ID: 1098405664

View in Genome Browser
Species Human (GRCh38)
Location 12:70123501-70123523
Sequence TGGAAGGACACAGTCCTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098405657_1098405664 2 Left 1098405657 12:70123476-70123498 CCAAAAGGAAACCCACCGACTTG No data
Right 1098405664 12:70123501-70123523 TGGAAGGACACAGTCCTGGCAGG No data
1098405660_1098405664 -9 Left 1098405660 12:70123487-70123509 CCCACCGACTTGAATGGAAGGAC No data
Right 1098405664 12:70123501-70123523 TGGAAGGACACAGTCCTGGCAGG No data
1098405656_1098405664 8 Left 1098405656 12:70123470-70123492 CCTGGGCCAAAAGGAAACCCACC No data
Right 1098405664 12:70123501-70123523 TGGAAGGACACAGTCCTGGCAGG No data
1098405661_1098405664 -10 Left 1098405661 12:70123488-70123510 CCACCGACTTGAATGGAAGGACA No data
Right 1098405664 12:70123501-70123523 TGGAAGGACACAGTCCTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098405664 Original CRISPR TGGAAGGACACAGTCCTGGC AGG Intergenic
No off target data available for this crispr