ID: 1098405580

View in Genome Browser
Species Human (GRCh38)
Location 12:70122983-70123005
Sequence TCCCTCTGTGGATGGGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098405580_1098405586 -9 Left 1098405580 12:70122983-70123005 CCAGCACCCCATCCACAGAGGGA No data
Right 1098405586 12:70122997-70123019 ACAGAGGGAGCATTTGGACCAGG No data
1098405580_1098405588 3 Left 1098405580 12:70122983-70123005 CCAGCACCCCATCCACAGAGGGA No data
Right 1098405588 12:70123009-70123031 TTTGGACCAGGGCTAGCCTGAGG No data
1098405580_1098405590 5 Left 1098405580 12:70122983-70123005 CCAGCACCCCATCCACAGAGGGA No data
Right 1098405590 12:70123011-70123033 TGGACCAGGGCTAGCCTGAGGGG No data
1098405580_1098405589 4 Left 1098405580 12:70122983-70123005 CCAGCACCCCATCCACAGAGGGA No data
Right 1098405589 12:70123010-70123032 TTGGACCAGGGCTAGCCTGAGGG No data
1098405580_1098405587 -8 Left 1098405580 12:70122983-70123005 CCAGCACCCCATCCACAGAGGGA No data
Right 1098405587 12:70122998-70123020 CAGAGGGAGCATTTGGACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098405580 Original CRISPR TCCCTCTGTGGATGGGGTGC TGG (reversed) Intergenic
No off target data available for this crispr