ID: 1098426746

View in Genome Browser
Species Human (GRCh38)
Location 12:70372892-70372914
Sequence GGATGAACAGAGTTTCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098426746 Original CRISPR GGATGAACAGAGTTTCATCT TGG Intronic
900956465 1:5889082-5889104 CGATGAGAAGAGTTTCCTCTAGG - Intronic
902309249 1:15568369-15568391 AGAGGAAAAGATTTTCATCTAGG - Exonic
902881731 1:19376023-19376045 GGAAGAGCCCAGTTTCATCTTGG - Intronic
903922785 1:26812893-26812915 GGGTGAACAGAGTGTCCTCTGGG - Intergenic
905774218 1:40658137-40658159 TGATGAAAAGAGTTACATCTTGG + Intronic
906133715 1:43479831-43479853 GGAGGAACACACTTTCATCCAGG - Intergenic
906891326 1:49718418-49718440 TGAAGAAAAGAGTTTTATCTTGG - Intronic
913001401 1:114584021-114584043 GAATAAAAAGAGTCTCATCTAGG + Exonic
913131846 1:115845790-115845812 TAATCAGCAGAGTTTCATCTTGG + Intergenic
913562840 1:120040312-120040334 AGGTGAACAGAGTTTGATTTTGG - Intronic
913635282 1:120753295-120753317 AGGTGAACAGAGTTTGATTTTGG + Intergenic
914283436 1:146199695-146199717 AGGTGAACAGAGTTTGATTTTGG - Intronic
914544466 1:148650414-148650436 AGGTGAACAGAGTTTGATTTTGG - Intronic
914622164 1:149420591-149420613 AGGTGAACAGAGTTTGATTTTGG + Intergenic
916642593 1:166746660-166746682 AGATGAAGTGAGTTTCTTCTAGG - Intergenic
919767890 1:201139094-201139116 GACTGAAGAGGGTTTCATCTGGG - Intronic
921796684 1:219352773-219352795 GGATGAACAGAGCCTAAGCTGGG - Intergenic
922309962 1:224379130-224379152 TGATGAACTGAGCTGCATCTTGG - Exonic
1063241153 10:4170454-4170476 GGATGGACAGAGTCTCAACAGGG + Intergenic
1063984433 10:11486865-11486887 GGTGGAATAGAGTTTCATTTTGG - Intronic
1067207874 10:44235070-44235092 GGATGAACAGTGCTTCAACAGGG - Intergenic
1068072979 10:52219166-52219188 GGATGAATAGATTTTGAGCTGGG + Intronic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1074308309 10:112299308-112299330 GGATGAACAGTGTGTCTTCTGGG + Intronic
1074376483 10:112945061-112945083 AGGTGAAAAAAGTTTCATCTAGG - Intergenic
1080750669 11:35147453-35147475 GGAGCAAGAGAGTTTCCTCTGGG + Intronic
1080784006 11:35458258-35458280 GAATGAACACACATTCATCTGGG - Intronic
1082860555 11:57851642-57851664 GGATGAAGCCAATTTCATCTTGG - Intergenic
1083881165 11:65548922-65548944 GGAGGATCAGGGTTTCAGCTGGG + Intronic
1084120777 11:67067744-67067766 TGATGATCAGAGTTTCTTGTTGG + Intronic
1092535315 12:9381189-9381211 GTATCAACAGAGTTGCTTCTTGG - Intergenic
1093765582 12:22958435-22958457 AGATGAACAGAGTCTAAACTGGG - Intergenic
1098426746 12:70372892-70372914 GGATGAACAGAGTTTCATCTTGG + Intronic
1098583000 12:72123175-72123197 GAATGAACTGAATTTAATCTCGG + Intronic
1101708918 12:107247033-107247055 ATAGGAACAGAGTTTCAGCTTGG + Intergenic
1101835416 12:108291699-108291721 GGATGAACAGTGTTTTATGCTGG - Exonic
1106879270 13:34111754-34111776 GAATGAAAAGAGTTTTATCTGGG - Intergenic
1107988118 13:45793399-45793421 GGATGAACACAACTTAATCTGGG - Intronic
1110960442 13:81615826-81615848 GGATGACCAGACTAGCATCTGGG - Intergenic
1110973623 13:81800787-81800809 GGATGACTAGAGTTTAATCAAGG + Intergenic
1111200983 13:84936820-84936842 GCATGAACACAGTTTCTGCTTGG + Intergenic
