGAAGTAGG + Intronic
924371764 1:243358468-243358490 CGGTGAGGATGTAGAGAAACTGG + Intronic
924444812 1:244119356-244119378 AAGTGAGGAGGGAGAGGAGATGG + Intergenic
924460548 1:244254858-244254880 CAGAGAGAATGGAGAGAAGGAGG - Intergenic
924487492 1:244499977-244499999 TGGTGAGGATGCAGAGAAATAGG - Intronic
1062885223 10:1011064-1011086 CAGTCAGGATGGAGGGATGCAGG - Intronic
1062885246 10:1011150-1011172 CAGTCAGGATGGAGGGATGCAGG - Intronic
1062955437 10:1537320-1537342 CAGTGAGGATGTGGAGAAATTGG + Intronic
1063497154 10:6520564-6520586 CAGGGAGGATGGAGTGAAACAGG - Intronic
1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG + Intergenic
1064127021 10:12671438-12671460 TAATAAGGATGTAGAGAAGTTGG - Intronic
1064511636 10:16100388-16100410 CAGTGTGAATGTTGAGAAGTGGG + Intergenic
1064553260 10:16522776-16522798 CATTGAGGGAGGGGAGAAGTAGG + Intergenic
1064739318 10:18416127-18416149 CAGGGAGGAGGAAGAGAGGTGGG - Intronic
1064980647 10:21163119-21163141 CAGTGTGGCTGGAGAGAAGGAGG + Intronic
1065448611 10:25830037-25830059 CAGTTAGAGTGGAAAGAAGTAGG - Intergenic
1065668469 10:28087806-28087828 CAGTGAGGTGGGAGAGGAGCAGG + Intronic
1065720796 10:28627111-28627133 CAGAGAGGATGCAGACAAGGGGG - Intergenic
1065747677 10:28857176-28857198 GTGTGGTGATGGAGAGAAGTGGG - Intronic
1065898290 10:30183380-30183402 TAGTGAGGATGGGGAGAAAGAGG + Intergenic
1065957142 10:30703926-30703948 CAGGGAGGATAGGGAGATGTTGG - Intergenic
1066028740 10:31394871-31394893 CAATGAGGATGAAGAGAGGTGGG + Intronic
1067093791 10:43285433-43285455 CTGTGAGCAGGGACAGAAGTTGG - Intergenic
1067135264 10:43602215-43602237 TAGGAAGGATGGAGAGGAGTTGG + Intergenic
1067214516 10:44291457-44291479 CAGTGATTATGGAGAGATTTGGG - Intergenic
1067235873 10:44448873-44448895 CAGAGAGGATGTGGAGAAATAGG - Intergenic
1068152138 10:53146019-53146041 TGGTGAGGATGTAGAGAAATAGG - Intergenic
1068214805 10:53969401-53969423 CAGTGAGAATGGAACCAAGTTGG + Intronic
1068491495 10:57730228-57730250 CAGTGAGGTTGCAGAGAAAAGGG - Intergenic
1068513683 10:57998912-57998934 CAGTTAGGATGGAGGGCAGTGGG - Intergenic
1068519887 10:58066467-58066489 CAGGTGGGATGAAGAGAAGTGGG - Intergenic
1069291649 10:66787421-66787443 GGGTGAGGTTGGACAGAAGTTGG + Intronic
1069360309 10:67633873-67633895 CAGGGAGGATGGAACCAAGTTGG + Intronic
1069583951 10:69584575-69584597 CAATGGGAATGGAGTGAAGTGGG + Intergenic
1069698468 10:70404819-70404841 CAGAGAGGAGAGAGAGAACTGGG - Intronic
1069919859 10:71810025-71810047 CAGTGATGTTGGAGAGCAGGTGG - Exonic
1070023322 10:72607757-72607779 CAGTGAGGTTGGACAGAACTGGG + Intronic
1070057169 10:72946573-72946595 TAGTGAGGATGTGGAGAAATGGG - Intronic
1070109193 10:73466077-73466099 AAGTGAAGATGGAGAACAGTAGG - Intronic
1070459796 10:76653229-76653251 CAGTGATGATGTGGAGAAATTGG - Intergenic
1071434015 10:85629843-85629865 TAGTGAGGATGCAGAGAAAAGGG - Intronic
1071472354 10:85992596-85992618 CAGTGAGGATGAGGAGAGGTGGG + Intronic
1071485640 10:86100547-86100569 CAGAGAGGAGGGAGAGAAAATGG + Intronic
1071680050 10:87695747-87695769 TAGAGAGGAAGGAGAGCAGTAGG + Intronic
1071706946 10:88009414-88009436 AAGTGGGGATAGAGAAAAGTAGG + Intergenic
1071755445 10:88533608-88533630 TTGTGAGGATGGAGTGAAGTGGG + Intronic
1072137475 10:92560903-92560925 AGGTGAGGATGGAGTGAAGGTGG - Intronic
1072493871 10:95935337-95935359 CAGAGAGGCTGGTGAAAAGTGGG - Intronic
1072563252 10:96596335-96596357 CAGTGAGGAGGCAGAGGAGCAGG - Intronic
1072755104 10:98014805-98014827 TGGTGAGGATGTAGAGAAATTGG + Intronic
1072876346 10:99176666-99176688 CAGGGAGAATGGAGCCAAGTTGG + Intronic
1073602400 10:104859927-104859949 TGGAGAGGATGTAGAGAAGTAGG + Intronic
1073787306 10:106903958-106903980 AAGTGAGGATTGAGGGAAGAAGG - Intronic
1073795769 10:106986575-106986597 CAGTGAGGAAAGAGAGAGATGGG - Intronic
1073856935 10:107687151-107687173 TGGTGAGGATGCAGAGAAATTGG + Intergenic
1073993255 10:109287920-109287942 CAGGGAGGGTGGAGGAAAGTGGG - Intergenic
1074099303 10:110341857-110341879 CAGTGAGGATGCTGAGCAGCAGG + Intergenic
1074173326 10:110968100-110968122 TACTGAGGATGCAGAGAAATTGG - Intronic
1074174566 10:110984137-110984159 TAGTGAGGATGTGGAGAAATCGG - Intronic
1074293551 10:112160259-112160281 AAGAGAGGAAGGAGAGAAGAGGG - Intronic
1074300904 10:112232577-112232599 CAGAGGGAATGGAGATAAGTAGG + Intergenic
1074331228 10:112511688-112511710 GAGGGAGGATGAAGAGAAGCAGG - Intronic
1074388669 10:113037962-113037984 AAGTGAGAATGGGAAGAAGTTGG + Intronic
1074446394 10:113524647-113524669 TAGTGAGGATGGAGTAAAGTTGG - Intergenic
1074660273 10:115647432-115647454 CGGAGAGGATGTAGAGAAATAGG - Intronic
1074839533 10:117335596-117335618 CAGTAAGGATGAAGAAAAGTAGG + Intronic
1075159585 10:120011574-120011596 AAGTGAAGAGGGAGAGAATTCGG + Intergenic
1075244791 10:120811320-120811342 CAGAGAGGAAGGAGAGAGGTGGG - Intergenic
1075383352 10:122036914-122036936 TGGTGAGGATGTAGAGAAATTGG - Intronic
1075383384 10:122037208-122037230 CGGTGTGGCTGGAGAAAAGTGGG + Intronic
1075878487 10:125828105-125828127 CAATGGAGAGGGAGAGAAGTGGG + Intronic
1075891878 10:125958622-125958644 TAGTGAGGATGTAGAGAAAAGGG - Intronic
1076726072 10:132413900-132413922 CAGTGGGGTGGGAGAGAGGTAGG + Intronic
1077010577 11:377484-377506 CAGGAAGGAAGGAGAGAAGCTGG - Intronic
1077147056 11:1051038-1051060 CACTGAGAAGGGAGAGAAGCTGG - Intergenic
1077446558 11:2593907-2593929 CAGTGAGGTTTCAGAGGAGTTGG - Intronic
1077591720 11:3497548-3497570 CAGTGAGAATGGAACCAAGTTGG - Intergenic
1077612691 11:3653786-3653808 CAGTGAGGATAGACAGAGGTAGG - Intronic
1077612699 11:3653849-3653871 CAGTGAGGATAGACAGAGGTAGG - Intronic
1077612707 11:3653912-3653934 CAGTGAGGATAGACAGAGGTAGG - Intronic
1077612715 11:3653975-3653997 CAGTGAGGACAGACAGAGGTAGG - Intronic
1077612729 11:3654101-3654123 CAGTGAGGATAGACAGAGGTAGG - Intronic
1077612737 11:3654164-3654186 CAGTGAGGATAGACAGAGGTAGG - Intronic
1077612745 11:3654227-3654249 CAGTGAGGATAGACAGAGGTAGG - Intronic
1077612753 11:3654290-3654312 CAGTGAGGATAGACAGAGGTAGG - Intronic
1077612761 11:3654353-3654375 CAGTGAGGACAGACAGAGGTAGG - Intronic
1077612769 11:3654416-3654438 CAGTGAGGATAGACAGAGGTAGG - Intronic
1077612777 11:3654479-3654501 CAGTGAGGACAGACAGAGGTAGG - Intronic
1077612785 11:3654542-3654564 CAGTGAGGACAGACAGAGGTAGG - Intronic
1077612793 11:3654605-3654627 CAGTGAGGATAGACAGAGGTAGG - Intronic
1077612801 11:3654668-3654690 CAGTGAGGATAGACAGAGGTAGG - Intronic
1077612809 11:3654731-3654753 CAGTGAGGATAGACAGAGGTAGG - Intronic
1077612817 11:3654794-3654816 CAGTGAGGACAGACAGAGGTAGG - Intronic
1077670899 11:4156737-4156759 CAGTGAGGTTGGAGAGAAAAAGG - Intergenic
1077705092 11:4477522-4477544 GAGTGAGGAGAGAGATAAGTTGG + Intergenic
1077826536 11:5815584-5815606 CAGTGAGAATGTAGAGAAATTGG + Intronic
1077971234 11:7193186-7193208 TAGTGAGGATGTGGAGAAATGGG - Intergenic
1078259489 11:9691367-9691389 CAGTGAGGATGCAGAGACATTGG + Intronic
1078269059 11:9777721-9777743 CAGTCAGGAGGGAGACAACTGGG - Intergenic
1078337047 11:10472961-10472983 CAGCCAGGCTGGAGAGCAGTGGG - Intronic
1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG + Intergenic
1078471966 11:11595542-11595564 TGGTGAGGATGTGGAGAAGTTGG - Intronic
1078476432 11:11634185-11634207 CAGTGAGGAAGTTGAGAAGCAGG - Intergenic
1078606513 11:12781676-12781698 TAGGGAGGATGTAGAGAAATGGG + Intronic
1078689261 11:13562612-13562634 CAGTGGGGAAGTAGGGAAGTGGG - Intergenic
1078692642 11:13597435-13597457 CAGCGAGGAAGTAGGGAAGTGGG + Intergenic
1079044886 11:17093105-17093127 AAGTGAGGATGAGGTGAAGTGGG - Intronic
1079131409 11:17748930-17748952 GTGTGGGGCTGGAGAGAAGTTGG + Intronic
1079625521 11:22612271-22612293 TAGTGAGGATGTAGAGAAAAGGG - Intergenic
1079694482 11:23462841-23462863 AAGGGAGGATGAAGAGAGGTTGG - Intergenic
1079869145 11:25774280-25774302 CGGTGAGGATGTAGAGAAATTGG - Intergenic
1080085599 11:28277910-28277932 GAGAGAGGATGAAGAGAAGTGGG + Intronic
1080360499 11:31507667-31507689 CAGGGGGGATGGGGAGAATTTGG + Intronic
1080546229 11:33321645-33321667 CAGTGAGGATGAGGAGGAGGTGG + Intronic
1081011795 11:37822071-37822093 CAGAGAGGATGTGGAGAAATAGG - Intergenic
1081012690 11:37834994-37835016 GAGTGAGGAAGGAGGGAAGTGGG - Intergenic
1081477508 11:43449002-43449024 CAATGGGGATGGAGAAAAGTAGG - Intronic
1082774196 11:57233450-57233472 AAGTGAGGAGGGAGAGAGGATGG - Intergenic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1082901150 11:58254094-58254116 TGGTGAGGATGCAGAGAAGAGGG - Intergenic
1083370597 11:62176398-62176420 GAGAGAGGATGGAGAGCGGTTGG - Intergenic
1083847480 11:65344442-65344464 CAGGGTGGAGGGACAGAAGTGGG - Intronic
1083848888 11:65354109-65354131 CAGCGAGGCTGGAGAGCAGCTGG + Intergenic
1083902834 11:65652037-65652059 CAGTGACAGTGGGGAGAAGTGGG + Intergenic
1084825267 11:71725228-71725250 CAGTGAGAATGGAACCAAGTTGG + Intergenic
1085142565 11:74160598-74160620 GAGGGAGGATGGAGAGAGGTTGG + Intronic
1085143619 11:74171861-74171883 CAGGGAAGGTGGAGGGAAGTGGG + Intronic
1085381693 11:76125544-76125566 CAGTCAGGATGGAGAACAGCTGG + Intronic
1085472393 11:76766700-76766722 CAGGGAGGATGGAGAGGAGACGG - Intergenic
1085648487 11:78244793-78244815 CAGTGAGGATGTGGAGAAAAGGG + Intronic
1086182282 11:83967368-83967390 CAGTGAGGATGTGGAGAAAAGGG - Intronic
1086645472 11:89214390-89214412 TAGAGAGGATGTAGAGAAATAGG + Intronic
1086801697 11:91184057-91184079 CAGTGAGGAGGAATAGATGTGGG + Intergenic
1086829628 11:91543988-91544010 TAGTGAGGATGTGGAGAAATAGG - Intergenic
1086976227 11:93136357-93136379 TGGTGAGGTTGCAGAGAAGTAGG + Intergenic
1086999693 11:93402879-93402901 AAGGGAGAATGAAGAGAAGTTGG + Intronic
1087141903 11:94772363-94772385 GAGTGAGGATGGGGAGAAGAGGG - Intronic
1087195824 11:95303357-95303379 TAGTGAGGATGGAGAGGAGAGGG + Intergenic
1087339409 11:96883656-96883678 TAATGAGGATAGAGAGATGTTGG + Intergenic
1087346189 11:96973788-96973810 AAGGAAGGATGGAGAGAGGTTGG + Intergenic
1087353702 11:97066517-97066539 GAGGGAGGATGGAGCGAAGTGGG + Intergenic
1087445443 11:98245480-98245502 AAGTGAGGATGATGAGAGGTTGG - Intergenic
1087646690 11:100816284-100816306 TAGTGAGGATGCAGAGAAACTGG - Intronic
1087746266 11:101950953-101950975 TAGAGAGGATAGAGAGAAATTGG + Intronic
1088116035 11:106315916-106315938 CAGAGAGGAAGGAGGGGAGTTGG - Intergenic
1088212640 11:107473557-107473579 CAGTGAGGCTGGAATAAAGTAGG - Intergenic
1088241169 11:107775150-107775172 CACTCAGGCTGGAGTGAAGTGGG - Intergenic
1088365608 11:109036971-109036993 CAGGCAGGAAGGAGAGAAGGAGG - Intergenic
1088569438 11:111207332-111207354 CAGTGAGTAGAGAGAGAAGATGG - Intergenic
1088783083 11:113155147-113155169 CAGTGAGGAAGGAGAGGAACTGG + Intronic
1088875124 11:113929148-113929170 TGGTGAGGATGGGGAGAAATTGG - Intronic
1089070245 11:115694408-115694430 TGGTGAGGATGTAGAGAAATTGG - Intergenic
1089626885 11:119756558-119756580 TGGTGAGGATGTAGAGAACTTGG + Intergenic
1090668433 11:128930436-128930458 CAGGGAGGGTGGGGAGAAGAAGG - Intergenic
1090685213 11:129109557-129109579 CAGTGAGTATGCAGAGAAAAGGG - Intronic
1090718885 11:129454755-129454777 GAGGGAGGTTGGAGAGATGTTGG - Intergenic
1090732363 11:129582848-129582870 TGGTGAGGATATAGAGAAGTTGG - Intergenic
1090860754 11:130650428-130650450 CACCCAGGAAGGAGAGAAGTGGG - Intergenic
1091405992 12:209911-209933 CCCCGAGGAGGGAGAGAAGTTGG - Exonic
1091675657 12:2487283-2487305 CAGTGTCGATGGAGAAAATTAGG - Intronic
1092145981 12:6215006-6215028 GGGTGAGGATGCAGAGAGGTGGG - Intronic
1092518234 12:9238357-9238379 TAGTAGAGATGGAGAGAAGTGGG + Intergenic
1092566604 12:9672659-9672681 CAGGGAGGATGGAACCAAGTTGG - Intronic
1092794503 12:12096738-12096760 CGGTGAGGATGTGGAGAAATTGG + Intronic
1092927144 12:13281624-13281646 CAGTGATCATGGTGAGAAATGGG - Intergenic
1092992290 12:13914428-13914450 TAGTGAGGATGTGGAGAAATGGG + Intronic
1093344617 12:18025307-18025329 CAGGGAGAATGGAGCAAAGTTGG + Intergenic
1093793454 12:23283141-23283163 CAGTGAGGATACAGAGAAAAGGG - Intergenic
1094084385 12:26573761-26573783 CAGTGTGGATGGAGCAGAGTTGG + Intronic
1094668613 12:32546646-32546668 CATAGAGCATGGAGGGAAGTAGG + Intronic
1095127628 12:38500792-38500814 TAGAGAGGATGTGGAGAAGTAGG + Intergenic
1095355212 12:41264938-41264960 AAGTGAGGAGGGAAAGAAGGAGG + Intronic
1095375299 12:41520078-41520100 CAGTGTGGAGGAAGAGAAGAGGG - Intronic
1095490056 12:42724413-42724435 CAGTGAGAATGGAACCAAGTTGG - Intergenic
1095559161 12:43545109-43545131 CAGTGGGGAAGGAGAAGAGTGGG - Intronic
1095562197 12:43578822-43578844 CTGGGAGGAAGAAGAGAAGTTGG + Intergenic
1095716547 12:45352313-45352335 GAGTGGGGAGGGAAAGAAGTGGG - Intronic
1095857877 12:46881219-46881241 CAGTGAGGTTGTGGAGAAATAGG + Intergenic
1095907770 12:47395292-47395314 CAGGGAGGATAGGAAGAAGTTGG - Intergenic
1096360152 12:50978002-50978024 TAGAGAGGATGCAGAGAAATAGG + Intergenic
1096602159 12:52737040-52737062 CACAGAGGATGGAGAGATGAAGG - Intergenic
1096602899 12:52742693-52742715 CACAGAGGATGGAGAGATGAGGG + Intergenic
1096739876 12:53685274-53685296 TAGTGGGGATGGTGAGGAGTAGG + Intergenic
1096800204 12:54105637-54105659 CTGTGGGGATGCAGAGTAGTAGG - Intergenic
