ID: 1098394693

View in Genome Browser
Species Human (GRCh38)
Location 12:70005618-70005640
Sequence GCAGCCTGCTAGGCTAGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098394683_1098394693 30 Left 1098394683 12:70005565-70005587 CCAACAAGAAGTTTACAGGAAAC No data
Right 1098394693 12:70005618-70005640 GCAGCCTGCTAGGCTAGAATTGG No data
1098394688_1098394693 8 Left 1098394688 12:70005587-70005609 CCCTTAAGGCAAGGAGGGAGAGG No data
Right 1098394693 12:70005618-70005640 GCAGCCTGCTAGGCTAGAATTGG No data
1098394690_1098394693 7 Left 1098394690 12:70005588-70005610 CCTTAAGGCAAGGAGGGAGAGGT No data
Right 1098394693 12:70005618-70005640 GCAGCCTGCTAGGCTAGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098394693 Original CRISPR GCAGCCTGCTAGGCTAGAAT TGG Intergenic
No off target data available for this crispr