ID: 1098394673

View in Genome Browser
Species Human (GRCh38)
Location 12:70005442-70005464
Sequence TGATTAAATTTCCCACATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098394659_1098394673 27 Left 1098394659 12:70005392-70005414 CCCAGGTGATTAATTCTGACCAC No data
Right 1098394673 12:70005442-70005464 TGATTAAATTTCCCACATATTGG No data
1098394670_1098394673 8 Left 1098394670 12:70005411-70005433 CCACAATGGCTGGGGGAGGGGGG No data
Right 1098394673 12:70005442-70005464 TGATTAAATTTCCCACATATTGG No data
1098394660_1098394673 26 Left 1098394660 12:70005393-70005415 CCAGGTGATTAATTCTGACCACA No data
Right 1098394673 12:70005442-70005464 TGATTAAATTTCCCACATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098394673 Original CRISPR TGATTAAATTTCCCACATAT TGG Intergenic