ID: 1098420950

View in Genome Browser
Species Human (GRCh38)
Location 12:70297334-70297356
Sequence CAGACTACAAACTCTGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098420950 Original CRISPR CAGACTACAAACTCTGTAGC TGG Intronic
903087003 1:20870297-20870319 AATACTACAAGCTCTGTATCTGG + Intronic
906364358 1:45193646-45193668 CAGACTACAAAACCTTTAGAAGG + Intronic
907481953 1:54751073-54751095 CTGACTCCAGAGTCTGTAGCTGG + Intergenic
911440325 1:97918594-97918616 CAGACTAGAAATTATGAAGCAGG + Intronic
912253738 1:108037987-108038009 CAGAGCACAAATTCTGAAGCCGG + Intergenic
914788306 1:150853382-150853404 CAGACTACAACCTCTGTAAAGGG + Intronic
916679479 1:167090838-167090860 CAGAATATAAACTCTGAAGGGGG - Intergenic
916689374 1:167175945-167175967 CAGTTTACAGACTCTGCAGCTGG - Intergenic
918880008 1:190106216-190106238 CAGAATACAAATTATGTAGCTGG - Intronic
919463403 1:197904481-197904503 AACACTAGGAACTCTGTAGCAGG - Intronic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
922110201 1:222548483-222548505 CAGACTTCACACTCTGTAGAAGG + Intergenic
922467948 1:225857157-225857179 TGGACTACCAACTCTGTACCTGG - Intronic
1063234506 10:4098764-4098786 CACACAACAAACTCCGAAGCTGG - Intergenic
1064718495 10:18203054-18203076 CAGACTACAGGGTCTGAAGCAGG + Intronic
1070055735 10:72932832-72932854 CAGACCACAAAATCAGAAGCTGG + Exonic
1070490708 10:76973799-76973821 CAGACTGCAAACACTGTGTCAGG + Intronic
1070648139 10:78215670-78215692 CAGACCCCAACCTCTGCAGCTGG + Intergenic
1070794578 10:79209322-79209344 CATACCACAAACTCTGGACCTGG - Intronic
1071282727 10:84117185-84117207 CAGACCACAGACCCTGTAGCAGG - Intergenic
1072493812 10:95934843-95934865 CAAACAAAAAACTCTGTGGCTGG - Intronic
1074882498 10:117669721-117669743 CAAACTACAATCTCTGGTGCTGG + Intergenic
1078000283 11:7489074-7489096 CAGAATACAAACCCTGAAGTGGG - Intronic
1078851183 11:15165547-15165569 CAGAGCAGAAACTCTATAGCTGG - Intronic
1080273978 11:30482888-30482910 CAGAGTTCAAACTCTGTAGAAGG + Intronic
1084140777 11:67227201-67227223 CAGACTACAAAGTATGAGGCAGG + Intronic
1084574647 11:69981220-69981242 CAGAGCACAAACTCTGGAGCTGG + Intergenic
1085231762 11:74978083-74978105 AGGACCACAAACTCTGAAGCCGG - Exonic
1088206490 11:107397911-107397933 CAGACAACAAACACTGCAGTCGG + Intronic
1088568172 11:111195200-111195222 GAGACTACAAACCCTGATGCTGG - Intergenic
1089687341 11:120163414-120163436 CAGGCTGGAAACTCTCTAGCAGG + Intronic
1090309833 11:125725741-125725763 CAGTCTACATACTGTGAAGCAGG - Intergenic
1090522516 11:127494574-127494596 CACTCTGCAAATTCTGTAGCTGG + Intergenic
1090695766 11:129239934-129239956 CAGACTACAAATTCTAAGGCAGG + Intronic
1090893527 11:130948968-130948990 AAGAGCACAAACTCTGGAGCAGG + Intergenic
1092296496 12:7203247-7203269 CAGACTACTAAATCAGTATCTGG + Intronic
1096411073 12:51377477-51377499 CAGCCTACATTCTCTATAGCAGG + Intronic
1097370107 12:58767930-58767952 CCAACTACAAATTCTTTAGCAGG - Intronic
1097495262 12:60323520-60323542 CAGAACACAAACTCTGTTTCAGG + Intergenic
1098420950 12:70297334-70297356 CAGACTACAAACTCTGTAGCTGG + Intronic