1111330629 13:86759515-86759537 TGAAGAAATGAGTTTCATCTGGG + Intergenic
1112997920 13:105597023-105597045 GAAAGAAGAGAGTTTCATATAGG + Intergenic
1117290532 14:54327815-54327837 TTATGGATAGAGTTTCATCTGGG - Intergenic
1117418314 14:55518803-55518825 GTATGTACAGAGATTTATCTGGG - Intergenic
1117718906 14:58608856-58608878 GCATGAACACAGATTGATCTGGG - Intergenic
1117842406 14:59873413-59873435 GGCTGGAAAGAATTTCATCTTGG - Intergenic
1119017436 14:71073827-71073849 AGATAATCAGAGTTTCTTCTTGG + Intronic
1121274067 14:92656114-92656136 GGCTGACCACAGTTTCCTCTGGG - Intronic
1122462191 14:101904973-101904995 GTATGAACAGTGTTGAATCTGGG + Intronic
1122964794 14:105117754-105117776 GGAAGAGCAGGGTTTCAGCTGGG + Intergenic
1127660379 15:61095087-61095109 GGATGAACAGAATGTCCTTTGGG + Intronic
1129186353 15:73909487-73909509 TGAAGGACAGAGTTTCATCAGGG + Intergenic
1130303332 15:82696962-82696984 GGGTTATCAGAGTGTCATCTGGG - Intronic
1134026751 16:10959938-10959960 AGATGGACAGGGTGTCATCTTGG - Intronic
1135713563 16:24740038-24740060 TGTTGAAAAGACTTTCATCTTGG + Intronic
1136737181 16:32475585-32475607 GGATGCACAGACTCTCCTCTCGG - Intergenic
1140719638 16:77759537-77759559 GGATGAACATAGGTCCATCCTGG + Intergenic
1141013624 16:80426833-80426855 GCTTGAACAGAGTTTGATCAAGG + Intergenic
1142015808 16:87746574-87746596 GGATGAACAGAGATACCTCGCGG - Intronic
1203015889 16_KI270728v1_random:353992-354014 GGATGCACAGACTCTCCTCTCGG + Intergenic
1203034224 16_KI270728v1_random:627150-627172 GGATGCACAGACTCTCCTCTCGG + Intergenic
1143831645 17:9656761-9656783 TAATGAATAGAGTTTCATTTTGG + Intronic
1144331353 17:14227076-14227098 GGATTAACAGAGTTTCAAATTGG + Intergenic
1145722307 17:27084325-27084347 AGATGAACTGAGTTTCTTGTAGG - Intergenic
1146108594 17:30065707-30065729 TGGTGAACCGAGTTTCTTCTAGG - Intronic
1146797471 17:35793256-35793278 AGATGGAGAGAATTTCATCTTGG - Intronic
1147962336 17:44175591-44175613 TGATTATCAGAGTTTCATCGAGG + Intronic
1149479319 17:56989624-56989646 GGCTGCAAAGGGTTTCATCTTGG - Intronic
1153218605 18:2843305-2843327 AGATGAACTGATTTGCATCTAGG - Intergenic
1155532314 18:26779856-26779878 TGATTAACAGAGATTCATTTTGG - Intergenic
1155995979 18:32332022-32332044 GGGTGAAGAGAGTATCATCTAGG + Intronic
1157294836 18:46435092-46435114 AGATGAACAGCAGTTCATCTGGG + Intronic
1158244620 18:55417598-55417620 GGATGTACAGAGTTCCTTTTTGG - Intronic
1159194013 18:65087757-65087779 GGATGAATCCAGTTTCATTTTGG + Intergenic
1165101292 19:33440140-33440162 GGATGAACAGAAGAGCATCTGGG - Intronic
1167391036 19:49195220-49195242 GCATGTACAGAGTTTCTTGTTGG - Intronic
1168700583 19:58436972-58436994 GGATGAACAGAGCTTTCTATGGG + Intronic
925157593 2:1659293-1659315 GGCTGAAAAGAATTTCAGCTAGG + Intronic
927320254 2:21735567-21735589 AGATGAAAAGAGTATTATCTTGG + Intergenic
927346987 2:22056486-22056508 GGCTCAACAGACTTTGATCTAGG - Intergenic
927431045 2:23026342-23026364 TGATGAACAGATTTTCAATTTGG - Intergenic
928268338 2:29831539-29831561 GGATCAACAGAGTTGGAGCTAGG - Intronic
930804714 2:55478910-55478932 GGATGAGTAGACTTTCATCAGGG - Intergenic
932479962 2:72033175-72033197 GGATGATCAGAGTTTCATATTGG - Intergenic
