ID: 1098387198

View in Genome Browser
Species Human (GRCh38)
Location 12:69931972-69931994
Sequence CTGTATATACAGATATCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 297}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098387198_1098387201 -4 Left 1098387198 12:69931972-69931994 CCCAGAGATATCTGTATATACAG 0: 1
1: 0
2: 2
3: 13
4: 297
Right 1098387201 12:69931991-69932013 ACAGGTGACAAATTGAATACTGG 0: 1
1: 0
2: 1
3: 11
4: 150
1098387198_1098387203 25 Left 1098387198 12:69931972-69931994 CCCAGAGATATCTGTATATACAG 0: 1
1: 0
2: 2
3: 13
4: 297
Right 1098387203 12:69932020-69932042 AATTTTAAAAAGTGTTTAGTGGG 0: 1
1: 0
2: 13
3: 129
4: 1065
1098387198_1098387202 24 Left 1098387198 12:69931972-69931994 CCCAGAGATATCTGTATATACAG 0: 1
1: 0
2: 2
3: 13
4: 297
Right 1098387202 12:69932019-69932041 TAATTTTAAAAAGTGTTTAGTGG 0: 1
1: 0
2: 15
3: 159
4: 1163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098387198 Original CRISPR CTGTATATACAGATATCTCT GGG (reversed) Intronic
900660988 1:3783559-3783581 CTGTGTTTACAGAAATCACTGGG + Intronic
902975812 1:20087677-20087699 CTGTATATATATATATGACTTGG - Intronic
903656555 1:24952334-24952356 CTGTTTATTGAGTTATCTCTTGG - Intronic
905304794 1:37010039-37010061 CTGTATTTACCGACATCTTTGGG + Intronic
905331509 1:37203837-37203859 CTGGGTGTACAAATATCTCTTGG - Intergenic
906143854 1:43548762-43548784 CTGGAGAGACAGATATCCCTGGG - Intronic
906865945 1:49420171-49420193 CTGTAAAGACAAAAATCTCTCGG + Intronic
906972423 1:50530159-50530181 ATTTATATACAGCTATCTCAGGG + Intronic
908086219 1:60637009-60637031 ATTTATAAACAGATATCTTTTGG + Intergenic
909372981 1:74908160-74908182 TTGTATATAAATATTTCTCTTGG + Intergenic
911933797 1:103940024-103940046 TTGCATATACGGTTATCTCTTGG + Intergenic
914698375 1:150107222-150107244 CTGAATATACAGATGTCTAGTGG + Intronic
916948149 1:169750312-169750334 TTGTATATACAGTGGTCTCTGGG - Intronic
917087833 1:171321314-171321336 ATATATATACAGTTGTCTCTTGG + Intronic
918279528 1:182990342-182990364 CAATGTATACAGATAACTCTAGG - Intergenic
918519057 1:185394849-185394871 CTGTAAACACAGATAGTTCTGGG - Intergenic
919598067 1:199589330-199589352 TTCTATACACAGATAACTCTTGG - Intergenic
920865217 1:209746669-209746691 TTGTTTGTACAGATTTCTCTTGG + Intergenic
921463594 1:215458721-215458743 CTGTATGTACTGATATCATTTGG + Intergenic
921501438 1:215908967-215908989 ATGTATATATAGATATATATAGG - Intronic
921819783 1:219604224-219604246 CTATAGATATAGATATATCTGGG - Intergenic
922394860 1:225187389-225187411 ATGTATATAGATATATATCTGGG + Intronic
924029742 1:239874263-239874285 CTGTGTATATAGATATATATAGG - Intronic
924882467 1:248176731-248176753 GAATATATACAGATACCTCTTGG + Intergenic
1064984362 10:21195188-21195210 CTGTATCTACTGACATTTCTAGG - Intergenic
1065289713 10:24217597-24217619 TTCTATATACAGATCTTTCTAGG + Intronic
1067363762 10:45606089-45606111 CAGAATATACAGTTGTCTCTTGG + Intergenic
