ID: 1098405666

View in Genome Browser
Species Human (GRCh38)
Location 12:70123532-70123554
Sequence TGTGCTGACTTAAGAGCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098405665_1098405666 -6 Left 1098405665 12:70123515-70123537 CCTGGCAGGATTTGTCATGTGCT No data
Right 1098405666 12:70123532-70123554 TGTGCTGACTTAAGAGCCCCTGG No data
1098405661_1098405666 21 Left 1098405661 12:70123488-70123510 CCACCGACTTGAATGGAAGGACA No data
Right 1098405666 12:70123532-70123554 TGTGCTGACTTAAGAGCCCCTGG No data
1098405662_1098405666 18 Left 1098405662 12:70123491-70123513 CCGACTTGAATGGAAGGACACAG No data
Right 1098405666 12:70123532-70123554 TGTGCTGACTTAAGAGCCCCTGG No data
1098405660_1098405666 22 Left 1098405660 12:70123487-70123509 CCCACCGACTTGAATGGAAGGAC No data
Right 1098405666 12:70123532-70123554 TGTGCTGACTTAAGAGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098405666 Original CRISPR TGTGCTGACTTAAGAGCCCC TGG Intergenic
No off target data available for this crispr