ID: 1098429567

View in Genome Browser
Species Human (GRCh38)
Location 12:70405005-70405027
Sequence AAGAGTGGCCAGAGGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 1, 2: 1, 3: 35, 4: 386}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098429567 Original CRISPR AAGAGTGGCCAGAGGGTGAA AGG Intronic
900032577 1:381785-381807 AAGGGTGGGCTCAGGGTGAAGGG + Intergenic
900881396 1:5383736-5383758 AAGTGTGGCCAAATGGTGATGGG - Intergenic
901317962 1:8321864-8321886 AAGAGTGGCTGGTGGATGAATGG + Intronic
901873921 1:12155207-12155229 AGGAGAGGCCAGAGGGAGATAGG + Intergenic
902236744 1:15062561-15062583 ATTAGTGGCCAGAGTGTGAGAGG - Intronic
902510682 1:16965455-16965477 AAGAGAGGCCATGGGGAGAAGGG + Intronic
902659178 1:17889570-17889592 AGTAGTGGCCAGGGGGTGGATGG + Intergenic
903766170 1:25736033-25736055 AGTAGAGGCCAGAGTGTGAAGGG + Intronic
905878553 1:41448866-41448888 AAGAGTTGGGAGATGGTGAAGGG + Intergenic
906796598 1:48701098-48701120 AGGTGTGGCCAGAGGGTCATGGG - Intronic
906837864 1:49103320-49103342 CAGAGAGGTCAGAGGGTCAAAGG + Intronic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
907330289 1:53666581-53666603 AAGAGTGGGCAGAGTGGGGATGG - Intronic
907373946 1:54020500-54020522 AAGGAAGGCCAGAGGCTGAAGGG - Intergenic
909564655 1:77040979-77041001 AAGAGTTGACAGAGGGTTGATGG - Intronic
910013642 1:82495540-82495562 AATCGTGGCGAAAGGGTGAAGGG + Intergenic
910682680 1:89883412-89883434 AAGCATGACCAGAGGGTAAAGGG + Intronic
910864107 1:91771934-91771956 CAGCTGGGCCAGAGGGTGAATGG + Intronic
912992297 1:114500551-114500573 AAGAGTGAGCAAAAGGTGAATGG + Intronic
913331414 1:117671224-117671246 AAAAGAAGCCAGAGGGGGAAGGG + Intergenic
913663966 1:121030605-121030627 AAGAGTGGAAAGAGTGTGTAGGG + Intergenic
914015359 1:143813884-143813906 AAGAGTGGAAAGAGTGTGTAGGG + Intergenic
914162427 1:145147124-145147146 AAGAGTGGAAAGAGTGTGTAGGG - Intergenic
914653977 1:149722425-149722447 AAGAGTGGAAAGAGTGTGTAGGG + Intergenic
915717956 1:157962269-157962291 AAGAGTGCAGAGAGGGGGAATGG - Intergenic
916000444 1:160610219-160610241 AAGAGTGAATAGAGGCTGAAGGG - Exonic
916039953 1:160953327-160953349 AACAGAGGCCAGTGGATGAAGGG + Intronic
916640248 1:166720450-166720472 GAGAGAGGCCAGAGTCTGAATGG - Intergenic
918240017 1:182612700-182612722 GAGAGTGGCCCCAGGGTCAAAGG - Intergenic
918943331 1:191028591-191028613 AAGGGCAGCCAGAGAGTGAAAGG + Intergenic
919813771 1:201425097-201425119 AGGAGAGGCCACAGGGTGAGGGG + Intronic
920372393 1:205487421-205487443 ATGAGTGCCCAGAGAGGGAAAGG - Intergenic
920617026 1:207503595-207503617 AAGGGAGGCAAGAGGGTGAAAGG - Intronic
920687186 1:208118380-208118402 GAGGGTGGCCAGTGGGTCAAGGG - Intronic
921297177 1:213715130-213715152 AAGACAGGCCAGTGGGTGAGAGG + Intergenic
921570897 1:216776849-216776871 AAGTGTGGCCAGATGGGGACAGG + Intronic