1067485317 10:46643643-46643665 CTCTATTTACAAATATATCTCGG + Intergenic
1067609441 10:47698020-47698042 CTCTATTTACAAATATATCTCGG - Intergenic
1067999370 10:51313641-51313663 CTATATATACAGTTGTCCCTTGG + Intronic
1068104187 10:52592776-52592798 CTGGATATACAGGCATATCTTGG - Intergenic
1069904785 10:71725796-71725818 CTGTATCCACAGAGCTCTCTAGG + Intronic
1073496018 10:103891721-103891743 AAGGATATACAGTTATCTCTCGG + Intronic
1073872196 10:107878301-107878323 ATGTATATACATATAACTCAAGG - Intergenic
1074228871 10:111513916-111513938 CTGTTTGTACAGAATTCTCTCGG - Intergenic
1074462286 10:113648856-113648878 CTGTACCTACAGACATGTCTAGG + Intronic
1075751727 10:124777832-124777854 TTCTATGTACAGATATCTTTAGG - Intronic
1076503867 10:130958889-130958911 ATGTATATACAGTCATCCCTAGG - Intergenic
1077769852 11:5204648-5204670 CTACATATGCAGAAATCTCTTGG + Intergenic
1077940178 11:6832395-6832417 CTGTCTGTACAGATAACTGTAGG - Intergenic
1077959032 11:7052980-7053002 CTGTGTATACATATATATCATGG - Intronic
1078286628 11:9962634-9962656 TTGCAAAAACAGATATCTCTAGG + Intronic
1078883319 11:15475014-15475036 CTGAAAATACAGTCATCTCTTGG - Intergenic
1080959575 11:37142611-37142633 ATGTATCTACAGAGTTCTCTGGG + Intergenic
1083211917 11:61193645-61193667 TTTTACATACTGATATCTCTGGG + Intergenic
1085470596 11:76755060-76755082 ATATATATACACATATATCTGGG + Intergenic
1086837888 11:91648261-91648283 CTGTTTATGCAGAAATTTCTAGG - Intergenic
1087869181 11:103270382-103270404 CTGTAGATATAGATATGTATAGG - Intronic
1088131269 11:106494609-106494631 CTGAGTATACAGATAACTGTTGG + Intergenic
1089262839 11:117234037-117234059 CTGTATTTACATAAATATCTAGG - Intronic
1089714587 11:120345743-120345765 CTGTATATATATATATATTTAGG - Intronic
1090285888 11:125498573-125498595 ATGTATATATATATATGTCTTGG + Exonic
1090430938 11:126645912-126645934 CTGTTTAAACATAAATCTCTGGG - Intronic
1090970253 11:131636304-131636326 CTTTATATATAGCTGTCTCTTGG + Intronic
1091515366 12:1174898-1174920 CTGTATATACAGGTATACCTCGG + Intronic
1091816891 12:3445566-3445588 CTGTGTAGACAAATAGCTCTCGG + Intronic
1092396222 12:8129103-8129125 CTGAAACTATAGATATCTCTAGG - Intronic
1093678294 12:21969849-21969871 CTGTATTTAAAAATATTTCTGGG - Intergenic
1093700112 12:22210788-22210810 CTGTGTATAGAGAAATCTTTAGG - Intronic
1095228970 12:39713942-39713964 CTGTATATACACGTATATATAGG - Intronic
1095931713 12:47634650-47634672 GTGTATATACACATATATGTGGG + Intergenic
1096569335 12:52512117-52512139 CGGTATATACAGACAGGTCTGGG - Intergenic
1097446257 12:59675912-59675934 CTATATATATATATATATCTGGG - Intronic
1097820733 12:64126779-64126801 CTGCATATACACACATTTCTTGG - Intronic
1097947423 12:65386979-65387001 CTATATATCCTGATATTTCTTGG + Intronic
1098268258 12:68745557-68745579 ATATATATACAGCTGTCTCTAGG - Exonic
1098387198 12:69931972-69931994 CTGTATATACAGATATCTCTGGG - Intronic