933495841 2:83049352-83049374 GGATGTACACAGGTCCATCTAGG - Intergenic
933934678 2:87192625-87192647 GGAAGAATAGAGTTGCTTCTAGG + Intergenic
935740803 2:106146151-106146173 GGATAAAGGGAATTTCATCTGGG + Intronic
936358464 2:111773271-111773293 GGAAGAATAGAGTTGCTTCTAGG - Intronic
936964389 2:118113217-118113239 GGGTGAACAGATTTTGATGTTGG + Intergenic
939714597 2:145568516-145568538 GGATGTATGAAGTTTCATCTTGG + Intergenic
940956061 2:159729047-159729069 GGTTGAACAGAAATTCTTCTTGG - Exonic
941327608 2:164136367-164136389 GGGTTAAAAGTGTTTCATCTGGG + Intergenic
943224569 2:185153697-185153719 GAATGAACACAGTTTCCTTTAGG - Intergenic
944267129 2:197740766-197740788 GGGTGCACAGAGTTTCAACTTGG + Intronic
948151282 2:235747039-235747061 GGATGCACTGAGTGTCTTCTGGG - Intronic
1169107384 20:3008490-3008512 GTGGGTACAGAGTTTCATCTGGG + Intronic
1169568809 20:6884901-6884923 GGATGAAAAGAGTGTCAAATTGG + Intergenic
1170787657 20:19481640-19481662 GGATGAGCAGAGTTTGATGTTGG + Intronic
1172417137 20:34778745-34778767 AGATGAAAAGAGTTACATCCTGG + Intronic
1175287470 20:57846576-57846598 GGATGGTCAGTGTTTGATCTAGG - Intergenic
1177926141 21:27217913-27217935 GGATGAACAGAGGATAATCAAGG - Intergenic
949323787 3:2841206-2841228 GGATCAAAAGAGTTACAGCTGGG + Intronic
949841139 3:8321320-8321342 ACATGAGCAGAGTTTCAACTTGG - Intergenic
951328780 3:21339659-21339681 AGATGAAGTGAGTTTCATGTAGG + Intergenic
952448293 3:33405277-33405299 GGAAGAACAGAGTAAAATCTTGG + Intronic
953511251 3:43541990-43542012 ATATGATCAGAGTTTCATTTAGG + Intronic
953867274 3:46595296-46595318 TGATGAACAAAGTGTCATCAGGG - Intronic
964496249 3:157293446-157293468 GGAAGAACTGAATTTCTTCTTGG + Intronic
965673188 3:171168267-171168289 GGGTGACCCGAGTTTCATCAAGG - Intronic
966547807 3:181170557-181170579 ATAGGAACAGAGTTTCATTTAGG - Intergenic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
970258380 4:14195306-14195328 AAATGACCAGAGTTTTATCTAGG + Intergenic
972460832 4:39300613-39300635 GTGTGAACATAGTTTCATTTGGG - Intronic
972488023 4:39560762-39560784 GGATGAACAGAGATCCAGTTTGG - Intronic
974019880 4:56683473-56683495 GCATCAACAGAGTCTCATCCTGG + Intergenic
975200571 4:71583551-71583573 GGAAGAACATAGTTTCTTCTTGG - Intergenic
976909179 4:90279290-90279312 GTATGCACATAGTTTTATCTGGG + Intronic
979644328 4:123050700-123050722 AGGTGAAGAGAGTTTCTTCTAGG + Intronic
980385513 4:132084682-132084704 GGATGAAAAGTGTTTTTTCTTGG - Intergenic
981697030 4:147569330-147569352 GAAAGACCAGAGTTGCATCTGGG - Intergenic
982194739 4:152899596-152899618 GGATGAACACACTTTCAAGTTGG - Intronic
984785795 4:183566235-183566257 GCATGATCAGATTTGCATCTGGG + Intergenic
984959040 4:185076721-185076743 GGATGACAAGAGTTACAGCTTGG - Intergenic
985210555 4:187588136-187588158 GGAGGAACAGAGATTTATCAAGG + Intergenic
985713644 5:1444166-1444188 GGATGGACAGGGCTTCATCGCGG + Intronic
987193508 5:15501670-15501692 GGATGATAAGAGTTTCCTCCAGG - Intronic
989410193 5:41111590-41111612 GAATGAATAGAGTGTCCTCTGGG - Intergenic
993842868 5:92901798-92901820 AGATGAACAGAGTTTGAATTTGG + Intergenic