1099547304 12:84000622-84000644 AACACTACAAACTCAGAAGCCGG - Intergenic
1100983826 12:100186354-100186376 CAGACTACAAGCCCTGTTGAGGG + Intergenic
1101022459 12:100567053-100567075 CACACTTCCAACTCTGGAGCTGG - Intergenic
1105674614 13:22657052-22657074 CTCACTACAAACTTTGTGGCGGG - Intergenic
1109342766 13:61082480-61082502 CAGACTAAAAACTAAATAGCAGG - Intergenic
1112969841 13:105247346-105247368 CAGAGTAGAAACTCAGTATCTGG + Intergenic
1115745126 14:36428804-36428826 CAGAAGACAAACCCTGTAGAGGG + Intergenic
1122490477 14:102112116-102112138 CAAACTCCAAACACTGTAGGAGG - Intronic
1129317994 15:74757652-74757674 GAGACTGCAAACTCTGTCCCTGG - Intergenic
1134597280 16:15505938-15505960 CAGAGTACAGAATATGTAGCTGG + Intronic
1139762370 16:69195878-69195900 CAGACTATAAAATCTGGAGTGGG + Intronic
1140713350 16:77698539-77698561 TAGAATACAAACACTGTAGGTGG - Intergenic
1141344137 16:83229859-83229881 CAGACCAAACACTCTGAAGCTGG + Intronic
1142152088 16:88517107-88517129 CTGACTATAAATTCTGAAGCTGG - Intronic
1144171086 17:12660605-12660627 CACACAACAAACTGTTTAGCAGG - Intergenic
1144520117 17:15947616-15947638 CAGACGACTAACTCTGGGGCAGG - Intronic
1144754655 17:17671755-17671777 CAGACCACAATCTCTGCAACTGG - Intergenic
1146491885 17:33289345-33289367 CTGACTTCAACCTCTGCAGCAGG - Intronic
1146958435 17:36951063-36951085 CAGACTCCTAACTCTTTTGCAGG - Intronic
1150721441 17:67617428-67617450 CTTACTGCAAACTCTGCAGCTGG - Intronic
1152983712 18:303391-303413 CAGACTACAAAGTCCCTAGGTGG + Intergenic
1156820251 18:41363687-41363709 CAGACTAGAAACACTGCATCAGG + Intergenic
1157160569 18:45310492-45310514 AAGAATACAAACTCTTTGGCAGG + Intronic
1158154487 18:54409910-54409932 AAGAGTCCAAACTCTGGAGCTGG - Intergenic
1159570342 18:70104979-70105001 CAGATCTCAAACTCTGTAACGGG + Intronic
1168124171 19:54274647-54274669 CAGACTCCACACTCAGTAGAAGG - Exonic
926168067 2:10534041-10534063 CTGACTACAAGCTCTCTGGCTGG + Intergenic
928014174 2:27639202-27639224 TAGACTATAAACTCTGAAGCTGG - Intronic
938906045 2:135837000-135837022 CAGAGTTCTAACTTTGTAGCAGG - Exonic
940140154 2:150485089-150485111 CAGACTCGAAACTCTGGAGAAGG - Intronic
941441437 2:165541866-165541888 AAAACTATAAACTCTGTAGAAGG - Intronic
943652228 2:190469596-190469618 CAGACTCCAAACTCAGGAGTGGG - Intronic
945155791 2:206835735-206835757 CAGAGAACAATCTCTGCAGCAGG + Intergenic
945681261 2:212916895-212916917 CAGACTGGAAGCTCTGCAGCTGG + Intergenic
947151114 2:227116462-227116484 CAGACAGCAAAGTTTGTAGCTGG + Intronic
1175708582 20:61201359-61201381 CAGACTACAGTCTCTCTAGGTGG - Intergenic
1178370320 21:32021744-32021766 CAGACATCATAATCTGTAGCCGG + Intronic
1179514358 21:41896658-41896680 CCGAATACAAACTCCTTAGCAGG + Intronic
949415534 3:3809897-3809919 CAGAATGCAGACTTTGTAGCAGG - Intronic
950729333 3:14943436-14943458 CCCACTACATACTCTGTACCAGG + Intergenic
952442309 3:33343598-33343620 AATACTACAAACTCTTCAGCAGG + Intronic
952827555 3:37536987-37537009 CTGACTAGAAACTCTGAAGGTGG + Intronic
956875144 3:73455380-73455402 AAGACCATAAGCTCTGTAGCTGG - Intronic
958442540 3:94174012-94174034 AAGAACACAAAATCTGTAGCTGG - Intergenic