1098828800 12:75333343-75333365 CTGGATATAAAGATATCTATAGG - Intronic
1099248684 12:80225006-80225028 GTGTATATACATATATATATGGG - Intronic
1099796167 12:87402756-87402778 GTGTATATACAAATATTTGTAGG + Intergenic
1100383726 12:94086064-94086086 CTATATATATAGTCATCTCTTGG - Intergenic
1102749938 12:115283882-115283904 GTGTATATATATATATATCTGGG - Intergenic
1104129087 12:125875380-125875402 CTGCATAGTCAGATATCACTGGG + Intergenic
1104698833 12:130885540-130885562 CTGAATATACAGCTATTTTTGGG + Intergenic
1105660306 13:22487093-22487115 CTGGATTTACAGATGTCTCCTGG + Intergenic
1106130405 13:26934729-26934751 CTGCATGTACAGATATCACATGG - Intergenic
1107137637 13:36961612-36961634 ATATATATACAGTTGTCTCTTGG - Intronic
1108398797 13:50017818-50017840 CTGTCTATTCAGATATTTTTTGG + Intronic
1108581223 13:51829995-51830017 CTGTTTGTACAGAATTCTCTTGG - Intergenic
1109452740 13:62539558-62539580 GTGTTTAAACTGATATCTCTTGG + Intergenic
1109550424 13:63890772-63890794 GTGTATATATATATATATCTGGG + Intergenic
1109660495 13:65452554-65452576 CTATATATATATATATATCTTGG - Intergenic
1110556820 13:76869297-76869319 ATATATGTACAGATATCTCAAGG - Intergenic
1110918669 13:81056873-81056895 CTGTATATTCAGATTCTTCTTGG + Intergenic
1111353309 13:87062603-87062625 TTGTAATTACAGCTATCTCTGGG - Intergenic
1111400677 13:87730496-87730518 ATGAATATACATATATCTATAGG + Intergenic
1111447575 13:88369120-88369142 CTGTATATTCACATAGCTCCAGG + Intergenic
1111856444 13:93643566-93643588 CTGTTTGTACAGATTTTTCTGGG + Intronic
1111948140 13:94687200-94687222 ATGTATATACATATATATATGGG + Intergenic
1112354252 13:98660991-98661013 CTGAATATACAGATGGCTCGTGG - Intergenic
1113247220 13:108411092-108411114 CTGTAAATACAGATGACCCTTGG + Intergenic
1113285731 13:108846504-108846526 GTGTATATACATATATCCTTTGG + Intronic
1114769958 14:25417807-25417829 CTATATATATAAATATCTATAGG - Intergenic
1115088466 14:29545694-29545716 CTGCATATACAAATATCATTAGG + Intergenic
1115496538 14:34010457-34010479 CTGTATGGATAGATATCACTGGG + Intronic
1115542031 14:34429819-34429841 CTGCACATACAGATATCACCTGG - Intronic
1115790046 14:36868319-36868341 CAATATATACAGATGTCTCTGGG + Intronic
1117184842 14:53229476-53229498 CTGGGTATACAAATATCTTTTGG + Intergenic
1117774761 14:59172047-59172069 CTGAAAATACAGATATATTTTGG + Intergenic
1119697348 14:76723825-76723847 CTGTATGTACAGATTTCTCTTGG - Intergenic
1120417368 14:84236739-84236761 CTATATATGCAGTCATCTCTTGG + Intergenic
1120488321 14:85144271-85144293 CTGTATAAACCTATATCTCTTGG + Intergenic
1121150838 14:91632967-91632989 CTGTTTGTACAAATTTCTCTTGG - Intronic
1123418308 15:20109190-20109212 CTATATATACAGATGTCGTTAGG + Intergenic
1123527526 15:21115724-21115746 CTATATATACAGATGTCGTTAGG + Intergenic
1123635041 15:22297017-22297039 CTGAATCTGCAGATATCTTTAGG - Intergenic
1123911861 15:24976150-24976172 CTGTGTTTACAGATATTTTTTGG + Intronic
1126252598 15:46586738-46586760 CTGTTTTTAAAAATATCTCTTGG + Intergenic