1096828241 12:54295411-54295433 GAGTGAGGATGGGGAGGAGGCGG - Exonic
1096910812 12:54981973-54981995 CAGTGTGGGAGGAGAGAAGAAGG + Intronic
1096934382 12:55255301-55255323 TGGTGAGGATGTGGAGAAGTAGG + Intergenic
1097097773 12:56563356-56563378 CAGTGGGGATGGAAGAAAGTGGG + Intronic
1097221247 12:57452457-57452479 CAGTGAGGGTGGGGAGAGGTGGG + Intronic
1097595735 12:61627407-61627429 AGGGGAGGATGAAGAGAAGTGGG + Intergenic
1097623168 12:61966139-61966161 CAGTGAAGATGAGGAGAAGTTGG - Intronic
1097650994 12:62297063-62297085 CAGGAAGGAAGGAGAGGAGTGGG + Intronic
1097701152 12:62821314-62821336 CAGGGAGAATGGAAACAAGTTGG + Intronic
1097893667 12:64803129-64803151 TAGAGAGGATGGGGAGAAATAGG - Intronic
1097917343 12:65035052-65035074 CAGGGAGAATGGAAACAAGTTGG - Intergenic
1097926951 12:65139324-65139346 CAGTGTGGCTAGAGAGAAATGGG - Intergenic
1097933503 12:65217856-65217878 CACTCAGGCTGGAGTGAAGTAGG + Intronic
1098179886 12:67834830-67834852 CAGTGAGGAAGATGAGAGGTTGG - Intergenic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1098634423 12:72764109-72764131 AAGTGAGGATAAAGAGAGGTTGG + Intergenic
1098671711 12:73238333-73238355 AGGAAAGGATGGAGAGAAGTTGG + Intergenic
1098908862 12:76188950-76188972 CAGTGTAGCTGGAGAAAAGTAGG - Intergenic
1099265868 12:80447040-80447062 CAGTGTGGATGCAGAGAAAAGGG - Intronic
1099697999 12:86045084-86045106 CATTGAGGGTGGACAGAAGGAGG - Intronic
1099892201 12:88603435-88603457 CAGAGAGGATGTGGAGAAATAGG - Intergenic
1099939605 12:89170108-89170130 AATTGAGGATAGAGAGGAGTTGG + Intergenic
1100024323 12:90109219-90109241 CACTGAGGATGGAGAAAATAGGG - Intergenic
1100100243 12:91094739-91094761 CAGTGTGTTTGGAGAGGAGTGGG + Intergenic
1100112306 12:91260398-91260420 GAGGGAGAATGAAGAGAAGTGGG + Intergenic
1100272202 12:93037230-93037252 TAGTGAGGATGTAGAGAAATTGG - Intergenic
1100432649 12:94544363-94544385 TGGTGAGGATGTAGAGAAATTGG + Intergenic
1100472815 12:94908857-94908879 AAGTGAGGTTGGAGAGAGCTGGG - Intronic
1100497405 12:95138633-95138655 CAGTGTGGTGGGAGAGAAATGGG - Intronic
1100521716 12:95381609-95381631 AAGGGAGGATGAAGAGAAGCGGG + Intergenic
1100815034 12:98378678-98378700 CAGTGTGGGTGAAGTGAAGTGGG - Intergenic
1100904515 12:99282300-99282322 CAGTGTGGCTGGAGCAAAGTGGG + Intronic
1100914633 12:99405608-99405630 GAGGGAGGAAGGAGAGAAGGAGG + Intronic
1101471471 12:105000646-105000668 CAGTGTGGATGGTAAGAATTTGG + Intronic
1101783497 12:107860907-107860929 CAGGGAGAATGGAGCCAAGTTGG + Intergenic
1101869592 12:108554004-108554026 CCCTGAGGTTGGAGAGACGTTGG - Intronic
1101873234 12:108582343-108582365 CACTGAGGAAGGACAGAGGTGGG + Intergenic
1101878029 12:108608300-108608322 CAGTGAGGATGGGGATGAGGGGG - Intergenic
1101931059 12:109014674-109014696 TGGTGAGGATGTAGAGAAATTGG - Intronic
1102392758 12:112562904-112562926 CAGTAGGGATAGGGAGAAGTGGG - Intergenic
1102602167 12:114039619-114039641 CACTCAGGATGGAGTGAAGTAGG - Intergenic
1102708528 12:114904923-114904945 TAGTGAGATGGGAGAGAAGTGGG + Intergenic
1103049109 12:117763852-117763874 CAGCAAAGATGGAGAGAAGTCGG + Intronic
1103254776 12:119531679-119531701 CAGTGAGTATGGAAGGAAGCAGG + Intronic
1103844292 12:123890726-123890748 CACTGGGGACAGAGAGAAGTGGG + Intronic
1103939000 12:124491873-124491895 CCCTGAGGATGGAGAGAATGAGG + Intronic
1104078991 12:125413974-125413996 TGGTGAGGATGTAGAGAAATTGG - Intronic
1104300614 12:127561832-127561854 GAGTGAAGATGGAAGGAAGTGGG + Intergenic
1104546069 12:129714057-129714079 CAGTGTGGTTGGAGGGAGGTAGG - Intronic
1104577383 12:129980263-129980285 CAGTGAAGATGGAAAGAATTGGG + Intergenic
1104675749 12:130710852-130710874 CTGTGAGGATTGGGAGCAGTGGG - Intronic
1104791306 12:131483750-131483772 CAGTAAGTCTGGAGACAAGTGGG + Intergenic
1105032058 12:132890884-132890906 CAGGCAGGAGGGAGAGAAGGAGG - Intronic
1105732563 13:23232927-23232949 TAGGGAGGATGCAGAGAAATTGG + Intronic
1105894981 13:24709860-24709882 CAATGAGCATGGAGAGAATCAGG - Intronic
1106117035 13:26826602-26826624 CAGGGAGGATGAAGAGAAGCAGG - Intergenic
1106155536 13:27152011-27152033 CAATGGGGATGCAGAGAAATGGG + Intronic
1106388499 13:29312044-29312066 CAGTGGGGTTGGAGGGATGTGGG - Intronic
1106653492 13:31717384-31717406 CATTGAAAATGAAGAGAAGTTGG - Intergenic
1106731740 13:32548407-32548429 TGGTGAGGATGTAGAGAAATTGG + Intergenic
1106914171 13:34494496-34494518 CAGGGAGAATGGAAACAAGTTGG + Intergenic
1107008043 13:35637299-35637321 TAGTGAGGATGTAGAGAAACTGG + Intronic
1107082152 13:36386467-36386489 TAGTGAGGATGTGGAGAAATTGG + Intergenic
1107131507 13:36901308-36901330 CAGTGAGGATGTAGAGAAATTGG - Intronic
1107146022 13:37061069-37061091 TAGTGAGGATGTGGAGAAATTGG - Intergenic
1107260492 13:38484785-38484807 TAGTGAGGATGTGGAGAAATTGG - Intergenic
1107755234 13:43614606-43614628 CAGTGAGCAGGGAGAGAAGGAGG - Intronic
1107897042 13:44975534-44975556 TTGTGGGGATGGAGAGAACTAGG - Intronic
1108129054 13:47277265-47277287 CATTGAGGAAGAATAGAAGTGGG + Intergenic
1108411439 13:50151655-50151677 TAGTGAGGATGGGGAGAAATTGG - Intronic
1108638223 13:52357256-52357278 TGGTGAGGATGCAGAGAAATTGG + Intergenic
1108885516 13:55177035-55177057 CATTCAGGATGGAAACAAGTTGG + Intergenic
1108955986 13:56157425-56157447 CAGGGAGGATGGAGGGAGGGGGG + Intergenic
1108998721 13:56767771-56767793 CAGAGAGGATGTAGAGAAATAGG - Intergenic
1109065130 13:57677589-57677611 CAGTAAGGAAGGAGAGGGGTAGG + Intronic
1109143370 13:58745306-58745328 CAGTGAGGGTGGGGGAAAGTAGG + Intergenic
1110009274 13:70311386-70311408 GAGTGTCAATGGAGAGAAGTTGG - Intergenic
1110018755 13:70442047-70442069 TAGTGAGGATGTGGAGAAATAGG - Intergenic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1110387926 13:74936367-74936389 CAGAGAGGATGTGGAGAAATAGG + Intergenic
1110525821 13:76535658-76535680 CAGTGAGGCTGTGGAGAAATAGG + Intergenic
1110642500 13:77841738-77841760 TAGTGAGAATGGGGAGAAATTGG - Intergenic
1110770594 13:79339263-79339285 CAGGAAGAATGGAGAGATGTTGG + Intronic
1111024171 13:82497602-82497624 CAATGAGAATGGGGAGAAATTGG - Intergenic
1111166584 13:84465129-84465151 CATGGAGGATGGAGTGAAGCAGG + Intergenic
1111203358 13:84969610-84969632 GAAGGAGGATGAAGAGAAGTTGG - Intergenic
1111266988 13:85829143-85829165 CAGTGAGGCTGGGGAGATGTTGG + Intergenic
1111788349 13:92820009-92820031 CAGAGAGGAAGCAGAGAAGAGGG - Intronic
1111846071 13:93510292-93510314 GAGGGAAGATGAAGAGAAGTGGG - Intronic
1111937108 13:94568952-94568974 CAATGAGGATGTAGAGAAATTGG - Intergenic
1112101188 13:96191131-96191153 CAGTGATAATGTAGAGAGGTGGG - Intronic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1112566800 13:100558836-100558858 GAGAGGGGATGGAGAGAGGTTGG + Intronic
1112588888 13:100745721-100745743 TGGTGAGGATGTAGAGAAATTGG + Intergenic
1113056707 13:106275835-106275857 CAGTCAGGGTGGAGCGGAGTTGG + Intergenic
1113181931 13:107638841-107638863 TAGTGAGGCTGGAGAACAGTGGG + Intronic
1114055449 14:18964215-18964237 AAGGGAGAATGAAGAGAAGTTGG + Intergenic
1114107096 14:19437548-19437570 AAGGGAGAATGAAGAGAAGTTGG - Intergenic
1114240773 14:20865618-20865640 TGGAGAGGATGCAGAGAAGTAGG + Intergenic
1114348430 14:21822954-21822976 CATTGAGGATGTGGAGAAATAGG + Intergenic
1114361019 14:21972801-21972823 CGGTGAGGATGTAGAGAAATAGG + Intergenic
1114450322 14:22821283-22821305 CAGTGAAGCTGGAGTGGAGTGGG - Intronic
1114593246 14:23889080-23889102 TAGTAAGGATGGAGAGAAACAGG + Intergenic
1114697123 14:24636429-24636451 CAGCAAGGATGCAGAGAAATAGG - Intergenic
1114877991 14:26747178-26747200 CGGTGAGGATGTAGAGAAAAAGG + Intergenic
1115143515 14:30200417-30200439 CAGAGATGATGAAGAGAAGGAGG - Intergenic
1115292398 14:31786996-31787018 CAGTGGAGAAAGAGAGAAGTGGG + Intronic
1115339870 14:32282050-32282072 TGGTGAGGATGTAGAGAAATTGG + Intergenic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1116051110 14:39804378-39804400 CAGAGAGGATGGAGTCAAGGAGG + Intergenic
1116123816 14:40755885-40755907 CAGGGAGAATGGAAACAAGTTGG - Intergenic
1116547730 14:46191348-46191370 TAGTGAGGATGTGGAGAAGAGGG + Intergenic
1116601037 14:46922870-46922892 TAATGCGGATGGAGCGAAGTAGG + Intronic
1116619268 14:47177661-47177683 CAGTGGGGAGGGATAGCAGTAGG + Intronic
1116648445 14:47560032-47560054 CAGTGAGGTTGCAGAGAAAAGGG - Intronic
1116803005 14:49463280-49463302 GAGTGAGGTGGGGGAGAAGTGGG - Intergenic
1116932272 14:50702375-50702397 CAGTGAGGAGGAACAGAATTGGG + Intergenic
1117124132 14:52603076-52603098 AGGGGAGGATGAAGAGAAGTTGG - Intronic
1117164340 14:53018697-53018719 GAGGGATGATGAAGAGAAGTGGG - Intergenic
1117356704 14:54930965-54930987 GAGTGAGGATGCAGAGAAACTGG - Intergenic
1117473206 14:56067552-56067574 AAGTGGGGATGGAGAGAACTGGG + Intergenic
1117612229 14:57496247-57496269 CAGAGGAGATGGAGAGAAGCAGG + Intergenic
1117840588 14:59856650-59856672 GATTGGGGGTGGAGAGAAGTCGG - Intronic
1117870279 14:60193433-60193455 CAGTGAGGATGTAGGGAAAATGG - Intergenic
1118057741 14:62099318-62099340 CACTGGGGATGGAAAGAAGTGGG + Intronic
1118159920 14:63277836-63277858 CAGAGAGAAAAGAGAGAAGTGGG + Intronic
1118227956 14:63920714-63920736 CCGTGGAGATGGAGAGAAATAGG + Intronic
1118263651 14:64272037-64272059 TAGTGAGGATGTAGAGAAAAGGG - Intronic
1118298559 14:64593474-64593496 CAGTGAGGATGTGGAAAAATTGG + Intergenic
1118372328 14:65147818-65147840 GAGGGAGGATGAAGAGAAGTGGG + Intergenic
1118760934 14:68879847-68879869 AAGTGAGGAGGGAGAGAAAGGGG - Intronic
1118772463 14:68951369-68951391 GAGTGAGGAGGGAGAGAAAGAGG + Intronic
1119204343 14:72782999-72783021 CAGTGAGGATGGAGCCCAGCGGG - Intronic
1119314984 14:73686078-73686100 TAGTGAGGATGTGGAGAAATTGG - Intronic
1119457774 14:74770946-74770968 TAGTTGAGATGGAGAGAAGTGGG + Intronic
1119599340 14:75964544-75964566 CAGTGAGGATGGACAACAGTTGG - Intronic
1119838377 14:77771481-77771503 TAGTGAGGATGCAGAGAAACTGG + Intergenic
1119894176 14:78205947-78205969 CAGTGAGGATAGAAAGGGGTAGG + Intergenic
1119927220 14:78506548-78506570 TAGTAAGGATGTAGAGAAATTGG - Intronic
1120021586 14:79537092-79537114 TAGTGAGGCTGTGGAGAAGTAGG - Intronic
1120086791 14:80284677-80284699 TAGAGAGGATGTAGAGAAATAGG - Intronic
1120112770 14:80577557-80577579 CAGAGAGCATGAAGAGGAGTGGG - Intronic
1120769939 14:88368042-88368064 CAGTGAGGTTGTAGAGAAAAAGG - Intergenic
1120800107 14:88678291-88678313 CAGGGAGGAGGGAGAGCATTGGG + Intronic
1120961808 14:90131790-90131812 CAGTGAGGAGACAGAGAAATTGG + Intronic
1120981304 14:90291711-90291733 GAGTGAGGACACAGAGAAGTGGG - Intronic
1121439889 14:93941969-93941991 GAGTGAGGTTGGACAGAAGGTGG + Intronic
1121456342 14:94041106-94041128 CAGTGGGCATGGCAAGAAGTGGG + Intronic
1122373779 14:101244423-101244445 CGGTGAGGATGGTGAGAAACTGG - Intergenic
1122401095 14:101467862-101467884 TGGGGAGGATGGAGAGAAGAGGG + Intergenic
1122403765 14:101484238-101484260 CAGGAGGGAGGGAGAGAAGTTGG + Intergenic
1122461350 14:101898118-101898140 CACTCAGGATGGAGTGAAGTTGG - Intronic
1122651825 14:103230607-103230629 CAGGAAGGAAGGAGAGAGGTGGG + Intergenic
1123180414 14:106464754-106464776 TAGTAAGGATGCAGAGAAGCAGG + Intergenic
1202946483 14_KI270726v1_random:31909-31931 TAGTAAGGATGCAGAGAAGCAGG - Intergenic
1123509361 15:20981081-20981103 CAGTGGGGATGGGGAGATATTGG - Intergenic
1123566583 15:21554821-21554843 CAGTGGGGATGGGGAGATATTGG - Intergenic
1123602844 15:21992114-21992136 CAGTGGGGATGGGGAGATATTGG - Intergenic
1124385541 15:29205452-29205474 TGGTGAGGATGTAGAGAAGTTGG - Intronic
1124659705 15:31536849-31536871 GAGGGACGATGAAGAGAAGTGGG + Intronic
1124888172 15:33706814-33706836 GGTTGAGGATGTAGAGAAGTTGG - Intronic
1124991323 15:34676890-34676912 CAGTGTGGTGGGAGAGCAGTGGG + Intergenic
1125282995 15:38063031-38063053 GAGTGGGTAGGGAGAGAAGTGGG - Intergenic
1125362314 15:38877047-38877069 AAGTGAGAATGGAGAGAAAGGGG + Intergenic
1125727127 15:41873825-41873847 CAGGTAGGATGCAGAGAGGTGGG - Exonic
1125768969 15:42152799-42152821 CAGCCAGGATGGAGAGAGGGAGG + Intronic
1125883298 15:43211064-43211086 CTCTGAGGATGGTGAGGAGTTGG + Intronic
1126086909 15:45019683-45019705 CAGGGAGAATGGAAACAAGTTGG - Intergenic
1126287690 15:47032919-47032941 CAGTGAGAATGTAGAGAAAAGGG - Intergenic
1126288375 15:47042867-47042889 CAGTGAGGATGTGGAGAAAAGGG - Intergenic
1126339930 15:47628394-47628416 TAGTGAGGATGCAGAGAAACTGG - Intronic
1126438407 15:48660386-48660408 CAGAGAGGAGGGAGAGATGAAGG + Intergenic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1126805489 15:52344539-52344561 CAGTTAGGATTGACAGAAATGGG - Intronic
1126930890 15:53649803-53649825 TTGTGAGGATGTAGAGAAATTGG + Intronic
1127172907 15:56322194-56322216 CAGTGTGGATAGAGAGGAGTAGG + Intronic
1127175150 15:56346237-56346259 CAGAGAGGCAGGAGAGAAGCAGG + Intronic
1128015138 15:64338234-64338256 TAGTGAGGATGTGGAGAAATTGG - Intronic
1128037887 15:64542750-64542772 AAGTGGGGATGGAGAGAAGGAGG - Intronic
1128261112 15:66233687-66233709 GAGTCATGTTGGAGAGAAGTGGG - Intronic
1128726332 15:69991185-69991207 CAGAGAGGAGGGAGAGAGGGAGG - Intergenic
1128931285 15:71706930-71706952 CCTGGAGGATGGAGAGGAGTTGG + Intronic
1128990773 15:72258210-72258232 CTGGGAGGATGGAGGGTAGTTGG - Intronic
1129275586 15:74443187-74443209 CAGTGGGGAAGGAGAGGAGGAGG - Intergenic
