ID: 1098394659

View in Genome Browser
Species Human (GRCh38)
Location 12:70005392-70005414
Sequence GTGGTCAGAATTAATCACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098394659_1098394668 -6 Left 1098394659 12:70005392-70005414 CCCAGGTGATTAATTCTGACCAC No data
Right 1098394668 12:70005409-70005431 GACCACAATGGCTGGGGGAGGGG No data
1098394659_1098394669 -5 Left 1098394659 12:70005392-70005414 CCCAGGTGATTAATTCTGACCAC No data
Right 1098394669 12:70005410-70005432 ACCACAATGGCTGGGGGAGGGGG 0: 1
1: 0
2: 0
3: 49
4: 637
1098394659_1098394673 27 Left 1098394659 12:70005392-70005414 CCCAGGTGATTAATTCTGACCAC No data
Right 1098394673 12:70005442-70005464 TGATTAAATTTCCCACATATTGG No data
1098394659_1098394671 -4 Left 1098394659 12:70005392-70005414 CCCAGGTGATTAATTCTGACCAC No data
Right 1098394671 12:70005411-70005433 CCACAATGGCTGGGGGAGGGGGG No data
1098394659_1098394667 -7 Left 1098394659 12:70005392-70005414 CCCAGGTGATTAATTCTGACCAC No data
Right 1098394667 12:70005408-70005430 TGACCACAATGGCTGGGGGAGGG No data
1098394659_1098394672 -3 Left 1098394659 12:70005392-70005414 CCCAGGTGATTAATTCTGACCAC No data
Right 1098394672 12:70005412-70005434 CACAATGGCTGGGGGAGGGGGGG No data
1098394659_1098394666 -8 Left 1098394659 12:70005392-70005414 CCCAGGTGATTAATTCTGACCAC No data
Right 1098394666 12:70005407-70005429 CTGACCACAATGGCTGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098394659 Original CRISPR GTGGTCAGAATTAATCACCT GGG (reversed) Intergenic