ID: 1098394657

View in Genome Browser
Species Human (GRCh38)
Location 12:70005371-70005393
Sequence GGCTTTGCACCTGCCACACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098394657_1098394668 15 Left 1098394657 12:70005371-70005393 CCTAGTGTGGCAGGTGCAAAGCC No data
Right 1098394668 12:70005409-70005431 GACCACAATGGCTGGGGGAGGGG No data
1098394657_1098394661 3 Left 1098394657 12:70005371-70005393 CCTAGTGTGGCAGGTGCAAAGCC No data
Right 1098394661 12:70005397-70005419 GTGATTAATTCTGACCACAATGG No data
1098394657_1098394667 14 Left 1098394657 12:70005371-70005393 CCTAGTGTGGCAGGTGCAAAGCC No data
Right 1098394667 12:70005408-70005430 TGACCACAATGGCTGGGGGAGGG No data
1098394657_1098394664 9 Left 1098394657 12:70005371-70005393 CCTAGTGTGGCAGGTGCAAAGCC No data
Right 1098394664 12:70005403-70005425 AATTCTGACCACAATGGCTGGGG No data
1098394657_1098394663 8 Left 1098394657 12:70005371-70005393 CCTAGTGTGGCAGGTGCAAAGCC No data
Right 1098394663 12:70005402-70005424 TAATTCTGACCACAATGGCTGGG No data
1098394657_1098394669 16 Left 1098394657 12:70005371-70005393 CCTAGTGTGGCAGGTGCAAAGCC No data
Right 1098394669 12:70005410-70005432 ACCACAATGGCTGGGGGAGGGGG No data
1098394657_1098394662 7 Left 1098394657 12:70005371-70005393 CCTAGTGTGGCAGGTGCAAAGCC No data
Right 1098394662 12:70005401-70005423 TTAATTCTGACCACAATGGCTGG No data
1098394657_1098394671 17 Left 1098394657 12:70005371-70005393 CCTAGTGTGGCAGGTGCAAAGCC No data
Right 1098394671 12:70005411-70005433 CCACAATGGCTGGGGGAGGGGGG No data
1098394657_1098394665 10 Left 1098394657 12:70005371-70005393 CCTAGTGTGGCAGGTGCAAAGCC No data
Right 1098394665 12:70005404-70005426 ATTCTGACCACAATGGCTGGGGG No data
1098394657_1098394672 18 Left 1098394657 12:70005371-70005393 CCTAGTGTGGCAGGTGCAAAGCC No data
Right 1098394672 12:70005412-70005434 CACAATGGCTGGGGGAGGGGGGG No data
1098394657_1098394666 13 Left 1098394657 12:70005371-70005393 CCTAGTGTGGCAGGTGCAAAGCC No data
Right 1098394666 12:70005407-70005429 CTGACCACAATGGCTGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098394657 Original CRISPR GGCTTTGCACCTGCCACACT AGG (reversed) Intergenic
No off target data available for this crispr