1129714612 15:77839866-77839888 TAGTGGGGTTGGAGAGAAATGGG - Intergenic
1129820986 15:78601864-78601886 CAGTGAGGAAGGAGATGAGCAGG + Exonic
1130063735 15:80588087-80588109 CAGTGAGAATGGAGGAAAGCAGG + Intronic
1130476056 15:84268699-84268721 CGGTGAGAATGGAGGCAAGTTGG - Intergenic
1130483477 15:84382753-84382775 CGGTGAGAATGGAGGCAAGTTGG - Intergenic
1130765967 15:86871553-86871575 GAGTGAGGAAGGAGAAAAGTCGG - Intronic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131150060 15:90042224-90042246 CAAGGAGGCTGGAGAGAAGGGGG - Intronic
1131836050 15:96392286-96392308 CTGTGAGGATGGAGTGAACTTGG + Intergenic
1131878774 15:96839702-96839724 CAGTGAGGATGTGGAGAAATTGG + Intergenic
1132202226 15:99962888-99962910 CAGTGAAGATAGGGAGAAGTGGG + Intergenic
1132277744 15:100583672-100583694 CACTGAGGAAGGGTAGAAGTAGG - Intronic
1132326089 15:100971754-100971776 CAGGGAGGACGAACAGAAGTGGG - Intronic
1132344040 15:101096852-101096874 GAGGGAGGATGGGGAGAAGTTGG + Intergenic
1132435720 15:101800210-101800232 GAGTGGGGATGGAGAGAACAGGG + Intergenic
1202974944 15_KI270727v1_random:281916-281938 CAGTGGGGATGGGGAGATATTGG - Intergenic
1132888003 16:2190883-2190905 CAGTGTGGATGAGCAGAAGTGGG + Intronic
1133305223 16:4804206-4804228 GAGGGAGGATGGAGAGCGGTGGG + Exonic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1134201765 16:12205094-12205116 CAGTGAAGATGGAGAGTCGTGGG + Intronic
1134264786 16:12683709-12683731 CACTGAGGATGGAGAGGAGATGG - Intronic
1134396318 16:13867378-13867400 TAGCGAGGATGGGGAGAAATTGG - Intergenic
1135141401 16:19925191-19925213 CAGTGAGGATGTTGAGAAATAGG - Intergenic
1135191501 16:20358238-20358260 CAGTGGAGATGAAGGGAAGTGGG + Intergenic
1135244426 16:20842976-20842998 CAGTGAAGATGTAGATAAGTTGG - Intronic
1135418857 16:22290657-22290679 CGGTGAGGATGAAGAGAAAGAGG + Intergenic
1135511454 16:23088101-23088123 CAGTGAAGATGGAGAGCACAGGG + Intronic
1135604347 16:23810181-23810203 CAGAAAGGATGGAAAGAACTGGG + Intergenic
1135865495 16:26098092-26098114 CAGAGAGGATGTGGAGAAATAGG + Intronic
1136398051 16:30003803-30003825 CAGTGGGGAAGGAGAGGAGGTGG + Intronic
1136554836 16:31001573-31001595 CAGTGATGATGAAGAGGAGGTGG - Exonic
1137467192 16:48720497-48720519 CATTGAGGAAGCAGAGAAGGTGG + Intergenic
1137578187 16:49617706-49617728 GGGAGAGGAGGGAGAGAAGTGGG - Intronic
1137669677 16:50271932-50271954 AAGGGAGGATGGTGAGAAGAGGG - Intronic
1138148056 16:54629888-54629910 CAATGAGGATGAGGAGAAGGAGG - Intergenic
1138470741 16:57233812-57233834 CAGTGAGGGTGATGAGTAGTTGG - Intronic
1138755116 16:59475187-59475209 TGGTGAGGATGCAGAGAAATAGG + Intergenic
1138786520 16:59852938-59852960 CATTGAGGAGGGAGAAAAGGAGG + Intergenic
1138933064 16:61685124-61685146 AATTGAGAATAGAGAGAAGTTGG + Intronic
1139258205 16:65563736-65563758 GAGGGAGGATGAAGAGAAGTGGG - Intergenic
1139620116 16:68132870-68132892 AAGTAAGGATGGGGAGAAGTTGG + Intronic
1140014478 16:71168358-71168380 CAGTGAAGGTGATGAGAAGTAGG - Intronic
1140153007 16:72391230-72391252 AAATGAGGAAGGAGAGAATTAGG + Intergenic
1141265567 16:82493877-82493899 CAAAGAGGAAGGAGAGAAGAGGG - Intergenic
1141524787 16:84604283-84604305 GAGTGAGGGTGGAGAGCAGGGGG - Intronic
1141603111 16:85138005-85138027 GAGGGAGGAAGGAGAGAAGAGGG - Intergenic
1141859937 16:86709670-86709692 CAGTGAAGCTGGAGAGAAGCAGG + Intergenic
1142012421 16:87722639-87722661 CAGGGAGGATGGTGAGCAGAAGG + Intronic
1142134178 16:88444094-88444116 AAGTGGGGTAGGAGAGAAGTGGG + Intergenic
1142591710 17:1009170-1009192 CAGTGGGGATGGACAGCAGTGGG - Intronic
1142591719 17:1009204-1009226 TAGTGGGGATGGACAGCAGTGGG - Intronic
1142649648 17:1339687-1339709 CAGTGAGGATGTGGAGTAGCTGG + Intergenic
1143042973 17:4053033-4053055 CAGTGAGAATGAACAGAAGTGGG - Intronic
1143054031 17:4149306-4149328 CAGTGAGGAGCTGGAGAAGTAGG + Intronic
1143488084 17:7266231-7266253 CAGTGAGTTTGGAGAGAAGCTGG - Intergenic
1143780815 17:9228375-9228397 CAGGGAGGCTGGAGAGAGGCTGG + Intronic
1143834740 17:9682087-9682109 CAGTGAGGAAGTAGAGGAATTGG - Intronic
1144051411 17:11500181-11500203 GACTGAGGATGGAGAGCAGCAGG - Intronic
1144415741 17:15044423-15044445 CAGCGATGATGGAGACAGGTGGG - Intergenic
1144505279 17:15824149-15824171 CAGTGAAGATGTGGAGAAATCGG - Intergenic
1145158887 17:20560963-20560985 GGGTGAGGAGGGAGAGGAGTGGG - Intergenic
1145838088 17:27969993-27970015 CAGTGAAGCTGGAGAAAAGAGGG - Intergenic
1145923032 17:28625717-28625739 CAGTGGGAATGGAGATAAGATGG - Intronic
1146210500 17:30938776-30938798 AAGGGAGGATGAAGAGAAGTGGG + Intronic
1146460366 17:33041426-33041448 CAGTGAGCAAGAAGAGATGTGGG - Intronic
1146621383 17:34401251-34401273 CAGGGAGGATGGGGCGGAGTGGG - Intergenic
1146696370 17:34911679-34911701 CAGTGTGGCTGGAGAGAGTTGGG + Intergenic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1146815780 17:35941130-35941152 TGGTGAGGATGTAGAGAAATTGG - Intronic
1147117548 17:38312936-38312958 CAGTGAGGATGTAGAGAAACTGG - Intronic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1147501503 17:40968559-40968581 TGGAGAGGATGGAGAGAAATTGG - Intergenic
1148412139 17:47476654-47476676 CAGTGAGGATGTAGAGAAACTGG + Intergenic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1148894461 17:50831772-50831794 CAGAGAGGAGGGAGAGACCTGGG - Intergenic
1149003987 17:51785526-51785548 CAGTGAAGATGTAGAGAAAAGGG + Intronic
1149106703 17:52976033-52976055 CAGTGAAGATGTGGAGCAGTAGG - Intergenic
1149630257 17:58116216-58116238 CAGTGGGGTAGCAGAGAAGTTGG + Intergenic
1149816467 17:59729633-59729655 TAGTGAGGATGTGGAGAAATCGG - Intronic
1149866972 17:60156539-60156561 CACTGAGCAGGGAGAGAAGGTGG - Exonic
1150017219 17:61570300-61570322 TAGTGAGGGTGTGGAGAAGTTGG - Intergenic
1150070165 17:62143571-62143593 TGGTGAGGATGTAGAGAAATTGG - Intergenic
1150106273 17:62464771-62464793 AGGTGAGGATGGAGACAGGTGGG + Intronic
1150194244 17:63278486-63278508 TGGTGAGGATGTAGAGAAATTGG + Intronic
1150317740 17:64183735-64183757 TAGTGAGGATGTAGAGAAATTGG - Intronic
1150532604 17:66000201-66000223 CAGTGAGGTTGCAGAGAAAAAGG - Intronic
1150836223 17:68566351-68566373 CACTGATTATGGAAAGAAGTTGG + Intronic
1151259629 17:72906338-72906360 TAGTCAGGATTGAGAGACGTGGG + Intronic
1151390783 17:73785444-73785466 CAGAGAGGATGGAGAGGAAGAGG + Intergenic
1151530344 17:74700294-74700316 AAGTGAGGCTGGAGTGAAGCAGG - Intronic
1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG + Intergenic
1152296024 17:79467361-79467383 CGGGGAGGAGGGAGAGAAGGTGG + Intronic
1152412772 17:80137448-80137470 CATTGAGGATACAGTGAAGTTGG + Exonic
1152840627 17:82565665-82565687 TAGTGAGGATGTGGAGAAATTGG + Intronic
1153092707 18:1366593-1366615 AAGTGTGGAGGGAGAGAAGGAGG - Intergenic
1153098343 18:1435428-1435450 CAGTGAAGTTGGAAAGAAGTAGG - Intergenic
1153196068 18:2597755-2597777 CAGTAAGGATTCAAAGAAGTAGG + Intronic
1153238025 18:3006957-3006979 CACTGAGGCTGGAGTGCAGTGGG - Intronic
1153376726 18:4388868-4388890 CAGTGAGGATGTGGAGAAACTGG + Intronic
1153546338 18:6209502-6209524 CAGTGAAGATGTGGAGAAATTGG + Intronic
1154158374 18:11960966-11960988 CTGTGAGGGTGGAGAGAGGAGGG + Intergenic
1154473184 18:14724633-14724655 CAGTGAAGATGCAGAGGAATTGG - Intergenic
1154935939 18:21056792-21056814 CAGTGTGGCTGGAGAGGATTAGG - Intronic
1155221128 18:23687101-23687123 TTGTGAGGATGTGGAGAAGTTGG - Intergenic
1155222921 18:23701709-23701731 CGCTGAGGATGAAGAGAAGCGGG + Intronic
1155351117 18:24907241-24907263 CAGTACAGGTGGAGAGAAGTAGG - Intergenic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1155627100 18:27846905-27846927 CAGTGGTGATGGACAGAAGTGGG - Intergenic
1155692277 18:28639787-28639809 CAGTGAAGATGTGGAGAAATTGG - Intergenic
1156425411 18:37005962-37005984 GAGGGAGGATGAGGAGAAGTTGG + Intronic
1156456394 18:37297039-37297061 CAGCGAGCAGGGAGAGAAGAGGG + Intronic
1156800641 18:41109283-41109305 CAGTGAGGAGGAAGAGGATTAGG - Intergenic
1156978201 18:43251866-43251888 CAGGGATGGAGGAGAGAAGTGGG + Intergenic
1157024992 18:43831842-43831864 CAGTGGAGAGGGAGAGAAGGGGG - Intergenic
1157137862 18:45074919-45074941 TGATGAGGATGCAGAGAAGTTGG - Intergenic
1157177502 18:45464975-45464997 CAGGCAGGCAGGAGAGAAGTAGG + Intronic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1157258158 18:46156678-46156700 CAGTGAGGATGGAGAACAGAGGG + Intergenic
1157483556 18:48071498-48071520 TGGTGAGGATGTAGAGAAATTGG + Intronic
1158514561 18:58120205-58120227 CAGCAAGGATGGAGAGAGGCAGG + Intronic
1158577984 18:58656316-58656338 CAGTGAGGAAGGAAGGAGGTAGG - Intergenic
1158801039 18:60909657-60909679 CAGTGAGAATGTAGAGAAACAGG + Intergenic
1158845341 18:61436389-61436411 TGGTGAGGATGTGGAGAAGTTGG - Intronic
1159046016 18:63368898-63368920 TAGTGAAGATGTAGAGAAATTGG - Intergenic
1159180780 18:64901247-64901269 TAGTGAGGATGTGGAGAAATTGG + Intergenic
1159254784 18:65931619-65931641 CAGTCAGGAGGCAGGGAAGTAGG - Intergenic
1159514497 18:69440119-69440141 CTGAGAAGAGGGAGAGAAGTGGG + Intronic
1159744195 18:72210995-72211017 CAGTGAAGATGCAGAACAGTTGG + Intergenic
1159763025 18:72452349-72452371 TAGTGAGGATGTAGAGAAAGGGG + Intergenic
1159827104 18:73226977-73226999 CAGTGAGGAGGGAGGGCAGGGGG - Intronic
1160140992 18:76322830-76322852 AAGTGAGTATGCAGAGACGTGGG + Intergenic
1160479748 18:79227702-79227724 CAGTGAGGAAGGAGAACAGTCGG - Intronic
1160758691 19:771829-771851 CAGGGAGGAAGGAGAGGAGAGGG - Intergenic
1160758731 19:771948-771970 CAGGGAGGAAGGAGAGGAGAGGG - Intergenic
1161198876 19:3003215-3003237 CAGGGAGGAGGGAGAGAGGAGGG + Intronic
1161635007 19:5382706-5382728 CAGTGAGGAAAGAGAGAGGAAGG - Intergenic
1161842697 19:6692561-6692583 CCATAAGGATGGAGAGAAGGAGG + Intronic
1161903311 19:7136059-7136081 CGGTGAGGATGAGGAGAAATCGG - Intronic
1161994386 19:7703596-7703618 CTGTGGGGATGGGGAGAAGCAGG - Intergenic
1162424012 19:10583180-10583202 CAGTGAGGAAGCAGGGAAGCTGG + Intronic
1162614827 19:11790490-11790512 CTGTGAGGATGTAGAGAAAAAGG + Intergenic
1163319698 19:16566893-16566915 TGGTGAGGATGAAGTGAAGTAGG + Intronic
1163620640 19:18357802-18357824 CCGTGATGGTGGGGAGAAGTGGG - Intronic
1163779708 19:19239911-19239933 GAGGGAGGAAGGAGAGAAGAGGG - Intronic
1164650482 19:29887581-29887603 CAGCAATGATGAAGAGAAGTTGG + Intergenic
1164676104 19:30102845-30102867 CTGTGAGGATGGTGAGAAGCTGG - Intergenic
1165230492 19:34383541-34383563 CAGTCAGGATGCTGAGAAGCAGG - Intronic
1165660008 19:37569801-37569823 GACTGAGGATAGAGAGAAGAGGG - Intronic
1166053291 19:40273931-40273953 CAGTGAGGCTGGAGAGCAGGCGG - Intronic
1166166078 19:40989820-40989842 CAGTGAGGATAGAGACATATGGG + Intergenic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
1166462432 19:43000643-43000665 CAGAGAGGATGTGGAGAAATAGG - Intronic
1166890281 19:45987571-45987593 GGGTGAGGATGGAGAGGAGGTGG - Intergenic
1167606313 19:50482609-50482631 CACAGAGGCTGGAGAGAAGGCGG - Exonic
1167608537 19:50494701-50494723 CAGAGAGGAGGGGGAGAAGCTGG + Intergenic
1167609011 19:50497238-50497260 GAGTGAGGAAGGAAAGAAGGAGG + Intergenic
1167623445 19:50571126-50571148 CAATTAGGGAGGAGAGAAGTTGG + Intergenic
1167724982 19:51205247-51205269 CGGTGAGGATGTGGAGAAATTGG + Intergenic
1167727642 19:51227352-51227374 TGGTGAGGATGTAGAGAAGAGGG - Intronic
1167744867 19:51344858-51344880 CAGTGAGGTGGGTGAGAAGAAGG - Intergenic
1168179478 19:54651063-54651085 CACTGAGGGTGGAGAGGAGGGGG - Intronic
1168470747 19:56638760-56638782 CAATGGGGATGGAGAGCAGTGGG - Intergenic
925449325 2:3954495-3954517 ACGTGAGGATGCAGGGAAGTGGG + Intergenic
925459951 2:4053262-4053284 GAGTGAGGATGAAGAAAGGTTGG - Intergenic
925560983 2:5195201-5195223 CAGTGAGATTGGATACAAGTTGG + Intergenic
925663579 2:6228668-6228690 CAGTGAAGATGGTCAGAAATAGG - Intergenic
925743362 2:7024973-7024995 TAGTGAGGACAGACAGAAGTGGG + Intronic
925981498 2:9180943-9180965 CAGAGATGATGGGGAGGAGTGGG - Intergenic
926583168 2:14654480-14654502 AAGTGAGGATGTTAAGAAGTAGG - Intergenic
927182955 2:20460154-20460176 CAGGGAGAATGGAGCCAAGTTGG + Intergenic
927253763 2:21021574-21021596 CAGAGATGATGGGGAGAGGTAGG - Intronic
927524398 2:23723622-23723644 CACTGAGGATGTAGAGAAAAGGG + Intergenic
927801491 2:26104215-26104237 TAGTGAGGATGTAGAGAAATTGG - Intronic
927982640 2:27384041-27384063 CAGTGAGGAGGCAGAGAATGAGG - Exonic
928199764 2:29240097-29240119 CAGGGAGGAGGGAGGGAAGAAGG + Intronic
928232079 2:29506882-29506904 CAGTGAGGATGTAGAGACATTGG + Intronic
928326206 2:30321663-30321685 CATTGAGGAGGGAAAGAAGCGGG - Intronic
928404945 2:31007568-31007590 CACTGTGGATGTAAAGAAGTTGG - Intronic
928922374 2:36539136-36539158 CAGAGAGGCTGGGGAGAAGTGGG + Intronic
928935698 2:36675528-36675550 TGGTGAGGATGTAGAGAAATTGG + Intergenic
929099769 2:38300689-38300711 CACTGAGGCTGGAGTGCAGTGGG + Intronic
929255625 2:39808330-39808352 TAGAGAGGATGTAGAGAAATAGG - Intergenic
929604113 2:43224283-43224305 CAGTGAGGAGGAAGGGAAGGCGG - Exonic
929647335 2:43640576-43640598 TGGTGAGGATGTAGAGAAATGGG - Intronic
929734898 2:44537531-44537553 TGGTGAGGATGGAGAGAAAAGGG + Intronic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
929910113 2:46082618-46082640 CAGTGAGGATGGGGAGCATCTGG + Intronic