921610901 1:217210969-217210991 GAGAGTGACTAGAGAGTGAATGG - Intergenic
922050704 1:221987856-221987878 AAGAGTGGACGGAGGGCTAAAGG + Intergenic
922188435 1:223296368-223296390 AAGAGTGGGCCTAGGGAGAAGGG + Intronic
924071449 1:240284514-240284536 AAGAGTGGACAGCTGGGGAAGGG - Intronic
924262994 1:242251358-242251380 AAGCGTGGCCAGAGACAGAAGGG + Intronic
924606739 1:245541913-245541935 AAGAGAGGGTAGAGGGTGCAAGG - Intronic
924709020 1:246519133-246519155 CACAGTGGGCAGAGGGTGATCGG - Intergenic
1062766428 10:69341-69363 AAGGGTGGACATTGGGTGAATGG - Intergenic
1062957314 10:1548880-1548902 GTGAGTGGCCAGAGTGTGAGGGG + Intronic
1063264193 10:4428648-4428670 AATAGAGGCCAGAGGGAAAAAGG - Intergenic
1063282478 10:4645432-4645454 AAGAGTGAGAAGAGAGTGAAGGG - Intergenic
1063568281 10:7191609-7191631 ATGAGAGGCCAGAGAATGAAGGG - Intronic
1063664399 10:8052808-8052830 ACGAGTGGTCAGAGAATGAAAGG + Intergenic
1063840661 10:10068702-10068724 AAGATTGGCCATAAGGTGAAAGG + Intergenic
1065471458 10:26086173-26086195 AATCGTGGGCAGAAGGTGAAGGG + Intronic
1066721787 10:38347091-38347113 AAGCGTGGCCAGAGACAGAAGGG - Intergenic
1070337570 10:75468796-75468818 AAGAGAGGCCACAGGCTGGACGG - Intronic
1070991735 10:80739240-80739262 TACAGTGGCCTGAGGGTGAAGGG + Intergenic
1071932256 10:90485249-90485271 GTGAGTGACCAAAGGGTGAAAGG - Intergenic
1072608490 10:97001995-97002017 AGCAGTGCCCAGAGGGTGGAGGG + Intronic
1073510410 10:104039293-104039315 AGGAAAGGCCAGAGGGTGGAAGG - Intronic
1073611838 10:104951819-104951841 AAGATTAGCCAGATGGAGAATGG - Intronic
1074864243 10:117535646-117535668 AAGAGCGGCCCGGGGGTCAACGG + Intergenic
1074894472 10:117763012-117763034 AGGATTGGGGAGAGGGTGAAAGG + Intergenic
1075087298 10:119422167-119422189 AACAGCTGGCAGAGGGTGAATGG + Intronic
1076360543 10:129885709-129885731 AACAGTGTCCAGAGGGAGAGAGG - Intronic
1076406509 10:130215612-130215634 AAGAGGGCCCAGGCGGTGAATGG + Intergenic
1077378194 11:2215496-2215518 AGGAGTAGCCAGAGGGAGCACGG + Intergenic
1077615517 11:3670995-3671017 CAGAGGGGCCAGATGTTGAAGGG - Intronic
1078328348 11:10398417-10398439 CAGGGAGGCCAGAGGGTGCATGG + Intronic
1078858555 11:15226494-15226516 AAGTGTGGCCAGAGGTGAAATGG - Intronic
1081133799 11:39412784-39412806 AGTAGTTGCCAGAGGTTGAAGGG + Intergenic
1081566518 11:44264198-44264220 GAGAGTGGGCAGAGGATGACAGG - Exonic
1081567376 11:44268442-44268464 AAGCGTGGCCTGATGGTGAGAGG + Intronic
1083270605 11:61570319-61570341 GAGGGTGGCCAGAGGCTGGAAGG + Intronic
1083299476 11:61732801-61732823 CAGCCTGGCCAGAGGGAGAAGGG + Intronic
1084476070 11:69390523-69390545 AAGACTGGCATGAAGGTGAAGGG + Intergenic
1084683264 11:70679440-70679462 AAGAGGGGGCCGAGGGTGCAGGG - Intronic
1085308169 11:75500171-75500193 AGGAGAGGCCAGAGGGAGGAGGG - Intronic
