ID: 1098414994

View in Genome Browser
Species Human (GRCh38)
Location 12:70223346-70223368
Sequence GCAAAACCCCAGTGTGTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098414994_1098414997 14 Left 1098414994 12:70223346-70223368 CCTTGAACACACTGGGGTTTTGC No data
Right 1098414997 12:70223383-70223405 TTGCCTGAAATGCTCCTCCCTGG No data
1098414994_1098414999 25 Left 1098414994 12:70223346-70223368 CCTTGAACACACTGGGGTTTTGC No data
Right 1098414999 12:70223394-70223416 GCTCCTCCCTGGATATTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098414994 Original CRISPR GCAAAACCCCAGTGTGTTCA AGG (reversed) Intergenic
No off target data available for this crispr