929964402 2:46522874-46522896 CAGTGAGGCCGTAGAGAAATAGG - Intronic
930246596 2:48989977-48989999 CAGAGAGGAAGGAGATAAGCAGG - Intronic
930253266 2:49060195-49060217 CGGTGAGGATGCAGAGAAAAAGG + Intronic
930263373 2:49172191-49172213 GAATGATGATGGAGAGAGGTGGG + Intergenic
930307208 2:49689727-49689749 CAGTGAGGATGCATAGAAACTGG - Intergenic
930875780 2:56213997-56214019 CAGTGAGGCTGGAGAGACATTGG + Intronic
931142704 2:59480920-59480942 TAGGGAGGATGGGGAGATGTTGG + Intergenic
931424699 2:62160155-62160177 TAGGGAGGATGCAGAGAAATTGG + Intergenic
931787500 2:65633358-65633380 AAGGGAGGATGGGGAGAGGTTGG - Intergenic
931810646 2:65851422-65851444 TAGTGAAGATGGAGAGAAGTGGG + Intergenic
932054724 2:68432732-68432754 AAGAGAGGATGGAGAGATGATGG - Intergenic
932326301 2:70864267-70864289 CCATGTGGATGGAGAGAAGTAGG - Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932881208 2:75503782-75503804 GAGGGAGGATGAAGAGAAGCGGG + Intronic
932922169 2:75929134-75929156 CAGTTATGAGGGAGAGAATTGGG - Intergenic
933350026 2:81142083-81142105 GAGAGGGGATGAAGAGAAGTTGG - Intergenic
933676613 2:85063204-85063226 CAGTGAAGATGGTGGGAAGGGGG - Intergenic
934087901 2:88525509-88525531 CAGGGAAGATGGGGAGGAGTGGG + Intronic
934698397 2:96417297-96417319 TGGTGAGGATGCAGAGAAGTAGG - Intergenic
934703211 2:96460216-96460238 CGGTGAGGATGTGGAGAAATAGG + Intergenic
934784399 2:96994460-96994482 CAAAGAGGATGGAGAGCAGAAGG - Intronic
934856195 2:97731904-97731926 CAGTGAGGAGGGAGGGCAGCTGG - Intronic
934874340 2:97901800-97901822 GAGGGAGGATGAAGAGAGGTAGG + Intronic
935121357 2:100186194-100186216 GAGGGAGGATGGAGACAAGGGGG - Intergenic
935275978 2:101475466-101475488 TGGTGAGGATGTAGAGAAATTGG + Intergenic
935551186 2:104457113-104457135 CAGTGAGGATGCAGAGAAACTGG - Intergenic
935786825 2:106557125-106557147 CAGGGAGGAGGGGGTGAAGTTGG + Intergenic
935888523 2:107649786-107649808 CTGGGAGGAGGGAGAGAATTAGG + Intergenic
935951968 2:108338076-108338098 CAGAGAGGATGTGGAGAAATAGG + Intergenic
936272979 2:111065883-111065905 AAGTGAGGATGAAGAGAAACTGG + Intronic
936528785 2:113260569-113260591 TAGGGAGGATGGGGAGAAGGGGG + Intronic
936719575 2:115234608-115234630 CAGTGTGCATGGTGAGAAGGTGG - Intronic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
937239711 2:120452219-120452241 CAGTGGGGATGGAGTGAAAGTGG - Intergenic
937299054 2:120827395-120827417 TGGTGAGGATGTGGAGAAGTTGG + Intronic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
937464288 2:122116749-122116771 GAGGGAGTATGAAGAGAAGTGGG - Intergenic
937545720 2:123017120-123017142 CAATGAGGATGGGGAGATGTTGG + Intergenic
937769751 2:125706561-125706583 CAGTGAGGCTGAAGAGAAATAGG + Intergenic
937862050 2:126718945-126718967 CAGTGAGGATGGATAGAGATGGG + Intergenic
938031420 2:127997635-127997657 CAGTGGGGATGGTGAGCAGGGGG + Intronic
938147130 2:128844879-128844901 CGGTGAGGATGCGGAGAAATGGG - Intergenic
938473613 2:131588792-131588814 AAGGGAGAATGAAGAGAAGTTGG + Intergenic
938611033 2:132948012-132948034 CTGTGAGGATGCTGAGAAGTTGG - Intronic
939001657 2:136743098-136743120 AAGGAAGGATGAAGAGAAGTGGG - Intergenic
939017981 2:136923590-136923612 TAATGAAGATGGAGAGAAATTGG - Intronic
939018344 2:136927942-136927964 AAGTCAGGAGGGAGAGAAGTGGG + Intronic
939180547 2:138797485-138797507 CAGGGAGAATGGAAACAAGTTGG + Intergenic
939382719 2:141457112-141457134 GAGTTTGGATGGACAGAAGTAGG + Intronic
939389201 2:141544704-141544726 CACTGAGGCTGGAGTGCAGTGGG + Intronic
939424660 2:142019558-142019580 CAATGGGGAAGGATAGAAGTGGG - Intronic
939800893 2:146706580-146706602 TAGTGAGGATGTAGAGAAAAGGG + Intergenic
939945319 2:148402518-148402540 CATGGAAGATGGGGAGAAGTAGG - Intronic
940277909 2:151958655-151958677 TAGTGGGGATGGAGAGGAGGAGG - Intronic
940295110 2:152114516-152114538 CAGTGAGGATGTGGAGAAATTGG + Intergenic
940625829 2:156173659-156173681 CTGAGAGGCAGGAGAGAAGTTGG - Intergenic
940842076 2:158595301-158595323 CAATAAGCATGGTGAGAAGTAGG - Intronic
940947992 2:159639755-159639777 CAGGAAGGAAGGAGAGAAGGAGG + Intergenic
941011133 2:160300361-160300383 CACTGAGGATGGTGATAAGGTGG + Intronic
941151183 2:161917674-161917696 CAGTGAGGATGCAGAATAATTGG - Intronic
941608597 2:167632427-167632449 CAGAGAGGATGTTGAGAAATAGG - Intergenic
941947920 2:171120650-171120672 TAGTGAGGATGTGGAGAAATTGG + Intronic
941958108 2:171225477-171225499 CAGCAAGGATGTGGAGAAGTTGG + Intronic
942392940 2:175515039-175515061 TTATGAGGATGGAGAGAAGAGGG + Intergenic
942529902 2:176898391-176898413 TGGTGAGGATGGAGAGAAAAGGG - Intergenic
942613062 2:177762091-177762113 CTGTGAGGATGGACAGGAGCAGG + Intronic
942876981 2:180812450-180812472 TACTGAGGATGCAGAGAAATGGG - Intergenic
943334782 2:186600307-186600329 TATTGAGGATGGAGGGGAGTGGG - Intronic
943409955 2:187534112-187534134 CAGGGAGAATGGAAAGAAGTTGG + Intronic
943490631 2:188551301-188551323 AAAGGAGGATGAAGAGAAGTGGG - Intronic
943572454 2:189589826-189589848 GAGTAAGGATGAAGAGAAGTTGG - Intergenic
943770616 2:191712498-191712520 CACTTAGGATCGGGAGAAGTGGG + Intergenic
943872519 2:193018985-193019007 TAGCAAGGATGTAGAGAAGTTGG - Intergenic
943901676 2:193446684-193446706 CAGTGAGGATGCAGAGAAAAAGG - Intergenic
944043438 2:195381516-195381538 CAGTGAGGATGTGGAGAAAAGGG + Intergenic
944105064 2:196070622-196070644 TAATGAGGATGTAGAGAAATTGG + Intergenic
944117411 2:196204297-196204319 TGGTGAGGATGTAGAGAAATTGG - Intronic
944303381 2:198151116-198151138 TAGTGAGGATGTGGAGAAATTGG + Intronic
944938820 2:204599820-204599842 TAGTGAGGATGCAGAGAAACAGG - Intronic
945901178 2:215539429-215539451 CAGGGATGATAAAGAGAAGTGGG - Intergenic
946172995 2:217906310-217906332 GAGTGTGGATGGGGAGAAGAAGG - Intronic
946226303 2:218265770-218265792 CAGGAAGGAAGGAGAGGAGTCGG + Intronic
946419968 2:219559183-219559205 CAGAGAGGAGGTAGAGAGGTAGG - Intronic
946434010 2:219640305-219640327 CCGTGAGGATGGAGAGGCCTGGG - Intronic
946490426 2:220144086-220144108 CACAGAGGAGGGAGAGAAGTGGG - Intergenic
946512219 2:220370379-220370401 CAGTGCAGGTGGTGAGAAGTGGG - Intergenic
947130010 2:226912212-226912234 TAGTGAGGATGTGGAGAAATTGG + Intronic
947259043 2:228199769-228199791 CAGAGAGGATGTGGAGAAATAGG - Intergenic
947544083 2:230998734-230998756 TGGTGAGGATGTAGAGAAGCTGG + Intronic
947941874 2:234064011-234064033 CAGAAAGGAAGGAGAGAAGTTGG + Intronic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948281457 2:236750489-236750511 CAGTGAGCACAGAGAGATGTAGG + Intergenic
948360171 2:237414246-237414268 CAGTGAGGAGGGGGAGAGGAGGG - Exonic
948512265 2:238476488-238476510 CAGTGAGGCTGGAGTGCAGAGGG + Intergenic
948551600 2:238776244-238776266 CAGTGGGGAAGGGGAGATGTCGG + Intergenic
948690826 2:239703475-239703497 CATTGAGGATACAGAGAAGTTGG - Intergenic
949046322 2:241874131-241874153 CACTGAGGCTGGAGGGAAGAGGG - Intergenic
1168796287 20:611984-612006 CAGAGAGGAGGGGGAGAAGGGGG - Intergenic
1169005526 20:2204144-2204166 CAGTGTGGCTGGAATGAAGTGGG - Intergenic
1169110957 20:3033394-3033416 CAGTTACGCTGGAGAAAAGTGGG - Intronic
1169170760 20:3463058-3463080 TGGTGAGGATGTAGAGAAATTGG - Intergenic
1169250075 20:4053555-4053577 AAGGGAGGATGGGGAGAGGTTGG + Intergenic
1169322793 20:4648134-4648156 TGGTGAGGATGTAGAGAAATTGG + Intergenic
1169439568 20:5622818-5622840 CAATGTGCATGGAGAGAAGGTGG + Intergenic
1169550157 20:6694252-6694274 CAGAGAGGATGTGGAGAAATAGG + Intergenic
1169636931 20:7702774-7702796 CAATGAGGAGGGAGAGCAGCAGG - Intergenic
1169688108 20:8299827-8299849 AAGTGAAAATGGAGAGAAGTGGG - Intronic
1169957768 20:11124656-11124678 CAGTCAGGATGGAGAGGGGATGG + Intergenic
1170037695 20:12006010-12006032 CAGAGAGGAAGGAGAGGGGTTGG - Intergenic
1170508579 20:17054299-17054321 CAGTGAGGAGGAACAGAATTGGG + Intergenic
1170687689 20:18584345-18584367 CAGGAGGGATGGAGAGAAGAGGG + Intronic
1170881961 20:20304729-20304751 CAGTGAGGGTGTGGAGAAGTGGG + Intronic
1171119745 20:22558089-22558111 CAAAGAGGATGGAGCGTAGTAGG - Intergenic
1171247555 20:23624542-23624564 GGGGGAGGATGAAGAGAAGTGGG + Intergenic
1171396223 20:24835464-24835486 CAGTGAGACAGGAGAGAGGTTGG + Intergenic
1171816777 20:29792725-29792747 CAGTGAGGATGGATGGATTTTGG - Intergenic
1172054809 20:32146749-32146771 CGGTGAGGATGAGGAGAAGTTGG - Intronic
1172388105 20:34548026-34548048 CAGTGACGGTGGAGACAGGTGGG + Intronic
1172459710 20:35108194-35108216 TAGTGAGGATGTGGAGAATTTGG - Intergenic
1172482602 20:35279782-35279804 CATTGAGGAGGGAGAGAATTTGG - Intronic
1172601446 20:36186374-36186396 TATTGAGGATGGAGGGAATTAGG + Intronic
1172789598 20:37493702-37493724 CAGTGCAGATGGAGAGAAGGCGG - Intronic
1172865898 20:38097045-38097067 CAGTGAGGATGTGGAGAAACTGG - Intronic
1173230945 20:41197073-41197095 CAGGGCTGATGGAGAGAAGAAGG + Intronic
1173285008 20:41662377-41662399 AAGTGAGAATGGAGAAAAATGGG + Intergenic
1173409120 20:42794069-42794091 AAGCTAGGATGGAAAGAAGTGGG - Intronic
1173527657 20:43745296-43745318 CTGGGAGGAGAGAGAGAAGTAGG - Intergenic
1173693807 20:44989244-44989266 TGGCGAGGATGCAGAGAAGTTGG - Intronic
1173861684 20:46287917-46287939 CAGTGAGGTTGGAGAGGAGTGGG + Intronic
1173915844 20:46708587-46708609 TGGTGAGGTTGGAGAAAAGTAGG - Intergenic
1174251108 20:49220312-49220334 CAGTGTGAATGGAGAGAGGCGGG - Intronic
1174839543 20:53888577-53888599 TGGTGAGGATGTAGAGAAATTGG - Intergenic
1174926826 20:54769547-54769569 CAGGCAGGATGGGGAGAAGCAGG + Intergenic
1174953723 20:55072659-55072681 AAGAGAGGATGGAGACAGGTTGG - Intergenic
1175041439 20:56055397-56055419 CAGAGAGGATGCAGAGAAATAGG + Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175357029 20:58376600-58376622 CAGTCAGGATGGATGGAAGAAGG - Intergenic
1175596022 20:60233538-60233560 CAGTAAGGAAGAAGAGAAGGAGG - Intergenic
1175683451 20:61008671-61008693 CTGGGAGGGTGGAGAGAAGATGG - Intergenic
1175696424 20:61106202-61106224 CAGAAAGGCTGGAGAGAGGTGGG + Intergenic
1175930503 20:62491728-62491750 CAGAGAGGAAGGAGAGAGGGAGG - Intergenic
1176036214 20:63038351-63038373 CAGAGAGGATGTGGAGAAGTTGG - Intergenic
1176195447 20:63834764-63834786 CAGTGAGGGTGGAGGGCAGGTGG - Intergenic
1176801300 21:13433216-13433238 CAGTGAAGATGCAGAGGAATTGG + Intergenic
1177336321 21:19733139-19733161 CAGAGAGGATGTGGAGAAATAGG - Intergenic
1177433127 21:21016069-21016091 CAATGAGTATTGAGGGAAGTTGG - Intronic
1177681767 21:24380322-24380344 CCGTGAGGATGTGGAGAAATAGG - Intergenic
1177694735 21:24556366-24556388 CAGGGAGAATGGAACGAAGTTGG + Intergenic
1177722930 21:24930180-24930202 AAGTGGAGATGGAGAGAAGGGGG - Intergenic
1177794175 21:25755594-25755616 CAGGGAGGAGGTAGAGAAGGTGG + Intronic
1178009994 21:28273733-28273755 CATTGAGAATGGTTAGAAGTGGG - Intergenic
1178017108 21:28360063-28360085 TGGTGAGGATGTGGAGAAGTTGG - Intergenic
1178095512 21:29211104-29211126 TGGTGAGGATGTAGAGAAATTGG + Intronic
1178275289 21:31231274-31231296 CAGTCAGGATGGATAGAATTAGG - Intronic
1178289353 21:31353728-31353750 TAGTGAGGTTGGAGAGAGCTGGG - Intronic
1178395926 21:32243564-32243586 CGGTGAGGATGCAGAGAAACTGG + Intergenic
1178529228 21:33361324-33361346 CGGAGCGGATGGAAAGAAGTAGG + Intergenic
1179045021 21:37836248-37836270 TAGAGAGGATGTGGAGAAGTAGG + Intronic
1179252752 21:39686759-39686781 CAGTGAGATTGGTGAGATGTAGG + Intergenic
1179366571 21:40764458-40764480 TGGTGAGGATGCAGAGAAATAGG + Intronic
1180084755 21:45503203-45503225 CGGAGAGGATGTAGAGAAATAGG - Intronic
1180473927 22:15686767-15686789 AAGGGAGAATGAAGAGAAGTTGG + Intergenic
1180629219 22:17215808-17215830 CATGGGGGATGAAGAGAAGTTGG + Intronic
1180966444 22:19790444-19790466 CAGTGAGGTGGGAGAGGAGAAGG - Intronic
1180977636 22:19857850-19857872 TGGTGAGGATGTGGAGAAGTTGG - Intergenic
1181000809 22:19987057-19987079 CAGACAGGTTGGAGGGAAGTTGG - Intronic
1181498914 22:23304702-23304724 CGGTGAGGATGTAGAGAAATGGG - Intronic
1181595025 22:23908501-23908523 CAGTGAGGATGGCCAGATCTGGG + Intergenic
1181711907 22:24696398-24696420 CAGTGACCATGGAGAGAGCTCGG + Intergenic
1181755633 22:25022450-25022472 CAGTGAGCATTGGCAGAAGTAGG + Intronic
1182306868 22:29375883-29375905 TGGTGAGGATGGGGAGAGGTAGG - Intronic
1182378265 22:29864770-29864792 TGGTGAGGATGCAGAGAAATTGG - Intergenic
1182859929 22:33550563-33550585 TAGTGAGGATGTGGAGAAGACGG + Intronic
1182868384 22:33624868-33624890 CAGTGGGGATGGAGAGAACGGGG + Intronic
1183698772 22:39438103-39438125 GAGTGAGGAGGGAGGGAAGGGGG - Intergenic
1183724559 22:39581217-39581239 AAGTGGGGAGGCAGAGAAGTGGG + Intronic
1183733486 22:39630970-39630992 CAGGGAGGATGGAGGGAGGTGGG + Intronic
1184108623 22:42382818-42382840 CAGTGAGCAAGGAGAGAGGCAGG - Exonic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1184639266 22:45860460-45860482 CAGGGAGGATGGAAAGGAGGAGG - Intergenic
1185160619 22:49226979-49227001 TGGTGAGGATGTAGAGAAATGGG + Intergenic
1185307065 22:50125114-50125136 CAGGGAGGGTGGACAGGAGTGGG + Intronic
949143872 3:671263-671285 AGATGAGGATGGAGAAAAGTTGG + Intergenic
949380557 3:3440793-3440815 TAGTGAGGATGTAGAGAAATTGG + Intergenic
949393754 3:3592580-3592602 CAGTGAGGTTGTAGAGAAAAAGG + Intergenic
949466071 3:4345078-4345100 CAGGGAGAATGGAAACAAGTGGG + Intronic