1085946883 11:81283378-81283400 AAGAGAAGCCAGAGGGTCATTGG - Intergenic
1087001948 11:93430136-93430158 AACAGTAGCCAGAGGGTGGCAGG - Intronic
1088871835 11:113896980-113897002 CTGAGTGGGGAGAGGGTGAACGG - Intergenic
1088906994 11:114162576-114162598 GAGAGTGGGCAGAGGGTGCATGG - Intronic
1089668092 11:120032984-120033006 AAGAGATGGCAGAGGGTGGAAGG - Intergenic
1089861692 11:121595789-121595811 AAACGTGCCCAGGGGGTGAAGGG - Intronic
1090371949 11:126262238-126262260 AACAATAGCCAGAGGTTGAAGGG + Exonic
1091871896 12:3898895-3898917 ACAAGTGGACAGAGGCTGAAGGG + Intergenic
1093037301 12:14344781-14344803 AAGAATGGGCAGAGGGAAAAGGG - Intergenic
1093888091 12:24486546-24486568 AAGAGAGGCCAGAGGGGACAAGG - Intergenic
1094497970 12:31001054-31001076 AAGAGTGGTCAGAGGGACAGGGG - Intergenic
1095200491 12:39378832-39378854 AAGATTAGCCAGAGGGTAATGGG + Intronic
1096014907 12:48261909-48261931 AAGGGTGGGAGGAGGGTGAAGGG - Intergenic
1096014914 12:48261927-48261949 AAGGGTGGGAGGAGGGTGAAGGG - Intergenic
1096014921 12:48261945-48261967 AAGGGTGGGAGGAGGGTGAAGGG - Intergenic
1096145911 12:49278554-49278576 AAGTGTGCAGAGAGGGTGAAGGG - Intergenic
1098429567 12:70405005-70405027 AAGAGTGGCCAGAGGGTGAAAGG + Intronic
1099277856 12:80600992-80601014 AAGAGTGTCCAGGAGGAGAATGG - Intronic
1099671405 12:85698768-85698790 GATATTGGCCAGAGGATGAAAGG - Intergenic
1101037720 12:100721565-100721587 CAGAGTGGCTAGAGGTTGAAAGG + Intronic
1101254541 12:102964769-102964791 AGGAGTGGAGAGAGGGAGAAAGG - Intergenic
1102039689 12:109792839-109792861 AAGAGAGGCCAGAGGGGAGAGGG + Intronic
1103492957 12:121337495-121337517 ATGAGGGGCCAGAGCCTGAAGGG - Intronic
1104058528 12:125248801-125248823 CACAGTGGGCAGAGGGAGAAGGG - Intronic
1104727528 12:131087296-131087318 ACGAGGGACCCGAGGGTGAATGG - Intronic
1104992710 12:132635126-132635148 AGGAGTGGCCAGAGAGTGGCTGG - Intronic
1106115771 13:26816316-26816338 CAGAGTAGCCAGAGGCAGAAGGG + Intergenic
1106696130 13:32175397-32175419 GTGAGTGCCCAGAGGGTGGAAGG - Intronic
1107169326 13:37321239-37321261 GAGAGTGGAGAGAGGGAGAAGGG + Intergenic
1107671311 13:42749223-42749245 ATGAGTGGCCTGAGAGAGAAGGG + Intergenic
1108640728 13:52380324-52380346 AAGAGTGGGCAGTGGGAGGACGG - Intronic
1111188063 13:84769076-84769098 AAGAATGACCAAACGGTGAATGG - Intergenic
1111916132 13:94362533-94362555 AAGACTGGTAAGGGGGTGAAAGG + Intronic
1112065271 13:95785818-95785840 AATAATGGCCAAAGAGTGAAGGG + Intronic
1113441551 13:110333023-110333045 TGGAGAGGGCAGAGGGTGAAGGG + Intronic
1114665708 14:24376181-24376203 ATGAGGGGCCAAGGGGTGAATGG + Intronic
1115100081 14:29688176-29688198 CAGAGGGACCATAGGGTGAAAGG - Intronic
1115444961 14:33479447-33479469 CAGAGTGACAAGTGGGTGAAGGG - Intronic
1116065287 14:39974159-39974181 ATGTGTGGCCAGTGGGTGAGAGG + Intergenic