1127211271 15:56777208-56777230 CTGTATATTCAGATTCTTCTTGG - Intronic
1128825113 15:70707953-70707975 ATGGATATGCAGATATCTCTAGG - Intronic
1128949313 15:71859312-71859334 GTGTTTTTACATATATCTCTTGG - Intronic
1130811739 15:87386202-87386224 CTTTAAATTCAGATACCTCTGGG + Intergenic
1131542166 15:93283736-93283758 GTGTACATGTAGATATCTCTTGG + Intergenic
1132007542 15:98242815-98242837 ATGAATATACAAATATCTGTTGG - Intergenic
1135334814 16:21592440-21592462 CTGTTTATGCAGAAATTTCTAGG - Intergenic
1136661818 16:31769586-31769608 CTGAATATACAGACTTCCCTGGG + Intronic
1137689945 16:50418024-50418046 CTGAAGAGACAAATATCTCTAGG - Intergenic
1138055955 16:53833507-53833529 CTCTGTATACAAATATCTGTGGG + Intronic
1138412342 16:56850509-56850531 CTGTACTTACAGAGACCTCTGGG - Intergenic
1138741921 16:59320984-59321006 CTGTTTATTCAGGTATCTATGGG - Intergenic
1138932113 16:61671575-61671597 CTGTCTAAACATATATCTTTGGG + Intronic
1139233139 16:65306531-65306553 CTGAAACTACAGACATCTCTGGG + Intergenic
1140632267 16:76867659-76867681 CTGTTTATACAGCTAACTCAGGG - Intergenic
1141798763 16:86292852-86292874 GTGTTTATACAGAGATGTCTGGG + Intergenic
1141873839 16:86807776-86807798 CTGTGTCTACAGATGTCACTAGG + Intergenic
1143368605 17:6424352-6424374 CTGCATATACAAAGATTTCTAGG - Exonic
1143847265 17:9781915-9781937 CTTTAGATTGAGATATCTCTAGG - Intronic
1146232453 17:31125316-31125338 TTGTATATATATATATATCTGGG + Intronic
1149084085 17:52693413-52693435 CTGTAATTACAGATTTCTGTGGG + Intergenic
1152984864 18:312201-312223 CTGTATATATATATATCCCATGG - Intergenic
1153368359 18:4285293-4285315 CTAGATAGAAAGATATCTCTGGG - Intronic
1153866459 18:9274053-9274075 CTGTTTGTACAGAATTCTCTTGG + Intronic
1155704097 18:28786222-28786244 TTTTATATACATATATCTCAAGG + Intergenic
1156132190 18:33989427-33989449 CTGTATTAAAAGTTATCTCTTGG - Intronic
1156633897 18:39004079-39004101 CTGTATATACAGATCTGTAAAGG + Intergenic
1156988473 18:43377674-43377696 CTATCTATACACATATATCTTGG - Intergenic
1158119695 18:54035234-54035256 CTGTATAAACAGAGATATCATGG + Intergenic
1158880325 18:61772777-61772799 CTGTATACAGAGAAATCTTTAGG + Intergenic
1159386286 18:67729387-67729409 CTGTAAGTACAGTCATCTCTTGG + Intergenic
1159407112 18:68018309-68018331 CTGTATATATATTTATTTCTTGG + Intergenic
1160360845 18:78276631-78276653 ATGTATATACATATATGTATAGG + Intergenic
1165948024 19:39456874-39456896 ATATGTACACAGATATCTCTAGG + Intronic
1166058687 19:40310761-40310783 GTAAATATACAGATATTTCTGGG + Intergenic
925665179 2:6246542-6246564 CTGTATATTTTAATATCTCTGGG + Intergenic
926479387 2:13371325-13371347 CTGAATCTGCAGATATCTTTAGG - Intergenic
926738678 2:16093610-16093632 TGATAAATACAGATATCTCTGGG + Intergenic
927671107 2:25069667-25069689 CAGTATGTGCAGAAATCTCTAGG + Intronic
928859775 2:35843592-35843614 GTGTATATATAGAGATCTATGGG + Intergenic
