ID: 1098394669

View in Genome Browser
Species Human (GRCh38)
Location 12:70005410-70005432
Sequence ACCACAATGGCTGGGGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098394657_1098394669 16 Left 1098394657 12:70005371-70005393 CCTAGTGTGGCAGGTGCAAAGCC No data
Right 1098394669 12:70005410-70005432 ACCACAATGGCTGGGGGAGGGGG No data
1098394659_1098394669 -5 Left 1098394659 12:70005392-70005414 CCCAGGTGATTAATTCTGACCAC No data
Right 1098394669 12:70005410-70005432 ACCACAATGGCTGGGGGAGGGGG No data
1098394660_1098394669 -6 Left 1098394660 12:70005393-70005415 CCAGGTGATTAATTCTGACCACA No data
Right 1098394669 12:70005410-70005432 ACCACAATGGCTGGGGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098394669 Original CRISPR ACCACAATGGCTGGGGGAGG GGG Intergenic
No off target data available for this crispr