949466451 3:4349342-4349364 TAGTGAGGCTGTGGAGAAGTAGG + Intronic
949745821 3:7291071-7291093 CAGTGAGGATGCTGGGAAGAGGG - Intronic
949893464 3:8751014-8751036 CGGTGAGGATGTAGAGAAACTGG - Exonic
949916876 3:8971965-8971987 CAGTGAGAAAGGAGGGAAGCTGG + Intergenic
950011579 3:9727898-9727920 CAGTGGGGAGGGAGAGAAAGTGG + Intronic
950139890 3:10608196-10608218 CAGTGTGGATGGAGTGAGGAGGG - Intronic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
950590790 3:13934736-13934758 AAGTGAGGAGGAAGAGAAGCTGG + Intergenic
950608132 3:14102871-14102893 CAGTGAGGCTGCAGAGAAAATGG + Intergenic
950615426 3:14154146-14154168 CAGTGAGGATGTGGAGAAAGTGG + Intronic
950689469 3:14644102-14644124 CAGGGAGGATGCAGAGATGATGG + Intergenic
950728948 3:14939414-14939436 CAGGCAGGATGGAGGGAGGTAGG + Intergenic
950925070 3:16732212-16732234 CAGGGAGAATGGAGCCAAGTTGG + Intergenic
951031077 3:17882301-17882323 CACTGAGGCTGGAGTGCAGTGGG + Intronic
951214917 3:20014740-20014762 CACTGGGGATGGAGACAAGTGGG - Intergenic
951281240 3:20752550-20752572 ACTTGAGGATTGAGAGAAGTGGG - Intergenic
951433330 3:22633633-22633655 CAGTGAGGATGTGGAGAAATTGG - Intergenic
951747978 3:26000213-26000235 TAGTGAGGTTGCAGAGAAATGGG - Intergenic
951875273 3:27417854-27417876 CGGTGAGGATGCAGGGAAATAGG + Intronic
952120530 3:30237976-30237998 TAGTGAGGATGTAGAGAAAAGGG - Intergenic
952549006 3:34454741-34454763 TGGTGAGGATGCAGAGAAATAGG - Intergenic
953047388 3:39306073-39306095 CAGGGAGAATGGAACGAAGTTGG + Intergenic
953193501 3:40711500-40711522 GGGGGAGGATGAAGAGAAGTGGG - Intergenic
953295182 3:41708020-41708042 CAGTGAGGATGTATAGAAAAGGG + Intronic
953471753 3:43173314-43173336 AAGTGAGGGTGAAGAGAGGTAGG - Intergenic
953681097 3:45038800-45038822 CTGTCAGGAGGGAGAGAATTAGG - Intergenic
953689998 3:45109850-45109872 CAGTTAGGATGATGAGAATTAGG - Intronic
953783431 3:45892555-45892577 CCTTGAGGATGGAGGGAGGTAGG + Intronic
953813421 3:46133555-46133577 CATTGAGGATGGAGAGCTGAAGG - Intergenic
953849485 3:46455071-46455093 CCGTGGGGCTGGTGAGAAGTTGG + Intronic
953975258 3:47377380-47377402 GAGAGAGGAAGGGGAGAAGTAGG - Intergenic
954534276 3:51346771-51346793 TGGAGAGGATGGGGAGAAGTAGG - Intronic
954667151 3:52261780-52261802 TGGTGAGGATGCAGAGAAATTGG + Intronic
954672877 3:52299884-52299906 CAGGGAGGGAGGAGAGAAGTGGG + Intergenic
954855554 3:53641065-53641087 CAGTGAGTATGCAGATATGTGGG + Intronic
954959085 3:54548853-54548875 GAGTGAGGAAGAAGAGAAGATGG - Intronic
955711067 3:61779537-61779559 CAGTGAAGATGGAGGGATGTAGG + Intronic
955791331 3:62591471-62591493 CCCTGAGGAGGGAGAGAATTTGG + Intronic
956112597 3:65884737-65884759 AAGTGGGGATGGAGAGATGGAGG - Intronic
956220242 3:66894573-66894595 CAGGGAGAATGGAGCCAAGTTGG + Intergenic
956253380 3:67257962-67257984 TAGTGAGGATGTAGAGAAAAGGG + Intergenic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
956456455 3:69425664-69425686 CAGTGAGGATTGAATGAATTGGG - Intronic
956471625 3:69573150-69573172 CAGTGAAGATAGAGAGAAGAGGG + Intergenic
956839336 3:73122644-73122666 TGGTGAGGATGCAGAGAAATTGG + Intergenic
956993434 3:74795754-74795776 CAGTGAGAATGGAACCAAGTTGG + Intergenic
957481420 3:80801880-80801902 CAGTGAGGATGCAGAGAAAATGG + Intergenic
957493944 3:80966408-80966430 CAGAGAGGATGTGGAGAAATAGG + Intergenic
957800536 3:85074152-85074174 TAATGTGGCTGGAGAGAAGTGGG - Intronic
957948893 3:87098373-87098395 CAGTGAGGGTGGAGCCAAGATGG - Intergenic
958133442 3:89458653-89458675 CAGCGAAGATGCAGAGAAATAGG - Intronic
958495042 3:94834316-94834338 CAGTGAGGTTGCAGAGAAAAGGG + Intergenic
958512885 3:95071725-95071747 TAGTGAGGATGTGGAGAAATTGG + Intergenic
958826438 3:99036321-99036343 CAGGGAGCATGGAAACAAGTTGG + Intergenic
959068961 3:101685137-101685159 TGGTGAGGATGGGGAGAAATTGG - Intronic
959304851 3:104649291-104649313 TGGTGAGGATGGAGAGAAAAGGG - Intergenic
959495292 3:107043187-107043209 CAGAGAGGAAGGAGAGGATTAGG + Intergenic
959760307 3:109955262-109955284 GAGAGGAGATGGAGAGAAGTTGG - Intergenic
959764824 3:110013169-110013191 TAGGGAGGATGTGGAGAAGTAGG + Intergenic
960000428 3:112725653-112725675 CAGGGAGAATGGAAACAAGTTGG + Intergenic
960173335 3:114488594-114488616 TAGTGAGGATGCAGAGAAATGGG + Intronic
960215781 3:115035582-115035604 TAGTGAGGATATGGAGAAGTTGG + Intronic
960302731 3:116023643-116023665 CAGTGAGCATGAAGAGAGGAAGG - Intronic
960329139 3:116336648-116336670 TGGTGAGGATGGGGAGAAATTGG + Intronic
960382925 3:116986614-116986636 CAGAGAGGATGTGGAGAAATAGG + Intronic
960429795 3:117555496-117555518 CAGAGAGGATGTGGAGAAATAGG + Intergenic
960746918 3:120900807-120900829 CAGGGAGAATGGAAACAAGTTGG - Intergenic
960832225 3:121862269-121862291 CAGAGAGAATGGAAACAAGTTGG - Intronic
960930915 3:122848945-122848967 GTGGGAGGATGAAGAGAAGTTGG - Intronic
960975347 3:123168108-123168130 TAGTGAGGATGAAGAGAAACTGG - Intronic
961053328 3:123766283-123766305 GAATGAGGGTGGAGAGAAATAGG - Intronic
961369603 3:126421507-126421529 AAGCAGGGATGGAGAGAAGTGGG + Intronic
961476250 3:127147956-127147978 GAGGGAGGAGGGAGAGAAGAAGG + Intergenic
961635713 3:128331215-128331237 CACTGAGGAAGGGGAGAAGAGGG - Intronic
961640081 3:128359751-128359773 CTGTGAGGATGGAAAGCTGTGGG + Intronic
961769510 3:129238639-129238661 TAGTGAGGATGTAGAGACATTGG - Intergenic
962132754 3:132699223-132699245 CAGTGAGGATGGGGAGAAGTGGG - Intronic
962152261 3:132905135-132905157 CAGTGAGGATGAGGAGAAAGTGG + Intergenic
962275113 3:134006956-134006978 TTTTGAGGATGGAGAGAAATTGG - Intronic
962480096 3:135790517-135790539 TAGAGAGGATGTAGAGAAATAGG - Intergenic
962553943 3:136527191-136527213 CAGGGAGAATGGAAACAAGTTGG - Intronic
962588837 3:136868366-136868388 CACTCAGGATGGAGTGCAGTGGG + Intronic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
963024434 3:140904759-140904781 CAGTGGAGATGGTGAGAACTGGG + Intergenic
963087610 3:141453121-141453143 CAGTGAAGATAGAGAGAAAGGGG + Intergenic
963202604 3:142600220-142600242 CAGTGAGGAGGGAGTGAGGCTGG + Intronic
963390822 3:144661631-144661653 CTGTGAGGATGCAGAGCAATTGG - Intergenic
963398997 3:144773239-144773261 CACTGAGTATGGAGAAGAGTGGG - Intergenic
963435089 3:145257220-145257242 CAGGGAGAATGGAAACAAGTTGG - Intergenic
963484553 3:145919431-145919453 CAGGGAGAATGGAAACAAGTTGG + Intergenic
963491835 3:146011439-146011461 TAGTGAGGATGTGGAGAAATTGG - Intergenic
963531135 3:146474734-146474756 CAGGGAGAATGAAAAGAAGTTGG - Intronic
963532163 3:146484333-146484355 CAGAGAGAATGGAAATAAGTTGG + Intronic
963638431 3:147828653-147828675 CAGTGGAGATGGAGACAAGTAGG + Intergenic
963975218 3:151472887-151472909 CAGTGTGGGTGGTGAGAACTTGG - Intergenic
964090606 3:152872039-152872061 CAGTGAGGATGGTGAGGATGTGG + Intergenic
964557055 3:157951402-157951424 CAGAGAGGATGTGGAGAAATAGG + Intergenic
964669975 3:159214358-159214380 CAGTGAGGATCTAGAGAAGGTGG - Intronic
964736066 3:159919204-159919226 TGGTGAGAATGCAGAGAAGTGGG + Intergenic
965011276 3:163095318-163095340 CAGAGAGGATGTGGAGAAATAGG - Intergenic
965287476 3:166835234-166835256 CGGTGAGGATGTGGAGAAATTGG - Intergenic
965296137 3:166949068-166949090 CATTGAGGGTGTAGAGTAGTGGG + Intergenic
965382509 3:168007313-168007335 TAGTGAGTATGGAGAGAAGTGGG + Intergenic
965464680 3:169013337-169013359 CAGTGCAGATAGAGAGAAGCAGG - Intergenic
965631476 3:170737701-170737723 TACTGAGGATGCAGAGAAATGGG + Intronic
965667590 3:171111518-171111540 TGGTGAGGATGCAGAGAAGAGGG + Intronic
965908249 3:173737889-173737911 TGGTGAGGATGCAGAGAAGTTGG - Intronic
965915248 3:173837826-173837848 CAGTGCAGTTGGAGGGAAGTGGG + Intronic
966007339 3:175031751-175031773 CAGTGAGGCTGGAGAGAAAAAGG - Intronic
966326976 3:178767761-178767783 GAGTGAGGAGAGAGAGAAGCTGG - Intronic
966348320 3:179003132-179003154 TGGAGAGGATAGAGAGAAGTGGG - Intergenic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
966519377 3:180855948-180855970 CACTGAGGCTGGAGTGCAGTGGG - Intronic
966542846 3:181111031-181111053 CAGTGAAGATCGGGAGAAATGGG - Intergenic
966726082 3:183109888-183109910 CAGTGAGGCTGTAGAGAAAAGGG - Intronic
966789067 3:183648232-183648254 AAGAGAGGATGGAGATAAATAGG + Intronic
966911071 3:184560661-184560683 CCCTGAGGAGGGAGAGAAGCTGG - Intronic
966946934 3:184783391-184783413 AGGTGAGGATGGAGAGATGGTGG + Intergenic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
966990944 3:185229465-185229487 CAGTGAGTCTGGGGAGAAGCTGG + Exonic
967258153 3:187614145-187614167 AAGAGAGGATGGAGGAAAGTGGG - Intergenic
967396833 3:189017862-189017884 CAGAGAGGATGTGGAGAAATAGG - Intronic
967417535 3:189235393-189235415 AAGGGAAGATGGAGAGAGGTGGG + Intronic
967650302 3:191977559-191977581 TGGTGAGGATGTAGAGAAGTTGG + Intergenic
968315506 3:197720941-197720963 CGGTGAGGATGGGGAGAAAAGGG - Intronic
968647806 4:1749010-1749032 CGGTGGGGAGGGAGAGCAGTGGG - Intergenic
968743379 4:2342839-2342861 CAATGGGAAAGGAGAGAAGTGGG + Intronic
968953839 4:3708340-3708362 GAGTGAGAATGGAGAGAGGCGGG - Intergenic
969219688 4:5751746-5751768 CAGTGAGGGTGGGGACAAGCAGG + Intronic
969392360 4:6900413-6900435 ATGTGGGGTTGGAGAGAAGTGGG + Intergenic
969487050 4:7478200-7478222 CAGTGAGTATGCAGTGATGTGGG + Intronic
969747225 4:9082073-9082095 CAGTGAGAATGGAACCAAGTTGG + Intergenic
969890871 4:10258905-10258927 CAATGAAGATGTATAGAAGTGGG - Intergenic
969951386 4:10839937-10839959 TCGTGATGATGCAGAGAAGTTGG - Intergenic
970238088 4:13979323-13979345 TAGAGAGGATGTAGAGAAATAGG + Intergenic
970269846 4:14334373-14334395 CAGTGAGGTTGCAGAGAAAAAGG + Intergenic
970336842 4:15055795-15055817 CACTGAGGCTGGAGAGAACAAGG - Intronic
970515806 4:16829057-16829079 CAGTGAGGGAGGAGGGGAGTGGG - Intronic
970923359 4:21421143-21421165 TGGTGAGGATGTAGAGAAGAGGG + Intronic
971052424 4:22876260-22876282 CAGTGGAGATGAAGAGAGGTGGG - Intergenic
971360954 4:25937935-25937957 CAGTGAGATTGGAAAGCAGTTGG + Intergenic
971530917 4:27687638-27687660 TGGTGAGGATGCAGAGAAATGGG - Intergenic
972083581 4:35184314-35184336 TGGTGAGGATGGGGAGAAATAGG + Intergenic
972115649 4:35630064-35630086 CAGTAAGGATGCAGAGAAACTGG + Intergenic
972257008 4:37367795-37367817 CAGTGAGGATGCTGAGACTTAGG + Intronic
972276330 4:37561200-37561222 CAGAGAGGAAGGAGGGAATTGGG - Intronic
972349134 4:38220216-38220238 GCGTCAGGAGGGAGAGAAGTGGG + Intergenic
972445582 4:39140186-39140208 CACTGAGGCTGGAGTGCAGTGGG - Intergenic
972509500 4:39754240-39754262 GAAGGTGGATGGAGAGAAGTAGG + Intronic
972766889 4:42159466-42159488 CAGTGACGATGGAAGGAAGTGGG + Intergenic
973065898 4:45792066-45792088 GAAGGAGGATGAAGAGAAGTGGG + Intergenic
973629583 4:52807508-52807530 TGGTGAGGATGCAGAGAAATAGG + Intergenic
973830100 4:54750569-54750591 CAGTGAGGATGTGGAGAAAAGGG + Intergenic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
974308584 4:60174520-60174542 CTGAGAGGATGGAGAGATGATGG - Intergenic
974539381 4:63214139-63214161 CAGTGAGGATGCTGAGAAAAAGG - Intergenic
974959322 4:68678132-68678154 CAGGGAGGATGTGGAGAAATAGG - Intergenic
975302718 4:72809622-72809644 GAGTGAGGTGGGAGGGAAGTGGG + Intergenic
975485577 4:74931682-74931704 CAGGGAGGATGGAGAGGGGATGG + Intergenic
975503701 4:75115787-75115809 CAGAGAGGATGTGGAGAAATAGG + Intergenic
975513854 4:75222862-75222884 CAGGGAGAATGGAGCCAAGTTGG + Intergenic
975530941 4:75398765-75398787 TAGTGAGGATGTGGAGAAATTGG + Intergenic
975544258 4:75545629-75545651 CAGGGAGGATGGGGAGTGGTGGG - Intronic
976028380 4:80720038-80720060 CAGTGAGGATGGAGGAAACCAGG + Intronic
976031806 4:80764452-80764474 TGGCGAGGATGGAGAGAAATAGG + Intronic
976116215 4:81730391-81730413 CAGTGAGGTTGTAGAGAAAAAGG + Intronic
976218832 4:82739906-82739928 CGGTGGGGATGGAGAGGGGTCGG - Intronic
976221051 4:82757121-82757143 AAGCGAGGATGGAGAGAGGGTGG - Intronic
976470663 4:85424963-85424985 TAGTGAGGATGCAGAGAAAAGGG - Intergenic
976482382 4:85559742-85559764 CAGGGAAGATGAAAAGAAGTTGG - Intronic
976511603 4:85916053-85916075 TAGAGAGGATGTAGAGAAATAGG - Intronic
976520720 4:86022232-86022254 TGGTGAGGATGTAGAGAAATTGG - Intronic
976540443 4:86268289-86268311 CAGTAAAGATGGTGAGAAGATGG - Intronic
977447074 4:97144481-97144503 AAGTGAGGATAGAGAGGAGCTGG + Intergenic
977601617 4:98939404-98939426 CAGTGAGAATGAAGAGGAGAGGG - Intergenic
977675015 4:99737909-99737931 TAGGGAGGATAGAGAAAAGTGGG - Intergenic
977845809 4:101765234-101765256 CAGTGAGGTTGCAGAGAAAAGGG - Intronic
977859421 4:101938306-101938328 TAGTGAGGATGGGGGAAAGTGGG + Intronic
978017734 4:103767975-103767997 CAGTGAGGATGTGGAGAAATTGG - Intergenic
978048671 4:104167489-104167511 CACTCAGGCTGGAGTGAAGTGGG - Intergenic
978261100 4:106760421-106760443 CAGTAAGGATGGAAAGAAGATGG + Intergenic
978862888 4:113471728-113471750 CAGTGAGGAGTGAGAGAGGCCGG - Intronic
979856522 4:125639522-125639544 CAGTAAGGAAGGGGAGAAGGGGG - Intergenic
980090269 4:128436101-128436123 CAGGGAGAATGGAAACAAGTTGG - Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
980148677 4:129021095-129021117 CATGGAGGATGAACAGAAGTAGG + Intronic
980389956 4:132131688-132131710 CAGTGAGGATAGAAAGAAGATGG + Intergenic
980545106 4:134250542-134250564 TAGTGAGGATGCAGAGAAAGGGG - Intergenic