931110203 2:59102172-59102194 ATGAATAAACAGATATATCTTGG - Intergenic
931428780 2:62194008-62194030 GTTTAAATAAAGATATCTCTAGG - Intergenic
933076138 2:77929076-77929098 CTGAATCTACAGATCACTCTGGG + Intergenic
933393256 2:81699863-81699885 TTGCATCTACAGTTATCTCTTGG - Intergenic
935064346 2:99635104-99635126 TGATATATACACATATCTCTAGG + Intronic
935064347 2:99635131-99635153 TGATATATACACATATCTCTAGG + Intronic
936947439 2:117943205-117943227 ATGTATATATAGACATGTCTTGG + Intronic
937482330 2:122275703-122275725 GTGTATGTACAGATATATATAGG - Intergenic
938609036 2:132927431-132927453 CTGAATATACAGATTGCTTTAGG + Intronic
939562428 2:143748604-143748626 CTCTACACACAGATATCACTTGG + Intronic
940469594 2:154079171-154079193 CTTTATATCCATAAATCTCTTGG - Intronic
941349783 2:164417838-164417860 CTGCATATGCAGATTTCACTTGG - Intergenic
942775364 2:179575130-179575152 CTGTATATGCAGATACCTCCTGG + Intronic
942779059 2:179619294-179619316 CTGTATATGTATATTTCTCTTGG - Intronic
943040646 2:182800724-182800746 ATGTATATAATGATATGTCTTGG + Intergenic
943261168 2:185665526-185665548 CAGTTTATACAGAAATTTCTGGG - Intergenic
943387236 2:187217105-187217127 CTGTCTATTCAGATTTTTCTTGG - Intergenic
944352308 2:198743027-198743049 CTGCAGAGACAAATATCTCTAGG + Intergenic
944818647 2:203406382-203406404 CTATATATAGACACATCTCTTGG - Intronic
1170301896 20:14893257-14893279 ATGGATGTGCAGATATCTCTTGG + Intronic
1170427521 20:16249683-16249705 CTGTTTGTACAGAATTCTCTTGG - Intergenic
1170576408 20:17665092-17665114 CTGTGTATACATATATATGTGGG + Intronic
1170772007 20:19341074-19341096 CTGTATTTTCAGAACTCTCTGGG - Intronic
1172265445 20:33608673-33608695 TTGTATATACATATACCTATTGG - Intronic
1173326578 20:42038921-42038943 TTGTACATTCAGATATCTGTGGG - Intergenic
1173484517 20:43430581-43430603 CGGTTTATACAGAAATTTCTAGG - Intergenic
1175142454 20:56871072-56871094 CTGTATCTACAGATCTCTGTGGG + Intergenic
1177319402 21:19500769-19500791 CTTTGCATACAGACATCTCTGGG - Intergenic
1177892086 21:26818226-26818248 CTGTACTTACAAATTTCTCTGGG - Intergenic
1178309474 21:31517823-31517845 TTGTTTGTACAGATTTCTCTTGG - Intronic
1178394688 21:32232167-32232189 CTATATATCTAGATATTTCTAGG + Intergenic
1181350426 22:22251927-22251949 CTATATATACAGATGTCGTTAGG + Intergenic
1181770589 22:25122413-25122435 CAGTTTATGCAGAAATCTCTAGG - Intronic
1181884945 22:26013525-26013547 ATGAATATACAGATTTCTGTCGG + Intronic
1183330021 22:37214389-37214411 CTGTTCATACAGATTTCTTTTGG - Intergenic
949255093 3:2036350-2036372 CAGTATATGCAGACATTTCTAGG - Intergenic
949849122 3:8404089-8404111 CTGTCTTTAGAGGTATCTCTGGG + Intergenic
949966321 3:9359549-9359571 CTGTCTATTCAGATGCCTCTTGG + Intronic
950353823 3:12385620-12385642 CTGTATTTACTTATATCTTTAGG - Intronic
951041251 3:17990983-17991005 CTGTAGGTACACATCTCTCTGGG + Intronic
951083281 3:18478167-18478189 GTGTATATATAGATATATATAGG - Intergenic
