ID: 1098413287

View in Genome Browser
Species Human (GRCh38)
Location 12:70204295-70204317
Sequence AAAATTTTACAGATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098413284_1098413287 26 Left 1098413284 12:70204246-70204268 CCAACTACATGATGTCTACATGA No data
Right 1098413287 12:70204295-70204317 AAAATTTTACAGATGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098413287 Original CRISPR AAAATTTTACAGATGGAGGA AGG Intergenic
No off target data available for this crispr