1116075936 14:40111045-40111067 AAGACTGTCCTGAGGGTAAAAGG + Intergenic
1116619422 14:47180179-47180201 AACAGAGGCCAGAGGGTGGGAGG - Intronic
1116676611 14:47914209-47914231 AAGAGTGGAAAGAGGGTAAATGG + Intergenic
1117014970 14:51508847-51508869 AAGGGTGGGAAGAGAGTGAAAGG - Intronic
1117433798 14:55697407-55697429 AGAAGTGACCAGGGGGTGAATGG - Intronic
1117623756 14:57614639-57614661 AACAGTTGCCTGAGGGAGAATGG - Intronic
1117966809 14:61214664-61214686 AAGAGGGGTCAGATGGGGAAGGG - Intronic
1121724936 14:96140320-96140342 AAGAGTGACCAGAGGTTCAGAGG - Intergenic
1121974307 14:98388684-98388706 AAGAGTGGCCTCATGGTGAGAGG + Intergenic
1122043585 14:99007689-99007711 AACAGGGGACAGAGGGTGAGGGG + Intergenic
1122046296 14:99026350-99026372 CACAGTGCCCAGAGGGTGAGAGG - Intergenic
1122363710 14:101182285-101182307 GAGAGTGTCCAGAGAGTGACCGG + Intergenic
1123478970 15:20613668-20613690 AAGAGTGGACGGTGGCTGAAGGG + Intergenic
1123639042 15:22386717-22386739 AAGAGTGGACGGTGGCTGAAGGG - Intergenic
1124572684 15:30880229-30880251 AAGTGTAGTGAGAGGGTGAAGGG - Intergenic
1124866710 15:33499305-33499327 AAGAGTGGCAGGAGGGAGGAGGG - Intronic
1124939119 15:34201426-34201448 ATGTGTGGCTAGGGGGTGAAGGG + Intronic
1125755052 15:42057905-42057927 GAGTGAGGCCAGTGGGTGAAGGG - Intergenic
1125772506 15:42179267-42179289 AAAAGTGGCGGGAGGGGGAAAGG + Intronic
1126804409 15:52331840-52331862 AAGAGTGGTCAGATTGTGATTGG + Intronic
1126943993 15:53797705-53797727 GAGAGTGGACTGGGGGTGAAAGG + Intergenic
1127127937 15:55831440-55831462 AAGAGAGGCCAGAGACGGAAAGG + Intronic
1127406610 15:58655349-58655371 AAGCATGGGCAGAAGGTGAAGGG + Intronic
1127521261 15:59745331-59745353 GAGAGTGGCCATGGGGAGAAGGG + Intergenic
1128151754 15:65367621-65367643 GAGAGTGGCCAGCGGGTGGCGGG - Intronic
1128676157 15:69610211-69610233 AAGAGTGGGGAGAGGGGAAAAGG - Intergenic
1128897544 15:71389295-71389317 AATAGTTGCCAGGGGCTGAAGGG - Intronic
1130157057 15:81359910-81359932 AATAGTGGACCGTGGGTGAAGGG + Intronic
1130823312 15:87517892-87517914 AGGAGTGGCCAGGGGCTAAACGG - Intergenic
1131638495 15:94263374-94263396 TATTGTGGCCAGAGGCTGAAAGG - Intronic
1132336964 15:101053875-101053897 CAGAGTGGCCAGAGGGTGAAAGG + Intronic
1133097033 16:3454342-3454364 ACCCATGGCCAGAGGGTGAAAGG + Intronic
1133931504 16:10236368-10236390 AAGAGAAACCAGAGTGTGAAAGG + Intergenic
1133957249 16:10455285-10455307 AAAAGTGGCAAGAAGGTCAAAGG + Intronic
1134118530 16:11567464-11567486 ATGGGTGGACAGAGGTTGAAAGG + Intronic
1135505575 16:23033243-23033265 AAGAGTGGAGAGAGAGTGAGAGG + Intergenic
1135637598 16:24092183-24092205 AATAGTTGCCAGAGGCTGGAGGG - Intronic
1136049247 16:27638795-27638817 AGGAGAGTACAGAGGGTGAATGG - Intronic
1136920519 16:34267532-34267554 AAGGGAGGGCAGAGGGAGAATGG - Intergenic
1137054380 16:35736295-35736317 AAGGGTGGCCAGAGAGTCAGGGG - Intergenic