951928066 3:27931835-27931857 CTGTGTAAACAGATATCTTCAGG - Intergenic
953599779 3:44350811-44350833 CTGTAACAACAGCTATCTCTAGG - Intronic
954163086 3:48735598-48735620 CTGTTTAAGCAGAAATCTCTAGG + Intronic
955953510 3:64265563-64265585 CTGTGTATGCAGAGATCTGTGGG - Intronic
956000469 3:64724628-64724650 CTGTATAGATAGATATGTTTTGG + Intergenic
956100518 3:65763186-65763208 CTGTTTATACAGAACTCTCTTGG - Intronic
956272445 3:67462353-67462375 CTGTCTATACAGATGCTTCTTGG - Intronic
956280997 3:67556610-67556632 CTGTATCTGCATATATTTCTTGG + Intronic
957194282 3:77047741-77047763 ATGTATATAAAGATATATATGGG + Intronic
960175805 3:114516364-114516386 CTCTATAAACATATATGTCTTGG + Intronic
960408461 3:117291714-117291736 CTGTCTTTGCAGAGATCTCTTGG + Intergenic
960687668 3:120310615-120310637 CTGTAGATTCAGGTATTTCTTGG + Intergenic
965119338 3:164531361-164531383 TTGAATATACAGATTTCTTTTGG + Intergenic
965642994 3:170850967-170850989 ATGTCTATGCAGATATGTCTTGG - Intronic
966689519 3:182728393-182728415 CTGTTTGTACAGATTTCTCTTGG - Intergenic
966823804 3:183946477-183946499 CTGTGAAGACACATATCTCTGGG + Intronic
970592722 4:17573506-17573528 TTGTTTGTACAGATTTCTCTCGG - Intergenic
970646328 4:18125086-18125108 CTGTATACAAGTATATCTCTAGG - Intergenic
971099143 4:23443218-23443240 TTGTATATAGAGAAATCTTTAGG + Intergenic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
972635016 4:40876520-40876542 CTGTATATACCGTTGTCGCTTGG + Intronic
973813506 4:54596467-54596489 ATGGGTATGCAGATATCTCTTGG - Intergenic
975464647 4:74695584-74695606 CTGTGTATATAGATTTCCCTAGG - Intergenic
976662811 4:87557680-87557702 CTGTATATTCTTCTATCTCTAGG + Intergenic
977033083 4:91912519-91912541 CTTTATATACATATAACCCTTGG + Intergenic
977244669 4:94617309-94617331 CTGTTTAAACAGGTAACTCTTGG + Intronic
977349957 4:95870701-95870723 ATATATATAGATATATCTCTAGG + Intergenic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978056273 4:104271808-104271830 CAGTATATCCAGTTATCTCTAGG - Intergenic
978125217 4:105127238-105127260 TTGTTTATGCAAATATCTCTTGG + Intergenic
980468199 4:133214280-133214302 CAGTATATACAGTCATCTTTTGG - Intergenic
981155882 4:141434388-141434410 CTGTATATCCAGATACCTCTTGG + Intergenic
982221206 4:153126667-153126689 CTATCTATACAGATATCTACTGG - Intergenic
983450505 4:167905369-167905391 GTGTATATACATATATGTATAGG - Intergenic
983770554 4:171543862-171543884 GTGTATTTACAGACATCACTGGG - Intergenic
984031839 4:174613521-174613543 CTGTTTGTACAGAATTCTCTTGG + Intergenic
985150265 4:186939914-186939936 CTGTATGTTCAGATGTCACTTGG - Intergenic
986821184 5:11468523-11468545 CTGTATCTACAGAGAGATCTGGG - Intronic
988109606 5:26801154-26801176 CTATATATATATATATATCTGGG - Intergenic
988293361 5:29320042-29320064 ATATAGATACAGATATCTTTGGG + Intergenic
991506148 5:67326417-67326439 ATGGATATACATATATCTATGGG - Intergenic
991506167 5:67326576-67326598 ATGGATATACATATATCTATGGG - Intergenic
