ID: 1098405661

View in Genome Browser
Species Human (GRCh38)
Location 12:70123488-70123510
Sequence TGTCCTTCCATTCAAGTCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098405661_1098405667 22 Left 1098405661 12:70123488-70123510 CCACCGACTTGAATGGAAGGACA No data
Right 1098405667 12:70123533-70123555 GTGCTGACTTAAGAGCCCCTGGG No data
1098405661_1098405664 -10 Left 1098405661 12:70123488-70123510 CCACCGACTTGAATGGAAGGACA No data
Right 1098405664 12:70123501-70123523 TGGAAGGACACAGTCCTGGCAGG No data
1098405661_1098405666 21 Left 1098405661 12:70123488-70123510 CCACCGACTTGAATGGAAGGACA No data
Right 1098405666 12:70123532-70123554 TGTGCTGACTTAAGAGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098405661 Original CRISPR TGTCCTTCCATTCAAGTCGG TGG (reversed) Intergenic
No off target data available for this crispr