ID: 1098394660

View in Genome Browser
Species Human (GRCh38)
Location 12:70005393-70005415
Sequence TGTGGTCAGAATTAATCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098394660_1098394668 -7 Left 1098394660 12:70005393-70005415 CCAGGTGATTAATTCTGACCACA No data
Right 1098394668 12:70005409-70005431 GACCACAATGGCTGGGGGAGGGG No data
1098394660_1098394672 -4 Left 1098394660 12:70005393-70005415 CCAGGTGATTAATTCTGACCACA No data
Right 1098394672 12:70005412-70005434 CACAATGGCTGGGGGAGGGGGGG No data
1098394660_1098394667 -8 Left 1098394660 12:70005393-70005415 CCAGGTGATTAATTCTGACCACA No data
Right 1098394667 12:70005408-70005430 TGACCACAATGGCTGGGGGAGGG No data
1098394660_1098394669 -6 Left 1098394660 12:70005393-70005415 CCAGGTGATTAATTCTGACCACA No data
Right 1098394669 12:70005410-70005432 ACCACAATGGCTGGGGGAGGGGG No data
1098394660_1098394666 -9 Left 1098394660 12:70005393-70005415 CCAGGTGATTAATTCTGACCACA No data
Right 1098394666 12:70005407-70005429 CTGACCACAATGGCTGGGGGAGG No data
1098394660_1098394673 26 Left 1098394660 12:70005393-70005415 CCAGGTGATTAATTCTGACCACA No data
Right 1098394673 12:70005442-70005464 TGATTAAATTTCCCACATATTGG No data
1098394660_1098394671 -5 Left 1098394660 12:70005393-70005415 CCAGGTGATTAATTCTGACCACA No data
Right 1098394671 12:70005411-70005433 CCACAATGGCTGGGGGAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098394660 Original CRISPR TGTGGTCAGAATTAATCACC TGG (reversed) Intergenic
No off target data available for this crispr