991517393 5:67453105-67453127 ATATATATATATATATCTCTTGG + Intergenic
992140525 5:73792472-73792494 CTGTATGTACAGAATTCTTTAGG + Intronic
992285656 5:75232908-75232930 CTGTTTGTACAGAATTCTCTTGG - Intronic
992746025 5:79821232-79821254 CTGGATATAAAGAATTCTCTTGG + Intergenic
993418570 5:87669684-87669706 CTGGATATACAGTGGTCTCTTGG + Intergenic
994659837 5:102640606-102640628 ATGTATTTTCATATATCTCTAGG + Intergenic
995215177 5:109587343-109587365 CTGTTTGTACAGAATTCTCTTGG - Intergenic
996497168 5:124172069-124172091 TTGTATAAACACATATTTCTGGG - Intergenic
998442295 5:142172769-142172791 CTGTTTGTTCAGATTTCTCTTGG + Intergenic
999462409 5:151769080-151769102 CTTCATTTACTGATATCTCTTGG + Intronic
999902976 5:156106765-156106787 CTGTATACACAGATATTAGTGGG - Intronic
1003967356 6:11265714-11265736 ATGTAAATACAGTTATCTTTAGG - Intronic
1004153407 6:13143470-13143492 CTGTGTGTGCAGATATCTCCTGG + Intronic
1005819257 6:29583766-29583788 CTGTAATTACAGCTATTTCTTGG + Intronic
1008954203 6:57197608-57197630 CTGTATATCTATATATCACTGGG + Intronic
1008995176 6:57650858-57650880 CCATCTATACAGCTATCTCTTGG + Intergenic
1009565855 6:65310367-65310389 CTATAGATATAGATATATCTGGG + Intronic
1009612682 6:65966267-65966289 CTGTATCTACAGTTGCCTCTGGG - Intergenic
1010258540 6:73789054-73789076 CTGTAAATACAGAAACATCTGGG + Intronic
1011675887 6:89733547-89733569 CTGTATATATATATAGCTTTTGG - Intronic
1013930811 6:115530337-115530359 ATATATATATATATATCTCTAGG - Intergenic
1014149007 6:118031779-118031801 CAGTTTATGCAGAAATCTCTAGG + Intronic
1014997184 6:128163063-128163085 CTGCATTTACAAATATTTCTTGG - Intronic
1015265151 6:131284158-131284180 GTGTATATACAGATATCCTCTGG + Intergenic
1016247404 6:141999628-141999650 TTGAATCTACAGATTTCTCTGGG - Intergenic
1018013222 6:159690536-159690558 CTGTGTATTCAGATATCAGTTGG - Intronic
1018601702 6:165550894-165550916 GTGTATATATACTTATCTCTTGG - Intronic
1019851705 7:3565583-3565605 GTGTATAAACAGTCATCTCTTGG + Intronic
1020553219 7:9634570-9634592 GTGTACATACATATATATCTTGG + Intergenic
1020591810 7:10148233-10148255 CTGTTTATTCAGATTCCTCTTGG - Intergenic
1020662567 7:10999313-10999335 CTATATATTCAAATATCTCCAGG - Intronic
1020983605 7:15103934-15103956 ATTTATATACATATATATCTAGG + Intergenic
1021035366 7:15791671-15791693 CTGTATATGGATTTATCTCTGGG - Intergenic
1021819873 7:24486228-24486250 ATGTATATACAGTTGTCCCTAGG - Intergenic
1022163309 7:27733246-27733268 CTCTAGAAACAGATTTCTCTGGG - Intergenic
1022614998 7:31920259-31920281 CTGGACACACAGATATCTCCAGG + Intronic
1023244419 7:38185764-38185786 CTGTATAGAAAGATAGGTCTGGG + Intronic
1023361634 7:39422875-39422897 CAGAATAGACAGATATTTCTCGG + Intronic
1026546094 7:71323695-71323717 CTGTGCATACAGAAATCTCCTGG - Intronic
1026650562 7:72212517-72212539 CTTAATATTCAGATATTTCTAGG + Intronic
1028771012 7:94621517-94621539 CTGTAGATACAGATTACTCAAGG - Intronic
