ID: 1098391650

View in Genome Browser
Species Human (GRCh38)
Location 12:69975961-69975983
Sequence GTGCAAACACACACACATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098391649_1098391650 -2 Left 1098391649 12:69975940-69975962 CCACAAAAGGAATCAAAGCAAGT No data
Right 1098391650 12:69975961-69975983 GTGCAAACACACACACATATTGG No data
1098391648_1098391650 2 Left 1098391648 12:69975936-69975958 CCAACCACAAAAGGAATCAAAGC No data
Right 1098391650 12:69975961-69975983 GTGCAAACACACACACATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098391650 Original CRISPR GTGCAAACACACACACATAT TGG Intergenic
No off target data available for this crispr