1139754168 16:69129682-69129704 AAGAGGGGCCAGATTGTGGAGGG - Intronic
1140786490 16:78347264-78347286 AGCATTGGCCAGAGGGAGAAAGG - Intronic
1141337018 16:83165573-83165595 AAGAGTGGACAGTGGGTACAGGG + Intronic
1141485997 16:84340750-84340772 AGGGGTGGCCAGAGGCTGAGAGG + Intergenic
1148194266 17:45701909-45701931 AAGAGTGGGCAGAGTGTGGAAGG + Intergenic
1148221690 17:45867114-45867136 TAGAGTGACCAGTGGCTGAAGGG - Intergenic
1149442657 17:56688009-56688031 ATTAGTGGACAGAGGGTGGATGG + Intergenic
1150645675 17:66976220-66976242 AAGACTGTCCAGATGGTGAGTGG - Intronic
1152472730 17:80499353-80499375 AAGAGGGCTCAGAGGGTGAGTGG + Intergenic
1152631328 17:81411855-81411877 AAGAGTGACCAGGGTGTGGAGGG - Intronic
1152959295 18:68909-68931 AAGGGTGGACATTGGGTGAATGG - Intronic
1153939949 18:9968868-9968890 GCGAGGGGCCAGAGTGTGAAGGG - Intergenic
1154121761 18:11657926-11657948 AAATGTGGCCAGAGGGTCAGAGG - Intergenic
1154484787 18:14865063-14865085 AAGTGTGGCCAGAGGGAGTGGGG - Intergenic
1154959248 18:21291376-21291398 AAGAGTGGATAGTGAGTGAAGGG - Intronic
1155733431 18:29191195-29191217 CAGGGTGGAAAGAGGGTGAAGGG - Intergenic
1156536092 18:37865999-37866021 AAGCGTGGACAGAGCATGAAAGG + Intergenic
1157680726 18:49603363-49603385 GAGTGTGGCCAGAGGGCGGATGG - Intergenic
1157900504 18:51511316-51511338 AAAAGTGGCCAGAGCATTAATGG - Intergenic
1159868235 18:73730972-73730994 GAGAGTGGGCAGGTGGTGAATGG - Intergenic
1163035273 19:14566027-14566049 GAGAGTGGGGAGAGAGTGAAGGG - Intergenic
1163200506 19:15764561-15764583 AAGAGTGGAAAGACGGTCAAAGG + Intergenic
1163332582 19:16650411-16650433 AAGAGTGGGCACAGGGAGATTGG + Intronic
1164146182 19:22513978-22514000 AAGAGTGGCCAGAATCTGAATGG + Intronic
1164160177 19:22621087-22621109 GAGAGTGGCCAGAATCTGAATGG - Intergenic
1164446019 19:28318190-28318212 AAGAGCTGCCAGATTGTGAATGG - Intergenic
1165364849 19:35359140-35359162 GAGAGTGGGCAGAGGATGAAGGG - Exonic
1165366668 19:35371609-35371631 GAGAGTGGGCAGAGGATGAAGGG - Exonic
1165920808 19:39296914-39296936 AAGAGGGGGGAGAGGGTCAAGGG - Intronic
1166642267 19:44503946-44503968 AAGAGTAACGAGAGGGTAAAAGG + Intronic
1167076640 19:47254203-47254225 AGGAGAGGCCGGAGGGTGAGAGG - Intergenic
1167316922 19:48769279-48769301 AAAAGTGGCCAGGAGCTGAAGGG - Intergenic
925079932 2:1056040-1056062 CAGAGTGGACACAGGGAGAAGGG + Intronic
925429225 2:3776560-3776582 ACGAGCGGCCAGAGGGAAAAGGG - Intronic
925741722 2:7010741-7010763 AAAGTTGGCCAGAGGGTCAAAGG - Intronic
926394437 2:12426624-12426646 AAGTGTGGCAAGATGGTGTAGGG + Intergenic
927705901 2:25296441-25296463 AGGAGTGGTCAGATGGTGAGGGG + Intronic
929661604 2:43791266-43791288 TACAGTGGCCAGAGGCTGAAAGG + Intronic
929883557 2:45858562-45858584 AAGGGTGCCCAGGGGCTGAAAGG - Intronic