1028973356 7:96884167-96884189 ATGTATATACAGTCATCCCTTGG - Intergenic
1029680635 7:102106621-102106643 CAGTTTATACAGAAATTTCTAGG - Intronic
1030852397 7:114506562-114506584 ATGTATATATATATATCTCAAGG - Intronic
1031360161 7:120839804-120839826 ATGTTTATACAGACATTTCTGGG - Intronic
1031767664 7:125802112-125802134 CTGTATAAGCAGAGAGCTCTAGG + Intergenic
1032899551 7:136291485-136291507 CTGTATCTAAAGATATCTATAGG + Intergenic
1036100757 8:5781552-5781574 CTGAATATATAGATAAGTCTGGG + Intergenic
1041440765 8:57894084-57894106 GTGCATATACACATATCTGTAGG + Intergenic
1041589038 8:59555265-59555287 CTGTCTTTAAAGGTATCTCTAGG - Intergenic
1043000327 8:74751839-74751861 CTGTATAAACAGATGACTGTAGG + Intronic
1044967556 8:97587792-97587814 CTTTATATACAGTTATGTTTAGG + Intergenic
1045600209 8:103706815-103706837 CTGTATATCCATCTTTCTCTAGG + Intronic
1046264801 8:111816846-111816868 TTGTAGAGACTGATATCTCTGGG - Intergenic
1047867869 8:129048195-129048217 CTGTATATAAATATATTTCATGG - Intergenic
1048219673 8:132529792-132529814 CTTTAAATGCAAATATCTCTAGG - Intergenic
1050647245 9:7733337-7733359 CTATATATACAGTTGTCCCTCGG + Intergenic
1050788421 9:9434700-9434722 TTGTATATACATATATTTCTGGG - Intronic
1051073238 9:13198961-13198983 TTGAATATATAGATATCTTTTGG + Intronic
1051073245 9:13199077-13199099 ATGAATATATAGATATCTTTTGG + Intronic
1051317016 9:15849310-15849332 CTCTATATACATATATATATAGG - Intronic
1051720921 9:20036699-20036721 GTGTATATACAGTCATCTTTCGG + Intergenic
1055019433 9:71653241-71653263 TTGTATATACACATATTTATTGG + Intergenic
1055508169 9:76969309-76969331 CTGGATATAGAGTGATCTCTAGG + Intergenic
1058169222 9:101659281-101659303 ATTTATATACATATATATCTTGG - Intronic
1058799689 9:108533272-108533294 ATATATATACAGGTATGTCTAGG + Intergenic
1059420602 9:114188607-114188629 ATGTATATACAAATATATCTTGG - Intronic
1060264124 9:122100438-122100460 CTGTATCTACAGGTATGTCAAGG + Intergenic
1186087717 X:6009197-6009219 CTGCGTATACAAATATCTCCTGG + Intronic
1188357724 X:29212964-29212986 CTGAATATACAGTTGACTCTCGG - Intronic
1188570852 X:31583742-31583764 ATATATATATATATATCTCTAGG - Intronic
1189710117 X:43801994-43802016 TTGTATGTACAGATATCTTCAGG + Intronic
1190339849 X:49287401-49287423 CTGTTAATAAATATATCTCTGGG - Exonic
1194349633 X:92809780-92809802 TTGTGTACACAGAAATCTCTAGG + Intergenic
1194892779 X:99401242-99401264 CTGTATTTACTGAGATCACTTGG - Intergenic
1195958007 X:110354582-110354604 TTTAATATACAGTTATCTCTTGG - Intronic
1196981764 X:121222052-121222074 CTGTATTTTTAGATATCTGTGGG - Intergenic
1197590968 X:128409542-128409564 CTGTATTTACGGATAGCCCTTGG - Intergenic
1198778887 X:140212963-140212985 GTGTATATACATATATGTATGGG - Intergenic
1198778890 X:140213004-140213026 ATGTATATACATATATGTATGGG + Intergenic
1199728722 X:150609542-150609564 CTGTATATCCAGCCATCTCCTGG + Intronic
1200657955 Y:5926381-5926403 TTGTGTACACAGAAATCTCTAGG + Intergenic