980610077 4:135148814-135148836 CAGAGAGGATGTGGAGAAATAGG - Intergenic
980777985 4:137461593-137461615 CAGTGAGGGATGATAGAAGTGGG + Intergenic
980825327 4:138064955-138064977 CAGAGAGGATGTGGAGAAATAGG + Intergenic
981147476 4:141342144-141342166 TGCTGAGGATGCAGAGAAGTTGG + Intergenic
981255450 4:142656208-142656230 GGGTGAGAATGGAGAAAAGTGGG - Intronic
981401743 4:144321784-144321806 CATTGAGAATGGACAGAAGGAGG + Intergenic
981547079 4:145904417-145904439 CAGGGAGGATGGGGAGTAATGGG + Intronic
981556273 4:145998386-145998408 CAGAGAGGATGTGGAGAAATAGG - Intergenic
981638911 4:146912812-146912834 CTGGAAGGATAGAGAGAAGTAGG + Intronic
981646971 4:147009908-147009930 AAGGCAGGATGGAGAGAAGCTGG - Intergenic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
981668674 4:147260017-147260039 CAGAGAGGATGTGGAGAAATAGG + Intergenic
981729753 4:147885013-147885035 CAGTGGGGGTGGAGCCAAGTGGG + Intronic
981790792 4:148534708-148534730 CAGGGAGAATGGAAACAAGTCGG - Intergenic
981917539 4:150051424-150051446 CAGTGGAGGTAGAGAGAAGTGGG - Intergenic
981990033 4:150907283-150907305 GAGGGAGGGAGGAGAGAAGTGGG + Intronic
982176817 4:152713466-152713488 GAGAGAGGATGAAGAGAAGTTGG + Intronic
982310189 4:153976283-153976305 GAATGAGGCTGGAGAGAAGTTGG - Intergenic
982693954 4:158579060-158579082 CAGAGATGCTGGAGAGAAGAGGG + Intronic
982908724 4:161112798-161112820 CAGAGAGGATGTGGAGAAATAGG - Intergenic
983194600 4:164793211-164793233 GAGTGAGGAGGGAGAAAAGAAGG + Intergenic
983283716 4:165712961-165712983 TAGGGAGGATGGGGAGACGTTGG - Intergenic
983308880 4:166030124-166030146 TGGTGAGGATGGACAGAAATTGG - Intronic
983537101 4:168869469-168869491 GACAGTGGATGGAGAGAAGTTGG + Intronic
983648118 4:170012219-170012241 CAGTGGGGAAGGAAAGAAGTTGG + Intronic
983727094 4:170941809-170941831 CAGGGAGGATGGAAACAAGCTGG + Intergenic
983939807 4:173527260-173527282 CAGTGAGGAGGAGGAGAAGGAGG - Exonic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
984092616 4:175392755-175392777 TGGTGAGGATGCAGAGATGTTGG + Intergenic
984201387 4:176724924-176724946 TAGGGAGGATGGAGAGAGGATGG + Intronic
984335168 4:178380522-178380544 CAGAGAGGATGGAAACAAGCTGG + Intergenic
984842102 4:184078325-184078347 CAGGGAGCATGGAGAGATATAGG + Intergenic
985006292 4:185537943-185537965 CAATGAGGATGGAGCAGAGTGGG + Intergenic
985230041 4:187805818-187805840 TAGTGAGAATGCAGAGAAGAGGG + Intergenic
985715723 5:1459882-1459904 TAGTGGGGATGCTGAGAAGTGGG - Intronic
985972673 5:3390823-3390845 CAGTGTGCATGGAGTGCAGTGGG - Intergenic
986313367 5:6571114-6571136 AAGGGAGGAAGGAGAGAAGGAGG + Intergenic
986313438 5:6571320-6571342 AAGGGAGGAAGGAGAGAAGGAGG + Intergenic
986313459 5:6571386-6571408 AAGGGAGGAAGGAGAGAAGGAGG + Intergenic
986522227 5:8632191-8632213 TAGAGAGGATGTGGAGAAGTAGG + Intergenic
986644867 5:9907120-9907142 CAGCAAGGAAGGAGAGAAGAGGG - Intergenic
986936882 5:12900124-12900146 GAGAGAGGATGGAGAGAGGGAGG + Intergenic
987362646 5:17121125-17121147 CAAAGAGAATGGAGAGAAGGTGG + Intronic
987621975 5:20346485-20346507 CAGCCAGGATGTACAGAAGTGGG + Intronic
987695731 5:21328957-21328979 CAGTAAAGATGGAGAGAAATAGG + Intergenic
988044792 5:25937008-25937030 TGGTGAGGATGGGGAGAAATAGG - Intergenic
988249185 5:28732894-28732916 GAGTGGGGATGGGGAGATGTTGG - Intergenic
988598678 5:32619439-32619461 AAGTGAGGATGTAGAAAAATTGG - Intergenic
988785021 5:34558491-34558513 AAGAGAGGAAGGAGAGAAGAAGG + Intergenic
989099487 5:37810914-37810936 CCGTGAGTGTGGAGTGAAGTAGG - Intergenic
989117018 5:37964927-37964949 CAGTCTGGAGGCAGAGAAGTTGG + Intergenic
989753991 5:44929430-44929452 TGGTGAGGATGGGGAGAAATGGG - Intergenic
989835341 5:45981728-45981750 CAGAGAGGATGTGGAGAAATAGG + Intergenic
990235514 5:53763250-53763272 TAGAGAGGATGTAGAGAAGTAGG + Intergenic
990338476 5:54799065-54799087 TAGTGAGGATGTAAAGAAATTGG + Intergenic
990624270 5:57593945-57593967 GATGGAGGATGGAGAGAAGCTGG + Intergenic
990705878 5:58528878-58528900 CATTGAGGCTGGTGAGAAGCTGG + Intergenic
990871763 5:60439718-60439740 CAGTGGAGATGGAGAGAGGTGGG - Intronic
991148325 5:63334572-63334594 TAGAGAGGATGGGGAGAAATAGG - Intergenic
991180799 5:63748438-63748460 TGGAGAGGATGGGGAGAAGTAGG + Intergenic
991388262 5:66114147-66114169 TGGGGAGGATGCAGAGAAGTTGG + Intergenic
991481926 5:67090298-67090320 AAGTGGGGAGGGGGAGAAGTGGG - Intronic
991481938 5:67090330-67090352 AAGTGGGGAGGGGGAGAAGTGGG - Intronic
991513208 5:67403420-67403442 CAGTGAGAATGGAGAAAAAGGGG - Intergenic
991662256 5:68962197-68962219 CAATGAGAATGGAGAGAAGTAGG + Intergenic
991744670 5:69723135-69723157 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991753033 5:69832098-69832120 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991796241 5:70302859-70302881 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991802651 5:70388825-70388847 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991824052 5:70598449-70598471 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991832353 5:70707217-70707239 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991888619 5:71302418-71302440 CAGTAAAGATGGAGAGAAATAGG - Intergenic
992093748 5:73341485-73341507 ATGTGAGGATGCAAAGAAGTTGG - Intergenic
992262897 5:74988732-74988754 TAGTGAGGATGCAGAAAAATTGG - Intergenic
993087837 5:83385769-83385791 CAGTGAGGATGGAGAAAAATTGG + Intergenic
993089625 5:83409308-83409330 CAGGGAGAATGGAGCCAAGTTGG + Intergenic
993119298 5:83754997-83755019 CGGGGAGAATGGAGACAAGTTGG + Intergenic
993276366 5:85864842-85864864 TAGGGAGGGTGGAGAGAAGTGGG + Intergenic
993419871 5:87687616-87687638 TGGTGAGGATGTGGAGAAGTTGG - Intergenic
993495096 5:88599974-88599996 CAGGGAAGGTGGAGAGGAGTGGG + Intergenic
994120487 5:96107822-96107844 CAGGGAGAATGGAAACAAGTTGG - Intergenic
994219279 5:97176301-97176323 AGGTAAGGATGAAGAGAAGTGGG - Intronic
994224691 5:97238865-97238887 CAGGGAGAATGGAAACAAGTTGG - Intergenic
994246636 5:97486258-97486280 CAGTGAGGATGGCAAGTAGGGGG + Intergenic
994951560 5:106470196-106470218 CAGGGAGGATGAACAGAAGTGGG + Intergenic
995183095 5:109247039-109247061 CAGTGGGGATGGAGTAAACTGGG + Intergenic
995900441 5:117059541-117059563 GAGTGAGGAAGGAAAGAGGTCGG + Intergenic
996224198 5:120970233-120970255 TGGAGAGGATGGAGAGAAATAGG + Intergenic
996285328 5:121784287-121784309 CAGTGGAGATGGAGAGACGTGGG + Intergenic
997063736 5:130538478-130538500 GAGAGAAGATGGGGAGAAGTTGG + Intergenic
997123856 5:131205657-131205679 CAGTGAGGATGTGGGGAAATGGG - Intergenic
997794195 5:136791770-136791792 CAATGAGGATGGAGACGATTGGG + Intergenic
998004167 5:138646354-138646376 CAGTGAGGATGGAGAGAGAGCGG - Intronic
998007036 5:138663870-138663892 CACTGAGGTAGGAGTGAAGTTGG + Intronic
998209470 5:140183397-140183419 AAGTGAGAATGGAGAGAAAATGG - Intronic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998734476 5:145120078-145120100 TAGGGAGGATGGCAAGAAGTGGG + Intergenic
998925359 5:147117848-147117870 CAGTGAGAATGCAGAGAAATGGG - Intergenic
998927347 5:147141162-147141184 CAGGGAGAATGGAAACAAGTTGG - Intergenic
998966805 5:147550013-147550035 CAGCAAGGATGTAGAGAAATTGG - Intergenic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999612835 5:153389067-153389089 CGGTGAGGATGTGGAGAAATTGG - Intergenic
999675724 5:154000213-154000235 GGGTGGGGATGAAGAGAAGTTGG + Intronic
1000294551 5:159901856-159901878 TAGTGAGGTTGGGGAGAAATTGG + Intergenic
1000322363 5:160144732-160144754 CGGTGAGGATGCAGAGAAAAGGG - Intergenic
1000646180 5:163762974-163762996 GAGGGAGGAGGGAGAGAAGATGG + Intergenic
1000819404 5:165965043-165965065 TGGTGAGGATGCAGAGAAATAGG - Intergenic
1001064353 5:168524124-168524146 GAGGGAAGATGAAGAGAAGTGGG + Intergenic
1001376165 5:171260519-171260541 GGGAGAGGATGAAGAGAAGTAGG + Intronic
1001734622 5:173988660-173988682 CAGGGGAGATGGAGGGAAGTGGG - Intronic
1001748769 5:174111940-174111962 CAGTGAGGAGAGAGAGGAGCGGG - Intronic
1001814899 5:174660383-174660405 CAGGGAGGGTGGAGAGGAGGAGG - Intergenic
1001969443 5:175942608-175942630 CAGTGAGGATGTAGAGAAAAGGG + Intronic
1001996431 5:176163831-176163853 CATTTAGGATGTGGAGAAGTTGG + Intergenic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002247992 5:177901145-177901167 CAGTGAGGATGTAGAGAAAAGGG - Intergenic
1002805173 6:567009-567031 CAGTGGAGTTGGAGAGCAGTTGG - Intronic
1003077548 6:2996563-2996585 GCGTGAGAATGTAGAGAAGTTGG + Intronic
1003078913 6:3005378-3005400 AGGTGAGGATGCGGAGAAGTTGG - Intronic
1003390932 6:5712190-5712212 TAGTGAGGATGGAAAGGAGAAGG - Intronic
1003529173 6:6923629-6923651 CACTGAGGATAAAGAGAATTCGG + Intergenic
1003693670 6:8380062-8380084 GGGTGAGGCTGGGGAGAAGTTGG + Intergenic
1003860680 6:10319418-10319440 CCGTGGGGATGGAGGGATGTGGG + Intergenic
1003860777 6:10319750-10319772 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1003860787 6:10319780-10319802 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1004271725 6:14201692-14201714 CAGTGAGAAAGGTGAGAACTAGG + Intergenic
1004691493 6:17996145-17996167 CAGTGAGGAGGGTCAGAAGCGGG + Intergenic
1004784464 6:18951127-18951149 TGGGGAGGATGGGGAGAAGTTGG + Intergenic
1004943911 6:20590989-20591011 CAGAGAGGATGTCGAGAAATAGG - Intronic
1004976509 6:20973413-20973435 CAGTGAGCGGGGAGTGAAGTAGG + Intronic
1005241106 6:23828650-23828672 AAGTGAGGATGTGGAGAAATTGG - Intergenic
1005314538 6:24591673-24591695 TAGTAAGGATGCAGAGAAATTGG - Intronic
1005390928 6:25332419-25332441 CAGTGAAGGTGTAGAGAAGTGGG + Intronic
1005477566 6:26222774-26222796 CACTCAGGATGGAGTGCAGTGGG - Intergenic
1005555054 6:26969109-26969131 CAGTAAAGATGGAGAGAAATAGG - Intergenic
1005587330 6:27289337-27289359 CAGTGTGGTTGGAGAGAAAGGGG - Intronic
1005693176 6:28327072-28327094 CAGTGAGGATGTACATAAGCAGG + Intronic
1005698493 6:28375176-28375198 AGGGGAGGATGGAGAGAGGTTGG - Intergenic
1006430616 6:33993446-33993468 GAGTGAGGCTGGAGAGGATTGGG + Intergenic
1006487930 6:34359897-34359919 TAGTGAGGATGTGGAGAAATTGG - Intronic
1006880899 6:37338816-37338838 CAGAGAGGATGTAGAGAAATAGG - Intergenic
1006920750 6:37625655-37625677 GAGGGAAGAGGGAGAGAAGTTGG - Intergenic
1006938880 6:37738203-37738225 CAGTGGGGAGGGTGAGAAGGGGG + Intergenic
1007115980 6:39343622-39343644 CAGTGAGGTGGGAGGGGAGTAGG - Intronic
1007117428 6:39353203-39353225 CAGTGAGGATGTTGAGCAATAGG - Intronic
1007192190 6:40028915-40028937 CAGTGAGGGTGGAGAAAAGTAGG + Intergenic
1007373199 6:41440288-41440310 CAGTGAGGCAGGAGAGATCTTGG - Intergenic
1007650292 6:43415536-43415558 CAGTGAGGATATAAAGAAATTGG + Intergenic
1007756112 6:44100885-44100907 AAGTGAGGGAGGAGAGAAGGTGG - Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1008054292 6:46930504-46930526 CAATGAGGGTAGAAAGAAGTGGG + Intronic
1008239515 6:49092012-49092034 TAGTGAGGATGCAGAGAAAAGGG - Intergenic
1008555918 6:52672736-52672758 CAATGAGAATGGAGAGAAGGTGG - Intronic
1008637635 6:53427018-53427040 CAGTGAGGCAGGGGAGAGGTGGG + Intergenic
1008664007 6:53697894-53697916 CAGTGAGGATGGAGAGGAAGAGG + Intergenic
1008718435 6:54318487-54318509 TAGTGAGGATAGAGAGAAGTAGG - Intronic
1008969586 6:57351494-57351516 CTGTGAGAATGGAAAGAAGTGGG + Intronic
1009158558 6:60253331-60253353 CTGTGAGAATGGAAAGAAGTGGG + Intergenic
1009481791 6:64168304-64168326 GGGTGAGAATGTAGAGAAGTGGG + Intronic
1009546675 6:65029794-65029816 CAGAGCGGATGGAAAGAAGATGG + Intronic
1009636462 6:66271273-66271295 GAAGGAGGATGAAGAGAAGTTGG + Intergenic
1009912052 6:69942506-69942528 GAGTGGGGATAGGGAGAAGTTGG - Intronic
1009962618 6:70542035-70542057 AAGTGAGAATGGGGAGAAGGGGG - Intronic
1010116174 6:72315273-72315295 TAGTGAAGATGGTGAGAAGAGGG + Intronic
1010246604 6:73665368-73665390 AAGGGGGGATGAAGAGAAGTTGG + Intergenic
1010306449 6:74328765-74328787 CAATGGGAATGAAGAGAAGTTGG - Intergenic
1010459949 6:76102891-76102913 CAGAGAGGATGTGGAGAAATAGG + Intergenic
1010629355 6:78178934-78178956 CAGTGAGGCTGCAGAGAAAAGGG + Intergenic
1010844190 6:80684758-80684780 CAGAGAGGATGGAACCAAGTTGG + Intergenic
1010915098 6:81606161-81606183 GAGTGAGGACAGAGAGATGTAGG + Intronic
1011085957 6:83541349-83541371 AGGTGAGGATGGGGAGATGTTGG + Intergenic
1011295042 6:85817466-85817488 CAGGGAGAATGGAAACAAGTAGG + Intergenic
1011874376 6:91938921-91938943 CAGAGAGGATGTGGAGAAATAGG - Intergenic
1011876846 6:91972331-91972353 CAGAGAGGATGTGGAGAAATAGG - Intergenic
1012074394 6:94666410-94666432 CAGGGCGGGTGGGGAGAAGTTGG - Intergenic
1012143790 6:95656141-95656163 AAGTGGGGATGGAGAAAAGGTGG - Intergenic
1012198389 6:96374246-96374268 TGGTGAGGATGGAGAGAATCTGG + Intergenic
1012200188 6:96396437-96396459 TAGTGAGGATGTAGAGGAATTGG + Intergenic
1012247043 6:96937717-96937739 CTGTGAGGATGGAGGGTAGAGGG - Intronic
1012384634 6:98664982-98665004 AGGGGAGGATGGAGAGAGGTTGG + Intergenic
1012680042 6:102168821-102168843 TGGTGAGGATGCAGAGAAATAGG + Intergenic
1013060869 6:106632590-106632612 TGGTGAGGATGGAGAAAAGTTGG - Intronic
1013076079 6:106772883-106772905 CAATGAGGATTGAGTGAATTAGG - Intergenic
1013453533 6:110308946-110308968 GACTGGGGATGGAGAGAAGAGGG + Intronic