929891142 2:45919423-45919445 AAGAGAGGCCAGAGGGCAGAAGG - Intronic
930751983 2:54943235-54943257 AAGAGAGGGAAGAAGGTGAATGG - Intronic
931382347 2:61765183-61765205 AATAGTGGCCAGAGGGGGGCCGG - Intergenic
932430646 2:71671983-71672005 AAGAGAGGTCAGAGAGTGGAAGG + Intronic
932573579 2:72950903-72950925 AGGAGTGGCCATAGGGAGAAGGG + Intronic
933468243 2:82684448-82684470 AAGAGTTGCCAGAGTGTCATGGG - Intergenic
934985190 2:98880231-98880253 AAGAGTGACCAGAGGAGGACGGG + Intronic
935309027 2:101764709-101764731 ATGAGTGGCAAGAAGGTGCAGGG - Intronic
935410803 2:102759886-102759908 CGGAGTGGCCAGAGAGAGAAAGG - Intronic
935530713 2:104229703-104229725 AATAGGGGCCAGATGATGAAGGG - Intergenic
936147160 2:109987605-109987627 CAGAGAGGCCAGTGGGTGCATGG + Intergenic
936197532 2:110383878-110383900 CAGAGAGGCCAGTGGGTGCATGG - Intergenic
937213845 2:120297769-120297791 AAAAATGGCGAGGGGGTGAAGGG - Intergenic
938139421 2:128783879-128783901 AAGAGTCAACAGAGGCTGAATGG + Intergenic
939553132 2:143640302-143640324 GAGGGTGGCGAGAAGGTGAATGG + Intronic
939708762 2:145488575-145488597 AAAAGTGGGGAAAGGGTGAAAGG + Intergenic
942138450 2:172953551-172953573 AATAGTGGTCAGTGGGGGAAGGG - Intronic
943115969 2:183670687-183670709 AACAGTCCCCAGAGTGTGAAAGG - Intergenic
943516917 2:188899999-188900021 AAGAGGAGCCAGAGGGAGATCGG - Intergenic
943774951 2:191755222-191755244 GAAATTGGCCAAAGGGTGAACGG - Intergenic
944179460 2:196872731-196872753 AGGAGTTGCGAGAGGGTGGAAGG + Intronic
946391543 2:219419408-219419430 CAGTGTAGCCAGAGGGAGAAGGG + Intronic
946456638 2:219832005-219832027 GAGAGAGGACAGAGTGTGAAGGG + Intergenic
947935780 2:234002218-234002240 AGGAGTGGGCAGAGGGAGGAGGG + Intronic
947938708 2:234029324-234029346 AAGAGAGGCCAGAGGTTCCAAGG - Intergenic
948395301 2:237640864-237640886 AAGAGAGGCCAGGGGTTGGAAGG - Intronic
948602888 2:239117294-239117316 CAGACAGGCCAGAGGTTGAAAGG + Intronic
1169023573 20:2348641-2348663 AAGAGGGGCCAGAGTGAGACTGG - Intergenic
1170031355 20:11947551-11947573 AAGAGTGGACAGAGTGAGAAAGG - Intergenic
1170611861 20:17920802-17920824 AAGACTGTTGAGAGGGTGAAAGG + Intergenic
1170859175 20:20086886-20086908 AAGAGTCACCGGAGGGTGTAGGG + Intronic
1171086214 20:22240336-22240358 AGCAGTGGGCAGAGGGAGAATGG - Intergenic
1172413659 20:34745711-34745733 GAGAGTGGCCTAAGTGTGAAGGG + Intronic
1173037486 20:39426544-39426566 AGGAGTGGGCAGAGGGGGATAGG + Intergenic
1173620625 20:44433220-44433242 AAGAATGGCAAGAGGGTCCAAGG + Intergenic
1174087473 20:48019366-48019388 ATGTGTGGCTGGAGGGTGAAGGG + Intergenic
1174128814 20:48327604-48327626 ATGTGTGGCTGGAGGGTGAAGGG - Intergenic
1174203950 20:48826341-48826363 AAAAGTGGCCAGCGGGTGGAGGG - Intronic
1174272107 20:49377162-49377184 AAGAGAAGCCAGAGAATGAAGGG + Intronic
1174655574 20:52169538-52169560 GAAAGTGGCAGGAGGGTGAAGGG - Intronic
