ID: 1098405573

View in Genome Browser
Species Human (GRCh38)
Location 12:70122901-70122923
Sequence AGAGAGAGTGCAGTGACTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098405570_1098405573 14 Left 1098405570 12:70122864-70122886 CCATGTAGCACAGGGACAGAATC No data
Right 1098405573 12:70122901-70122923 AGAGAGAGTGCAGTGACTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098405573 Original CRISPR AGAGAGAGTGCAGTGACTAG AGG Intergenic
No off target data available for this crispr