1013708806 6:112873111-112873133 TAGTGAGGATGTAGAGAAATAGG + Intergenic
1013715800 6:112960012-112960034 TGGTGAGGATGCAGAGAAATAGG + Intergenic
1013895176 6:115079389-115079411 CAGTGAGAAAGCAGACAAGTAGG + Intergenic
1013941452 6:115667913-115667935 CAGCGTGGATGAAGAGCAGTTGG - Intergenic
1014344632 6:120252700-120252722 TGGTGAGGATGCAGAGAAATAGG + Intergenic
1015337383 6:132055729-132055751 CAGTGAGTATGTTGAGAAATGGG + Intergenic
1015809085 6:137143236-137143258 GAGTGAGGAAGGTGAGAATTAGG + Intergenic
1016455978 6:144231208-144231230 AAGAGAGGATGGTGAGAAGAGGG + Intergenic
1016569804 6:145498663-145498685 CAGGGAGAATGGAGAAAAGCAGG - Intergenic
1016730809 6:147425571-147425593 TGGTGAGGATGTGGAGAAGTAGG - Intergenic
1016864656 6:148753810-148753832 CAGTGAGGATGTGAAGAAATTGG - Intronic
1016912598 6:149214158-149214180 CAGTGAAGATGGAGAAGAGCAGG - Intergenic
1016975805 6:149806440-149806462 TAGTAAGGATAGAGAGAAGTGGG + Intronic
1017084707 6:150703174-150703196 GAGTTAGGAAGGAGAGAAGTGGG - Intronic
1017208784 6:151832486-151832508 CACTATGGATGGACAGAAGTTGG - Intronic
1017287435 6:152692150-152692172 CAGTGAGGATTTGGAGAAATTGG - Intergenic
1017809819 6:157976813-157976835 CAGCGAGGTTGGGGAGAAGAAGG + Intergenic
1017944870 6:159087772-159087794 GGGTGAGGATGAAGAGAACTGGG + Intergenic
1018118104 6:160607610-160607632 ATGTGAGGATAGAGAGAGGTTGG - Intronic
1018353599 6:162989096-162989118 CAGTGAGAATGTAGAGAAGGGGG + Intronic
1018651845 6:165998908-165998930 CACTGGGAATGGAGAGAAGGAGG - Intergenic
1018717956 6:166549180-166549202 CGGTGAGGATGCAGAGAAACTGG + Intronic
1018869618 6:167770869-167770891 CTGTCTGGATGGAGGGAAGTGGG - Intergenic
1019285791 7:222306-222328 CAGTGAGGATGGAGGGACTTGGG + Intronic
1019509829 7:1412299-1412321 CACTGAGGTTGGAGAGGGGTGGG - Intergenic
1019532720 7:1511687-1511709 CACTGCGGGAGGAGAGAAGTGGG - Intergenic
1019778377 7:2925688-2925710 AAGGCAGGATGGGGAGAAGTAGG - Intronic
1020033050 7:4946435-4946457 CAGTGATGCTGAAGGGAAGTGGG + Intronic
1020224653 7:6271240-6271262 CAGCCAGGATGGTGGGAAGTTGG - Intronic
1020359015 7:7307172-7307194 CAGGGAGGATGAGGAGAGGTTGG - Intergenic
1020382820 7:7565670-7565692 GAGTGGGCATGGAGAGAAGTGGG - Intergenic
1020442012 7:8227352-8227374 CAGAGAAGATGGAGAGAGGAAGG + Intronic
1020487504 7:8737730-8737752 CAGAGAGAATGGAAACAAGTTGG - Intronic
1020510622 7:9052508-9052530 GGGTGAGGATGGGGAGATGTTGG - Intergenic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1020833901 7:13125427-13125449 CAGGGAGAATGGAAACAAGTTGG - Intergenic
1020986332 7:15139494-15139516 GTGGGAGGAGGGAGAGAAGTAGG - Intergenic
1021031825 7:15746624-15746646 CAGTGAGGATGTGGAGAAACAGG + Intergenic
1021127755 7:16872959-16872981 TGGTGAGGATGCAGAGAAGAGGG + Intronic
1021545464 7:21808515-21808537 GAGAGGGGATGCAGAGAAGTTGG - Intronic
1021627645 7:22610081-22610103 TAGTGGAGATGGAGAGAAGTTGG - Intronic
1021690378 7:23224954-23224976 TGGTGAGGATGTAGAGAAATTGG - Intergenic
1021902137 7:25296653-25296675 CAGAGAGTAAGGAAAGAAGTTGG - Intergenic
1022135659 7:27445677-27445699 GAGTGAGGAAGGGGAGAAGAGGG + Intergenic
1022394064 7:29969986-29970008 CAGTGGAGGTGGAGAGGAGTGGG - Intronic
1022457087 7:30566929-30566951 CAGTGTGGATGGGTAGAATTTGG + Intergenic
1022634807 7:32121274-32121296 CAGGGAGAATGGAAACAAGTTGG + Intronic
1022729604 7:33010082-33010104 CAGGGAAGATGGAGAGGAATAGG - Intergenic
1022786801 7:33646127-33646149 CAGTGATGATGGAAAGGAGAAGG - Intergenic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1023190946 7:37581811-37581833 TAGCGAGGATGTAGAGAAATTGG - Intergenic
1023372421 7:39525044-39525066 TGGTGAGGATGTAGAGAAATTGG + Intergenic
1023398966 7:39777850-39777872 CAGTGAAGATGTGGAGGAGTTGG - Intergenic
1023456876 7:40349060-40349082 CAGTGAGGATATACAGAAGGAGG - Intronic
1023520152 7:41042001-41042023 CGGTAAGGATGTAGAGAAATTGG + Intergenic
1023558042 7:41443643-41443665 CAGTGAGGAAGGAGGGTGGTGGG + Intergenic
1023643985 7:42290189-42290211 CAGCGAGGATGAGGAGAAATTGG - Intergenic
1023714881 7:43033757-43033779 CAGTGAGAATGTAAAGAAATTGG + Intergenic
1023765362 7:43505332-43505354 CAGTGGAGATGAAGTGAAGTGGG - Intronic
1024003801 7:45210684-45210706 GAAAGAGGATGGAGAGAAGGTGG - Intergenic
1024046223 7:45587432-45587454 CGGTGGGGTTAGAGAGAAGTTGG + Intronic
1024131190 7:46354588-46354610 CGGTGAGGAAGGAGAGAAGCAGG + Intergenic
1024132614 7:46370572-46370594 TGGCGAGGATGGAGAGAAATTGG - Intergenic
1024173254 7:46811523-46811545 AAGTGAGGGTGAAGAGCAGTGGG - Intergenic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1024280768 7:47717688-47717710 CAGTGAGGAAGAAGAGAAATTGG + Intronic
1024454638 7:49589896-49589918 CAGTGGAGATGTAGAGAAATTGG + Intergenic
1024651475 7:51406840-51406862 CAGTGAAGATGTGGAGGAGTTGG + Intergenic
1024795328 7:53012731-53012753 CAGTGAGGAGGGATAGATCTGGG + Intergenic
1025061860 7:55816205-55816227 GATTGGGGAGGGAGAGAAGTGGG + Intronic
1025076578 7:55949103-55949125 CACTGAGGCTGGAGTGCAGTGGG - Intergenic
1025133680 7:56392650-56392672 CAGTGAAGATGTGGAGGAGTTGG + Intergenic
1026023739 7:66729471-66729493 AGGTGAGGATGGAGAGCAGGAGG - Intronic
1026498396 7:70922632-70922654 TGGGGAGGGTGGAGAGAAGTTGG - Intergenic
1027271291 7:76520548-76520570 CAGGGATGATGGAGAGAAATGGG - Intergenic
1027321055 7:77010483-77010505 CAGGGATGATGGAGAGAAATGGG - Intergenic
1027358264 7:77381531-77381553 AAGGGAGGATGGAGAAAAATGGG - Intronic
1027586181 7:80061681-80061703 CAGTAAGGAAAGAGAGAAGCAGG + Intergenic
1027589736 7:80102612-80102634 CGGTGAGAATGTAGAGAAATTGG - Intergenic
1027592675 7:80135229-80135251 CCGTGAGGACGGCGAGAAGGCGG + Exonic
1027603656 7:80271914-80271936 AGGTGAGGATGGAGAAAATTAGG - Intergenic
1027634179 7:80648890-80648912 CAGTGAAGATGGAAGGAAGAAGG + Intronic
1028469259 7:91186484-91186506 CAATGATAATGGGGAGAAGTTGG - Intronic
1028750845 7:94381132-94381154 CATTGAGGATGAAGAGAATTAGG - Intergenic
1028893830 7:96018614-96018636 GAGTGATGCTGAAGAGAAGTTGG + Intronic
1028955341 7:96683392-96683414 CAGAGAGGATGTGGAGAAATAGG + Intronic
1029434722 7:100556567-100556589 CAGTGAGGGTGGAGAAGAGAAGG - Intronic
1030516749 7:110548576-110548598 CAGTAAGAATGGAGAGCAGGAGG - Intergenic
1030655703 7:112165288-112165310 AGGGGAGGATGCAGAGAAGTAGG - Intronic
1030817655 7:114056461-114056483 CAGGGAGAATGGAAACAAGTTGG + Intronic
1031392195 7:121228995-121229017 GAGGGAGGATGAAGACAAGTGGG + Intronic
1031462945 7:122074112-122074134 TGGTGAGGATGCAGAGAAATTGG - Intergenic
1031651376 7:124294638-124294660 TGGTGAGGATGGGGAGAAATTGG + Intergenic
1031679676 7:124655962-124655984 TGGTGAGGATGCAGAGAAATTGG + Intergenic
1031715132 7:125099532-125099554 CAAGGAGGATGGAGAAATGTTGG + Intergenic
1031739493 7:125411808-125411830 AAGTGAGGAGTGAGAGAACTAGG - Intergenic
1031767000 7:125792469-125792491 CGGTGAGAATGGAGAAAAATTGG + Intergenic
1032035338 7:128517359-128517381 AGGTGAGGATGGAGACAGGTGGG + Intergenic
1032169484 7:129572641-129572663 TAGTGGGGATGGAGAGATGTTGG + Intergenic
1032254192 7:130284123-130284145 CAGTGTGGATGGAGTGATGAGGG + Intronic
1032312425 7:130801125-130801147 CAGGGAGAATGGAAACAAGTTGG - Intergenic
1032318650 7:130864771-130864793 CAGGGGGAATGAAGAGAAGTTGG + Intergenic
1032499511 7:132389925-132389947 CAGAGAGGATGTGGAGAAATAGG + Intronic
1032607533 7:133371867-133371889 CAGTAAGGATGCAGAGAAATTGG - Intronic
1033227417 7:139572860-139572882 GAGGGAGGAGGGAGAGAAGGAGG - Exonic
1033249397 7:139745790-139745812 CAGTGAGCATGCAGAGGAGGAGG - Intronic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1034034662 7:147806349-147806371 TAGTGAGGATGCAGAGAAAGGGG + Intronic
1034165328 7:149021103-149021125 CATTGAGGATGAAGAGGAGGAGG - Exonic
1034586414 7:152097360-152097382 CAGTGAGGATGTGGAGAAACTGG + Intronic
1035390804 7:158503332-158503354 CTGTGAGGGTAGAGAGAAGCTGG - Intronic
1035483967 7:159208027-159208049 CAATGAGGATGGCAGGAAGTGGG + Intergenic
1035825641 8:2641842-2641864 CTGAGAGGATGGAGTGAAGGAGG + Intergenic
1036066335 8:5385090-5385112 AAGTGAGGATGTAGAGAAAATGG - Intergenic
1036118234 8:5985004-5985026 CAATGAGAATGTAGAGAAATTGG + Intergenic
1036625135 8:10464392-10464414 ACGTGAGGATGCAGAGAAGGTGG + Intergenic
1037373818 8:18207623-18207645 CAGTGAGGCTGCAGAGAGATAGG + Intronic
1037904265 8:22706188-22706210 CAGTGTGGTGGGAGAGAAGATGG - Intergenic
1038111371 8:24503384-24503406 TAGAGAGAATGGAGAGAAATAGG + Intronic
1038214741 8:25551175-25551197 CAGTGAGGCTGGACAGGTGTGGG - Intergenic
1038675716 8:29621060-29621082 CAGGGTGGAGGGAGAGAGGTTGG + Intergenic
1038807631 8:30809894-30809916 CAGTCAGGCTGGAGTGCAGTGGG - Intronic
1038919381 8:32065818-32065840 CAGAGAGGATGTGGAGAAATAGG - Intronic
1038948613 8:32389591-32389613 CAGTGAGGATGGCCAGAACTAGG - Intronic
1039076481 8:33694475-33694497 TGGTGAGGATGTAGAGAAATTGG - Intergenic
1039103747 8:33967925-33967947 CAGTGGGGATGGAGCCAAGATGG - Intergenic
1039170520 8:34739583-34739605 CAGGGAGAATGGAGCCAAGTTGG + Intergenic
1039254791 8:35707160-35707182 CTGTGAGGATAGACAGAAATAGG + Intronic
1039366368 8:36932314-36932336 GAGAGAGGAGGGAGAGGAGTGGG - Intronic
1039375211 8:37026106-37026128 CAGGGAGGGTGGATTGAAGTAGG - Intergenic
1039669945 8:39584628-39584650 CAGTGAGGAGGGCGAGGAGAAGG - Exonic
1039801951 8:40965551-40965573 CAGGGAGGATGGAACCAAGTTGG + Intergenic
1039820405 8:41129563-41129585 CAGTGAGAATGAAGAAAAGCAGG + Intergenic
1040067886 8:43163111-43163133 CAGTGAGGTGGGAGGGAGGTTGG + Intronic
1040734845 8:50492372-50492394 CGGAGAGGATGTGGAGAAGTAGG - Intronic
1040756911 8:50787353-50787375 TAGTGAGGATGTAGAGAAATTGG + Intronic
1040885396 8:52257416-52257438 TGGTGAGGATAGAGAGAAATTGG - Intronic
1040962302 8:53047747-53047769 CAGGGAGGATGGAACCAAGTTGG - Intergenic
1040989326 8:53332674-53332696 TGGTGAGGATGCAGAGAAGTTGG - Intergenic
1040989987 8:53339190-53339212 CAGGGAGAATGGAGCCAAGTTGG + Intergenic
1041071101 8:54126747-54126769 CTTTGAGGATAGAGAAAAGTAGG + Intergenic
1041487187 8:58392189-58392211 CAGAGAAGATGGGGAGGAGTAGG - Intergenic
1041508865 8:58632524-58632546 CAGTGAGGTTGGAGAGAAGCAGG - Intronic
1041820176 8:62022781-62022803 TAGAGAGGATGTGGAGAAGTAGG + Intergenic
1041845255 8:62320931-62320953 CAGGGAGAATGGAAACAAGTTGG - Intronic
1041885430 8:62802162-62802184 CAGGGAGAATGGAAACAAGTTGG + Intronic
1042319225 8:67457532-67457554 CAGAGAGGATGGAAAGAAGAAGG - Intronic
1042425849 8:68647308-68647330 CCGTGAGGATGTAGAGAAAAGGG + Intronic
1042542024 8:69916852-69916874 CACTGAGGCTGGAGTGCAGTGGG - Intergenic
1042811068 8:72825528-72825550 CAGGGAGGACGTAGAGAAATTGG - Intronic
1042858285 8:73289076-73289098 CAGGGAGGATGGGGAAATGTGGG - Intergenic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1043135681 8:76521013-76521035 TGGTGAGGATGCAGAGAAATGGG - Intergenic
1043227329 8:77748558-77748580 CAGTGAGGAGGAACAGAATTAGG - Intergenic
1043356867 8:79423991-79424013 GAGAGAGGATGGAGAGAGGAAGG + Intergenic
1043461738 8:80467412-80467434 GAGGGAGAATTGAGAGAAGTTGG - Intergenic
1043701620 8:83295202-83295224 GGGAGAGGATGGAGAAAAGTGGG - Intergenic
1044094977 8:88052412-88052434 CAGTGGAGATGGAGCAAAGTGGG - Intronic
1044428606 8:92082885-92082907 AAGAGAGGAGGGAGAGAAGGAGG + Intronic
1044519113 8:93177259-93177281 GGGTGAGGATGAAGAGAACTGGG + Intergenic
1044604819 8:94039433-94039455 CAGTGGAGATGGAGAGAGATGGG + Intergenic
1044638610 8:94354575-94354597 TGGTGAGGATGTAGAGAAATTGG + Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1044915490 8:97109096-97109118 AAGTCAGGAAGAAGAGAAGTAGG - Intronic
1045125602 8:99086057-99086079 CAGGGAGAATGGAAACAAGTTGG - Intronic
1045252101 8:100490822-100490844 GAATGAGGAAGGAGAGAACTGGG - Intergenic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1045475588 8:102549746-102549768 GAGTGAGGATGGAGTGAGGGAGG - Intergenic
1045520465 8:102898659-102898681 CTGGGAGGAAGGAGAGAAGAGGG + Intronic
1045572133 8:103378950-103378972 CACTCAGGATGGAGTGCAGTGGG - Intronic
1045863622 8:106840256-106840278 CAATGAGGATGGAGAGAAGATGG - Intergenic
1046091980 8:109513813-109513835 CAGTGGAGGTGGTGAGAAGTGGG - Intronic
1046551857 8:115728193-115728215 GAGTGTGGATAGAGAAAAGTAGG + Intronic
1046790761 8:118319333-118319355 CAGGGTGAAGGGAGAGAAGTGGG - Intronic
1046972379 8:120237207-120237229 CAGGGAGAATGGAACGAAGTTGG - Intronic
1047030921 8:120879833-120879855 CAGTGGACCTGGAGAGAAGTTGG + Intergenic
1047312791 8:123706555-123706577 AGATGAGGATGGAGAGAAATGGG - Intronic
1047425921 8:124746967-124746989 TAATGAGGATGTAGAGAAATTGG + Intergenic
1047555340 8:125923308-125923330 CAGTGAGGATGGAGACTGGGGGG + Intergenic
1047631183 8:126710466-126710488 TAGAGAGGATGTAGAGAAATAGG + Intergenic
1047634485 8:126744996-126745018 CAGTGAAGATGAAGAAAAGTAGG + Intergenic
1047755400 8:127914320-127914342 TGGTGAGGATGTAGAGAAATTGG + Intergenic
1048011568 8:130461025-130461047 TAGTGAGGATGCAGAGAAAAGGG + Intergenic
1048048344 8:130794061-130794083 ATGTGAGGATGGAAAGAAATTGG + Intronic
1048196409 8:132335401-132335423 CAGTGAGACTGGAGAGAAGTTGG - Intronic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1048497711 8:134948811-134948833 CAGGGAAGATGAAGAGAAGGAGG - Intergenic