1175176658 20:57116412-57116434 AAGAGAAGCCAGAGGTTGGATGG - Intergenic
1175548804 20:59802284-59802306 AAATGTGGACAGAGAGTGAAGGG + Intronic
1176367247 21:6040532-6040554 TACAGTGGCCAGAGGAAGAAGGG - Intergenic
1176723564 21:10412585-10412607 GAGGGTGGCCAGTGGGAGAAGGG - Intergenic
1176796538 21:13374412-13374434 AAGTGTGGCCAGAGGGAGTGGGG + Intergenic
1178135241 21:29619484-29619506 AAGAGTGGGAAGGGGGTGAGCGG + Intronic
1178267806 21:31160300-31160322 AAGGGTATCCAGAGGGTAAAAGG + Intronic
1178387594 21:32166073-32166095 CAGAGTTGCCAGGGGGTGAGGGG + Intergenic
1178619087 21:34158601-34158623 AGGCATGGCCAGAGGGTGGAGGG + Intergenic
1179710299 21:43209512-43209534 AAGACTGTCCAGAGGGACAATGG + Intergenic
1179756272 21:43498014-43498036 TACAGTGGCCAGAGGAAGAAGGG + Intergenic
1180304723 22:11065357-11065379 GAGGGTGGCCAGTGGGAGAAGGG - Intergenic
1180666063 22:17513252-17513274 AAGAGTGCCCAAAGGATAAACGG - Intronic
1180786705 22:18551660-18551682 CAGAGAGGCCAGAGGTTCAAGGG + Intergenic
1181243619 22:21491181-21491203 CAGAGAGGCCAGAGGTTCAAGGG + Intergenic
1182154428 22:28055859-28055881 AATGGTGGCCAGTGGGGGAAAGG - Intronic
1182567901 22:31213194-31213216 AAGAGTTGTCTAAGGGTGAAGGG + Intronic
1183987006 22:41575516-41575538 AAGAGGGGCCTGAGGGCGGAAGG + Exonic
1185373601 22:50471882-50471904 AGGCGAGGCCATAGGGTGAAAGG + Intronic
949416154 3:3816462-3816484 AAAAGTGGACTGAGGGTGGAGGG - Intronic
950814807 3:15689494-15689516 AAGAGAGGCCACAGGAGGAAGGG + Intronic
950886890 3:16370168-16370190 AAGAATGGCCAGACAGTGAGCGG - Exonic
951786596 3:26426813-26426835 AAGAGTAGAAAGAGGGCGAAGGG + Intergenic
951876500 3:27431640-27431662 AAGAGTGGCGGGAGGCTGAAAGG + Exonic
952765224 3:36947248-36947270 AAGAGTGGTCAAAGTGTAAACGG - Intergenic
952809316 3:37387257-37387279 AAAACTGGGCAGAGGGAGAAAGG - Intronic
954575715 3:51674927-51674949 AAGAGTGGGCAGAATCTGAATGG - Intronic
956228732 3:66988728-66988750 AACAGGGCCTAGAGGGTGAAAGG + Intergenic
956724886 3:72148812-72148834 AACTGTGGCCAGAAGGCGAAGGG + Intergenic
956790664 3:72677594-72677616 AGAAGAGGCCAGCGGGTGAACGG - Intergenic
956889918 3:73602562-73602584 AAGAGTGGCAATAGGGTAAAAGG + Intronic
957403914 3:79752549-79752571 AGGTGTGTGCAGAGGGTGAAAGG + Intronic
957792083 3:84954237-84954259 AAGAGTGACCAGAGGAGGTAGGG + Intergenic
961550374 3:127667508-127667530 AGGAGTGGCCACAGGGCCAAAGG + Intronic
961797849 3:129422575-129422597 AAGAGTGCCCAGGGTGTGGATGG - Intronic
961815963 3:129550525-129550547 CAGAGTGGCTGGAGGGTTAACGG - Intronic
962043763 3:131734191-131734213 AGAAGTGGGCATAGGGTGAAGGG - Intronic
962240684 3:133748383-133748405 GAGAGAGGCCAGAGGTGGAAGGG - Intronic
962595250 3:136935625-136935647 AAGAGTGACCATAGTGAGAAGGG + Intronic
964453914 3:156839544-156839566 AAAAAAGGTCAGAGGGTGAAGGG + Intronic