958459551 3:94377556-94377578 CTGATTACAAACTCTGGGGCTGG - Intergenic
958895164 3:99821277-99821299 CTGCCTACATACTCTGTAGCAGG - Intronic
959149005 3:102585804-102585826 CAGACTGAAAACTCTTGAGCAGG + Intergenic
962838939 3:139216063-139216085 CAAACTGCAAACTCTGTCTCTGG + Intronic
966023635 3:175247623-175247645 GAGTCTACAAATTATGTAGCTGG - Intronic
966650873 3:182299593-182299615 CAGAATTCAGACTCTGGAGCTGG + Intergenic
969228393 4:5813714-5813736 CAGGCTACAAGCTCGGTGGCGGG - Exonic
969658650 4:8513029-8513051 CAGACTGTAATCTCAGTAGCTGG + Intergenic
971176623 4:24288405-24288427 GAGATTACAAAGTCTGTAACAGG + Intergenic
971654113 4:29320275-29320297 CAGAATAGAAATTCTGAAGCTGG - Intergenic
983510542 4:168605398-168605420 GAGACTAGATACTCAGTAGCTGG - Intronic
984011970 4:174382158-174382180 CAGCCTGCAAACTCTTTAGGCGG + Intergenic
986111499 5:4723385-4723407 CACACTCCCATCTCTGTAGCTGG - Intergenic
991445700 5:66698108-66698130 CAGACTACATACTCTAAAGTGGG - Intronic
992125984 5:73641995-73642017 CAGGCTACAAACCCCGCAGCAGG - Intronic
992192880 5:74311423-74311445 CAGACTTCAAACTCTTTTGGCGG - Intergenic
996456690 5:123692700-123692722 TAGAATACAGACTTTGTAGCAGG - Intergenic
996595945 5:125202809-125202831 AAGCCTACAAATTATGTAGCTGG - Intergenic
996602361 5:125279115-125279137 CAGGCTTAGAACTCTGTAGCTGG + Intergenic
999283228 5:150378823-150378845 AAGAATACAGACTCTGGAGCTGG - Intronic
999907714 5:156162082-156162104 GGGACTACAAACTCATTAGCAGG - Intronic
1000846640 5:166289898-166289920 AAGAGTACAGAATCTGTAGCCGG - Intergenic
1001700906 5:173705878-173705900 CTGACTGCAAACACTGCAGCCGG - Intergenic
1015780327 6:136858928-136858950 CACACTACAAACTTTGCAGTTGG - Intronic
1018254125 6:161901624-161901646 CAGATTACAAACAATGGAGCGGG + Intronic
1018790320 6:167143333-167143355 CAGAATAGATGCTCTGTAGCTGG - Intergenic
1021054977 7:16036050-16036072 CAGGCTATAAGCTCTCTAGCAGG + Intergenic
1021312953 7:19116077-19116099 CAGTCTAGAGACTCTGGAGCTGG - Exonic
1023951885 7:44852723-44852745 CACACAAGAAACTCTGGAGCTGG - Intergenic
1026458292 7:70591746-70591768 TAGACTACAAAGTATGTTGCAGG - Intronic
1030223635 7:107125184-107125206 TAGAATATAGACTCTGTAGCTGG + Intronic
1030732028 7:113001865-113001887 AAGACTACAAACTCTGTGACTGG + Intergenic
1034210216 7:149356916-149356938 GAGACAACAAAGTCTGTACCTGG + Intergenic
1034333882 7:150307997-150308019 TGGACTCCAAACTCTGGAGCTGG + Intronic
1036730117 8:11255548-11255570 CAAACGAAAAACTCTGTAGGTGG + Intergenic
1037185995 8:16064455-16064477 CAGACTTCAAACTTGGAAGCTGG + Intergenic
1039915675 8:41858757-41858779 CACACAACAAACTGTGAAGCTGG - Intronic
1042498721 8:69485634-69485656 CAGACTGCAACCTCTGCAGTCGG + Intronic
1049138380 8:140927653-140927675 CAGACTCCATACTCTGTATCAGG + Intronic
1051755591 9:20396333-20396355 CAGACTACCAACTATGTGCCAGG + Intronic
1055803154 9:80062872-80062894 AAGACTAGAAACTCTGTAGCTGG - Intergenic
1057517013 9:95730137-95730159 GAGACTACGAACTCTACAGCAGG + Intergenic
1193342427 X:80365368-80365390 CAGAATACTTACTCTGTATCAGG - Intronic
1202083480 Y:21109919-21109941 CTGACAACAAACTTTGTACCAGG + Intergenic