ID: 1098407168

View in Genome Browser
Species Human (GRCh38)
Location 12:70138967-70138989
Sequence GGCTTCAGGGCTTCATACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098407168_1098407170 -10 Left 1098407168 12:70138967-70138989 CCTTTGTATGAAGCCCTGAAGCC No data
Right 1098407170 12:70138980-70139002 CCCTGAAGCCCTCTTTATCCTGG No data
1098407168_1098407174 6 Left 1098407168 12:70138967-70138989 CCTTTGTATGAAGCCCTGAAGCC No data
Right 1098407174 12:70138996-70139018 ATCCTGGACTAATGATATGAAGG No data
1098407168_1098407176 29 Left 1098407168 12:70138967-70138989 CCTTTGTATGAAGCCCTGAAGCC No data
Right 1098407176 12:70139019-70139041 TTGCTCTAAATACTTTAAAATGG No data
1098407168_1098407177 30 Left 1098407168 12:70138967-70138989 CCTTTGTATGAAGCCCTGAAGCC No data
Right 1098407177 12:70139020-70139042 TGCTCTAAATACTTTAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098407168 Original CRISPR GGCTTCAGGGCTTCATACAA AGG (reversed) Intergenic
No off target data available for this crispr