994716520 5:103328237-103328259 GGTTGAAAAGATTTTCAACTAGG - Intergenic
995645645 5:114308067-114308089 GGAAAAACATAGTTTCTTCTCGG - Intergenic
996208629 5:120776204-120776226 GGATGAATAGAATTTCAACAAGG - Intergenic
997400921 5:133601582-133601604 GGATGAACAGAGTGTGAGCAAGG + Intronic
999517724 5:152317905-152317927 GGATGAACAGTGTTTCATAAAGG + Intergenic
999903053 5:156107918-156107940 GAATGAACACAGTTGCCTCTTGG + Intronic
1000529090 5:162396123-162396145 GGGTGAAGTGAGTTTCTTCTAGG - Intergenic
1000572381 5:162930812-162930834 GGATGAATAGAAATTCATGTTGG + Intergenic
1003168328 6:3700657-3700679 GGATGAACAAAGTTGCATGAAGG + Intergenic
1004919479 6:20362777-20362799 AAATAAACAGAGTGTCATCTGGG - Intergenic
1005907403 6:30276218-30276240 TGATAAACAGAGTTTCCTTTGGG - Intergenic
1006359759 6:33580600-33580622 AGATGAACAGAGGCTCAGCTGGG + Intergenic
1008735436 6:54538105-54538127 TGATGGGCAGAGTTTTATCTTGG - Intergenic
1009802055 6:68551145-68551167 GGATGAAGTGTGTTTCTTCTAGG - Intergenic
1010760488 6:79716903-79716925 GGATGATAAGAGTTTGAACTAGG + Intergenic
1011111522 6:83842024-83842046 GAATGAACAAAGTTTCTTTTTGG + Intergenic
1011966910 6:93171149-93171171 TTATGAACAGGGTTGCATCTGGG + Intergenic
1013340645 6:109211953-109211975 AGATGAAGTGAGTTTCTTCTAGG + Intergenic
1013669141 6:112379418-112379440 TGATGAACAGAGTTTTGTCTTGG + Intergenic
1016024257 6:139269756-139269778 GGATGCACACAGTATCATCTTGG + Intronic
1021026640 7:15676276-15676298 GCATGAACAGAATTTTATTTTGG - Intronic
1024156832 7:46634612-46634634 GGCTGAACTGATTTTCCTCTTGG - Intergenic
1024213244 7:47225501-47225523 TTATGAGCAGAGTTTCATCTTGG + Intergenic
1024485577 7:49914362-49914384 GAATGAACCCAGTATCATCTTGG + Exonic
1028061466 7:86322846-86322868 GTATGAAATAAGTTTCATCTTGG + Intergenic
1030645207 7:112053475-112053497 GAATGGACAGAGTTACTTCTTGG - Intronic
1031500308 7:122506368-122506390 ATATGAACAGACTTTAATCTGGG + Intronic
1033593514 7:142835925-142835947 GGATGTTCAGAGTTTATTCTGGG + Intergenic
1038269751 8:26065585-26065607 TCATGAACAGAGTGTCCTCTGGG + Intergenic
1041335405 8:56776605-56776627 GGATGAACAGACTTTCTCCTGGG + Intergenic
1042818564 8:72905253-72905275 GAATTAACAGAGTTTTATCAAGG + Intronic
1044270480 8:90237056-90237078 GGAGGAACAGAGAGGCATCTTGG - Intergenic
1045713155 8:105010301-105010323 GGGTGAACAGAGTTTGGTTTAGG - Intronic
1047453351 8:124986927-124986949 GGATCAACTGAGATTCACCTTGG + Intergenic
1047489818 8:125365267-125365289 GGAAGAAGCGAGCTTCATCTGGG - Intronic
1051035425 9:12738929-12738951 AGATGAATAGTGGTTCATCTGGG + Intergenic
1056060017 9:82875561-82875583 GAATGAACAAAGTTGCATTTGGG - Intergenic
1059884662 9:118732417-118732439 GGAAGAAGATAGTTTCATATAGG - Intergenic
1060714593 9:125912003-125912025 GGATGAACAGAGGTTAGTCATGG + Intronic
1188364300 X:29295737-29295759 TGATGGACAGAGTTTCATCTTGG - Intronic
1190421758 X:50291672-50291694 GCAAGTAGAGAGTTTCATCTTGG + Intronic
1192318901 X:70073230-70073252 GGATTAAAAGAGTTTTATCAGGG + Intergenic
1193485576 X:82081929-82081951 GGTGGAACAGAGTTTCATCAAGG - Intergenic
1201483043 Y:14461173-14461195 GGATGAATCCAGCTTCATCTTGG - Intergenic