1049033610 8:140057194-140057216 TAGTGAGGATGTGGAGAAATTGG + Intronic
1049129727 8:140827547-140827569 GGGTGGGGATGGAGAGCAGTAGG + Intronic
1049460251 8:142723994-142724016 CATTGAGAATGGAGAGATTTAGG - Intergenic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1050207469 9:3212427-3212449 TGGGGAGGATGGAGAGAGGTTGG + Intergenic
1050218447 9:3357602-3357624 AAGGGAGGATGAAGAGAAGTTGG + Intronic
1050403481 9:5282138-5282160 TAGAGAGGATGTAGAGAAATAGG + Intergenic
1050569054 9:6918651-6918673 TAGTGAGGCTGTAGAGAAGGGGG - Intronic
1050580041 9:7044494-7044516 CAGTGATGATGGAGAGAACAGGG + Intronic
1050866083 9:10501173-10501195 CAATGAGGATGTAGAGAAAAGGG - Intronic
1051075537 9:13230160-13230182 TGGTGAGGATGTAGAGAAGCTGG + Intronic
1051413563 9:16815377-16815399 CAGGAAGGATGGACAGCAGTAGG + Intronic
1051417638 9:16859209-16859231 CTGTGAGGTTGTAGAGAAATTGG + Intronic
1052286898 9:26796609-26796631 AAGGGAGGATAGAGAGATGTTGG - Intergenic
1052511582 9:29428528-29428550 TAGAGAGGATGTGGAGAAGTAGG + Intergenic
1052692031 9:31827177-31827199 CAGTGAGGATGTGGAGAAAAGGG + Intergenic
1052954257 9:34241103-34241125 GAGTGAGGAAGGAGTGAATTGGG + Intronic
1053375736 9:37604798-37604820 CAGGGAGAATGAAGGGAAGTGGG + Intronic
1054752981 9:68927404-68927426 CAGTGAGGATGTAGAGAAACTGG - Intronic
1055227770 9:74021111-74021133 TAGTGAGGATGTAGAGAAAAGGG + Intergenic
1055572811 9:77633641-77633663 CAGAGAGGATGGCAAGAAGCGGG + Intronic
1056024248 9:82476209-82476231 CAGTGAGGGAGGAGAGAGGCAGG - Intergenic
1056182849 9:84102389-84102411 CAGTGAGGAGGGAAAGAAGGAGG + Intergenic
1056190375 9:84178775-84178797 CAGAGAGGATGTGGAGAATTAGG - Intergenic
1056267196 9:84909565-84909587 CAGTGAGGATGTGGAGAAACAGG - Intronic
1056426212 9:86479792-86479814 CAGGGAGAATGGAAACAAGTTGG - Intergenic
1056470820 9:86903264-86903286 AAGCGCGGATGGAGAGGAGTAGG - Intergenic
1057363694 9:94398852-94398874 CACTGAGGCTGGAGTGCAGTGGG + Intronic
1057659641 9:96989235-96989257 CACTGAGGCTGGAGTGCAGTGGG - Intronic
1057787319 9:98096709-98096731 CAGTGGGGATGGGGAGAAACAGG - Intronic
1058091685 9:100813014-100813036 AAGTGAGAATGGAGAGAAAGGGG + Intergenic
1058266482 9:102905238-102905260 CGGTGAGGATGCAGAGAAATAGG + Intergenic
1058285001 9:103166664-103166686 CAGTGAGGATGTGGAGAAGTGGG - Intergenic
1058732292 9:107861922-107861944 AAGAGCAGATGGAGAGAAGTGGG + Intergenic
1058843747 9:108934964-108934986 CAGTAGGGATGGCGAGAAGAGGG + Intronic
1059113269 9:111577318-111577340 TGGTGAGTATGTAGAGAAGTTGG + Intronic
1059169622 9:112113032-112113054 CATTCATGATGAAGAGAAGTTGG - Intronic
1059589408 9:115641884-115641906 CAGTGAGGTTGGAGATCATTGGG - Intergenic
1059660479 9:116395264-116395286 CTTTCAGGATGGAGAGAGGTTGG + Intronic
1059702158 9:116785742-116785764 AAGTCAGCATGGAGAGAGGTGGG - Intronic
1059770159 9:117416133-117416155 CAGGGAAGATGAAGAAAAGTAGG - Intergenic
1060100345 9:120834864-120834886 CAGTGAGGATAGAGAGAAGAGGG + Intronic
1060146424 9:121256529-121256551 AAGAGAGGATGAAGAGAAGTTGG + Intronic
1060258656 9:122054727-122054749 CTGTGAGGAAGTAGAGAACTGGG - Intronic
1060550683 9:124483640-124483662 CAGTGATGATGGAGACAAGATGG - Intronic
1060956829 9:127647589-127647611 CAGAGGAGATGGTGAGAAGTGGG - Intronic
1061208030 9:129175493-129175515 CAGAGAGGATAGAGAGGTGTGGG - Intergenic
1061630388 9:131868606-131868628 GAGTGAGGATGTCCAGAAGTTGG + Intronic
1061633137 9:131886420-131886442 CAGTGGGGGTAGGGAGAAGTGGG - Intronic
1061651320 9:132052673-132052695 CATTGAGGACGGAGAAAGGTGGG - Intronic
1061776226 9:132966706-132966728 CAGTTATGATGGAGAGAACTGGG + Intronic
1061947352 9:133916148-133916170 CAGGGAGAATGGAGGGAAGGAGG + Intronic
1062665353 9:137668101-137668123 CAGTGGGGAGGCAGACAAGTAGG + Intronic
1062675123 9:137738413-137738435 CAGTGAGGATGCGGAGAAATGGG + Intronic
1185669524 X:1795007-1795029 AAGTGAGGATGGAGAGACGTTGG - Intergenic
1185895017 X:3850376-3850398 CAGCCAGGATGTAGAGAAATGGG + Intergenic
1185900135 X:3888801-3888823 CAGCCAGGATGTAGAGAAATGGG + Intergenic
1185905251 X:3927229-3927251 CAGCCAGGATGTAGAGAAATGGG + Intergenic
1186155179 X:6717833-6717855 TGGTGAGGATGCAGAGAAGAGGG - Intergenic
1186374293 X:8981685-8981707 CGGTGAGGAGGAAGAGTAGTAGG - Intergenic
1186393696 X:9186373-9186395 CAGTGAGAAGGGAGGGAAGCAGG + Intergenic
1186527286 X:10260520-10260542 TAGTGAGGAGGGAGAGCATTAGG - Intergenic
1186534800 X:10335506-10335528 GAGAGAGGATTAAGAGAAGTTGG + Intergenic
1186678837 X:11850306-11850328 TAGCGAGGATGTGGAGAAGTTGG + Intergenic
1186680904 X:11872890-11872912 CTGTGAGGATGTGGAGAAATTGG + Intergenic
1186716234 X:12254936-12254958 GAGTGAGCATGAAGTGAAGTGGG - Intronic
1186927139 X:14346612-14346634 GAGGGAGGATGTAGAGAAGTTGG - Intergenic
1186989948 X:15056619-15056641 CAGAGAGGATGTGGAGAAATAGG + Intergenic
1187087643 X:16058212-16058234 AAGTGAGGATGTGGAGAAATTGG + Intergenic
1187119467 X:16390217-16390239 TTGTGAGGATGCAGAGAAATTGG + Intergenic
1187171535 X:16856668-16856690 TAGTGAGGATGTAGAGAAACTGG + Intronic
1187184955 X:16975349-16975371 CAGTGAGGTTGCAGAGAAAAAGG - Intronic
1187289395 X:17938490-17938512 CAGTGAGAATTAAAAGAAGTAGG - Intergenic
1187380415 X:18796688-18796710 CAATGAGGAGAGAGAGAAGTGGG + Intronic
1187408888 X:19029840-19029862 CAGAGAGGAGGGAGAGAAGGAGG + Intronic
1187454550 X:19429706-19429728 AAGTGTGGATGGAGAGAAGGTGG + Intronic
1187593979 X:20750511-20750533 TGGTGAGGATGTAGAGAAATGGG - Intergenic
1187718717 X:22130138-22130160 CAATGGGGAGGGAAAGAAGTGGG - Intronic
1187830464 X:23375606-23375628 CAGTGAGCATGAAGACAACTTGG - Intronic
1187972886 X:24676331-24676353 GAGGGAGGATGAAGAGAAGTGGG + Intergenic
1188059399 X:25582422-25582444 CAGTGATGAAGGTGAGATGTAGG + Intergenic
1188221880 X:27550662-27550684 GAGGGAAGATGGAGAGAGGTTGG - Intergenic
1188318717 X:28708816-28708838 GGGAGAGGATGAAGAGAAGTGGG + Intronic
1188321875 X:28748918-28748940 AGGGGAGGAAGGAGAGAAGTTGG - Intronic
1188335665 X:28929417-28929439 CAGTAAGGAATGAGAGGAGTGGG - Intronic
1188466111 X:30483116-30483138 GAGGTAGGATGAAGAGAAGTTGG + Intergenic
1188580034 X:31700366-31700388 CAATGTGTATGGAGAGGAGTTGG + Intronic
1188599274 X:31941497-31941519 ACAGGAGGATGGAGAGAAGTGGG - Intronic
1188793751 X:34437620-34437642 CAGTGAGGAGGAACAGAATTGGG - Intergenic
1189133222 X:38521932-38521954 CGGAGAGGATGTAGAGAAATAGG - Intronic
1189192061 X:39118847-39118869 CAGTGAGGGAGGAGGGAAGCAGG + Intergenic
1189198991 X:39175595-39175617 CAGTGGGGAAGGAGAGAGGAGGG + Intergenic
1189338681 X:40187487-40187509 CAGAGTGGATGGAGGGAAATGGG + Intergenic
1189370509 X:40424560-40424582 TGGTGAGGATGTAGAGAAATTGG - Intergenic
1189475904 X:41355423-41355445 TGGTGAGGATGCAGAGAAATTGG - Intronic
1189541493 X:41995779-41995801 TAGTGAGGGTGCAGAGAATTTGG + Intergenic
1189809521 X:44768344-44768366 CCTAGAGGATGGAGGGAAGTGGG + Intergenic
1190335464 X:49259073-49259095 CAGTGGAGAAGGCGAGAAGTGGG + Intronic
1190757654 X:53414796-53414818 CAGTGAGGAATTAGAGAAGTTGG - Exonic
1190837937 X:54118583-54118605 CGGAGAGGATGCAGAGAAGCTGG - Intronic
1190897658 X:54637007-54637029 CAGTGAGGTTGCAGAGAAAAGGG - Intergenic
1191053189 X:56216143-56216165 AAGTGAAGATGAAGAGAAGTAGG - Intergenic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191209332 X:57868651-57868673 TAGAGAGGATGCAGAGAAATAGG + Intergenic
1191218694 X:57961843-57961865 TTGTGAGGATGGGGAGAAATTGG - Intergenic
1191647116 X:63493635-63493657 CAGGGAGAATGGAAAAAAGTTGG + Intergenic
1191767841 X:64719817-64719839 CAGTCAGGATGGAAAGAAGGTGG - Intergenic
1191852343 X:65594702-65594724 CAGTGAATCAGGAGAGAAGTAGG + Intronic
1191911774 X:66159337-66159359 CGGTGGAGATAGAGAGAAGTGGG + Intergenic
1192020720 X:67387791-67387813 CGGTGAGAATGGAAACAAGTTGG + Intergenic
1192163193 X:68803982-68804004 CAGTGAGAATGGAGAGGAGGGGG + Intergenic
1192226887 X:69235043-69235065 CTGTAAGGATTGAGAGAAGAAGG + Intergenic
1192236182 X:69297605-69297627 GAGTGAGGAAGGAGAAAAGATGG - Intergenic
1192405894 X:70885948-70885970 TGGTGAGGATGTAGAGAAATTGG + Intronic
1192513096 X:71737845-71737867 TAGAGAGGATGCAGAGCAGTGGG - Intergenic
1192513601 X:71743668-71743690 TAGAGAGGATGCAGAGCAGTGGG + Intergenic
1192536318 X:71931032-71931054 TGGTGAGGATGCAGAGAAATTGG - Intergenic
1192658500 X:73017974-73017996 CAGTGAGGATGCAGAGAAAAGGG - Intergenic
1192769893 X:74177883-74177905 CAGTGAGGATGTGGAGAAAAGGG + Intergenic
1192910667 X:75601096-75601118 CGGTGAGAATGGAAACAAGTTGG - Intergenic
1193034624 X:76935771-76935793 CAGGGAGGATGGAACCAAGTTGG + Intergenic
1193182773 X:78478327-78478349 CAGAGAGGATGTGGAGAAATAGG - Intergenic
1193360155 X:80571824-80571846 CAGGGAGGAGGGAGAGAAAGAGG + Intergenic
1193452275 X:81685468-81685490 CAGGGAGGATGGAACAAAGTTGG + Intergenic
1193499314 X:82254610-82254632 CAGTGAGGTTGCAGAGAAAAGGG - Intergenic
1193550379 X:82885084-82885106 TAGTGAGGTTGCAGAGAAGAAGG + Intergenic
1193655627 X:84193676-84193698 TGGTGAGGATGGAGAGAAGAGGG - Intergenic
1193671466 X:84391583-84391605 TAGTGAGGATGCAGAGAAATAGG - Intronic
1193740033 X:85205892-85205914 CAATGGAGATAGAGAGAAGTGGG + Intergenic
1194617934 X:96130339-96130361 GAGTGAGGATGCAGAGACCTGGG - Intergenic
1195084366 X:101400366-101400388 TAGTGAAGATGGAAGGAAGTGGG + Intronic
1195147615 X:102032969-102032991 CAGGGAGAATGGAAAAAAGTTGG + Intergenic
1195177510 X:102325289-102325311 CGGTGAGAATGCAGAGAAATTGG + Intronic
1195181354 X:102361804-102361826 CGGTGAGAATGCAGAGAAATTGG - Intronic
1195405233 X:104505457-104505479 CACTGAGGCTGGAGTGAAATGGG + Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195548570 X:106140170-106140192 CAGGGAGGATGGAAACAACTTGG + Intergenic
1195626490 X:107009557-107009579 CGCTGAGGAAGGAGAGGAGTGGG + Intergenic
1195635771 X:107114193-107114215 CAGTGAAATTGGAGAGAGGTAGG - Intronic
1195655309 X:107326864-107326886 CGCTGAGGAAGGAGAGGAGTGGG + Intergenic
1195750535 X:108159046-108159068 CTGGGAGGGTGGAGAGAAGAGGG + Intronic
1195795209 X:108639894-108639916 TGGTGAGGATGTGGAGAAGTTGG + Intronic
1195799492 X:108691177-108691199 TGGGGAGGATGAAGAGAAGTGGG + Intronic
1195824040 X:108977836-108977858 TAGTGCGGTTGGGGAGAAGTGGG + Intergenic
1195846101 X:109230327-109230349 CAGGGAGAATGGAAACAAGTTGG + Intergenic
1195854819 X:109319509-109319531 CAGGGAGAATGGAAACAAGTTGG - Intergenic
1195935491 X:110121820-110121842 TAGTGAGGATGTTGAGAACTTGG - Intronic
1195941207 X:110169394-110169416 CAGTGAGGCTGGAGGAGAGTGGG - Intronic
1196642628 X:118080618-118080640 CAGTGAGGCTGCAGAGAAAAGGG + Intronic
1196661139 X:118270105-118270127 TAGTGAGGATGTGGAGAAGAGGG + Intergenic
1196703452 X:118696507-118696529 AAAGGAGGATGAAGAGAAGTGGG - Intergenic
1196856471 X:119989993-119990015 GGGTGAGGATGGAGGGAAGACGG + Intergenic
1196883191 X:120219017-120219039 GAGGGAGGATGAAGAGAAGTTGG + Intergenic
1196903224 X:120407134-120407156 AAGTGGGGATGGATAGAAATGGG - Intergenic
1197180346 X:123528959-123528981 CAGTGAGGATGCTGAGAAAAGGG - Intergenic
1197359630 X:125484252-125484274 TGGTGAGGATGTGGAGAAGTTGG + Intergenic
1197400529 X:125983896-125983918 CAGTGAGGTGAGACAGAAGTAGG - Intergenic
1197739472 X:129878508-129878530 TAGTGAGGATGGGGAGAAAAGGG - Intergenic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1197878969 X:131144407-131144429 CAGTGAGGATAGAGAACAGATGG - Intergenic
1197973460 X:132139438-132139460 CAGTGAGGATGCAGAGAAAAGGG - Intergenic
1198388239 X:136148003-136148025 GAGTGAGGAGGGAGTGAAGGGGG + Intronic
1198599826 X:138270343-138270365 CAGTGAGAACGGAGGAAAGTAGG - Intergenic
1198629435 X:138618380-138618402 GAGTGGGGATAGAAAGAAGTAGG - Intergenic
1199271391 X:145886811-145886833 CAGTCAGGAAGGAGAGAACATGG + Intergenic
1199338734 X:146650532-146650554 CAGTGAAGTTCAAGAGAAGTGGG + Intergenic
1199595722 X:149504650-149504672 AAGAAAGGATGGAGAGAAGGAGG + Intronic
1199686702 X:150271591-150271613 CAGTGGAGGTGGAGACAAGTGGG + Intergenic
1199778314 X:151034968-151034990 GACAGAGGATGGAGAGAAGGAGG - Intergenic
1199916205 X:152343596-152343618 CTGTGTGAATGGAGAGAATTTGG - Intronic
1199932837 X:152541994-152542016 TGGTGAGGATGCAGAGAAATTGG - Intergenic
1199968677 X:152842346-152842368 CAGTGAGGATGTGGAGAACCTGG - Intronic
1200271869 X:154692814-154692836 TAGTGAGGATGTGGAGAAATTGG + Intronic
1200298869 X:154952161-154952183 CCATGAGGCTGGAGAGAAGAGGG + Intronic
1200819608 Y:7569013-7569035 CAGAGAGGAGGTAGAGAAATAGG + Intergenic
1200836019 Y:7732275-7732297 CAGTGAGGAAGGGGAGAGCTAGG - Intergenic
1200899672 Y:8416835-8416857 CAGTGAGGAGGAAGAGATTTGGG - Intergenic
1201308391 Y:12571095-12571117 CAGGGAGAATGGAAACAAGTTGG + Intergenic
1201463836 Y:14257813-14257835 CACTGAGGCTGGAGTGCAGTGGG - Intergenic
1201549245 Y:15202038-15202060 TCGTGAGGATGCAGAGAAGAGGG + Intergenic
1201561347 Y:15320903-15320925 CAGGGAGAATGGAGCCAAGTTGG - Intergenic
1201741247 Y:17326303-17326325 AAGTAAGGAAGGAGAGAAGAGGG + Intergenic
1201858303 Y:18569186-18569208 CAGTTAGGAGGGAAAGAAGTGGG + Intronic
1201875018 Y:18751195-18751217 CAGTTAGGAGGGAAAGAAGTGGG - Intronic