965259812 3:166467637-166467659 AAGAGTGGCCATGGTGTCAAGGG + Intergenic
966263131 3:178003668-178003690 AAGACTGCCCAGATGGTGAGTGG + Intergenic
967943335 3:194783173-194783195 GTGAGTGGGCAGAGGGTGAAGGG + Intergenic
968025859 3:195442429-195442451 AAGAGCAGCCAGAGGAGGAAGGG + Intronic
968231172 3:197005584-197005606 AGGAGTGGCCAGAGAGTGAGAGG + Intronic
969451138 4:7274108-7274130 AAGAGAGGAGAAAGGGTGAAAGG - Intronic
969719412 4:8885104-8885126 AAGAGGGGCCACAGGGAGAAGGG - Intergenic
970266724 4:14296496-14296518 AAGTGTGGCCAGAGGCTGCGTGG + Intergenic
970733723 4:19140699-19140721 AAGAGGAGCAAGAGAGTGAAGGG + Intergenic
970985692 4:22154454-22154476 AAGGGTAGCTAGAGGGTGCAAGG + Intergenic
971924249 4:32986264-32986286 AAAAGTGTCCAGATGGTGCATGG + Intergenic
972129995 4:35820785-35820807 AAAGGTGGGCAGAGGGGGAAGGG - Intergenic
973162007 4:47031108-47031130 AAGAGTGGAGAGAGAGGGAACGG - Intronic
973163317 4:47046101-47046123 CAGAGTGGCCGGAGAGAGAAGGG - Intronic
975343337 4:73265791-73265813 AAGGGTAGTAAGAGGGTGAAGGG - Intergenic
975385162 4:73749545-73749567 CAGAGTAGACAGAGGGTGGAGGG + Intergenic
975688619 4:76943914-76943936 ATGACTGGCCACAGGGAGAAAGG + Intergenic
976686416 4:87819845-87819867 AAGAGTGGCCAGAGGAGCAGGGG - Intergenic
977736039 4:100417215-100417237 AAGAGTGGACAGCAGGTGAGGGG - Intronic
978542617 4:109835000-109835022 AAAAATGGCCAGATGATGAACGG - Intronic
979793310 4:124813758-124813780 AAGATTGGCAAGAGGTTAAAGGG - Intergenic
980955755 4:139427690-139427712 AATCATGGCCAGAAGGTGAAGGG + Intergenic
981162947 4:141521001-141521023 AAGAGTGGCATAAAGGTGAAAGG + Intergenic
983781316 4:171673967-171673989 AAGAGGGTCAAGTGGGTGAAGGG + Intergenic
984687530 4:182688109-182688131 AAGAGTGGCGGGAGAGAGAAGGG - Intronic
986384237 5:7216204-7216226 AAGAGTGGGCATGGGGTGGAGGG + Intergenic
988921497 5:35946656-35946678 AAGAAGGGGCAGAGGGTGAGAGG - Intergenic
989043379 5:37250956-37250978 AAAAGTGCAGAGAGGGTGAAAGG - Intergenic
990123346 5:52483609-52483631 AAGAGTGGGCAGTAGGGGAAAGG + Intergenic
992032357 5:72734448-72734470 AAGACTCGCTTGAGGGTGAAGGG - Intergenic
994338117 5:98593299-98593321 AAGAATTTCAAGAGGGTGAAAGG + Intergenic
994384045 5:99107227-99107249 AACATTGGCCAGAGTGTGACAGG + Intergenic
995331270 5:110949658-110949680 AAGGGAGGGCAGAGGGAGAATGG - Intergenic
997179192 5:131811029-131811051 AGAAGTGGCCAGAGGTTGAAAGG + Intronic
998415920 5:141945930-141945952 CAGAGTGGCCAGACGGGGACAGG + Intronic
998516306 5:142757677-142757699 CAGAGTGGGCAGAGGGAGAAGGG + Intergenic
998671051 5:144354458-144354480 TAGGCTGGCCAGAGGGTGGAAGG - Intronic
999287170 5:150401001-150401023 GAGAGAGGCCAGATGGTGGAGGG - Intergenic
999298149 5:150473313-150473335 TAGAGGGGTCAGAGGGTGACAGG + Intergenic
999531650 5:152469605-152469627 AAGTGTGGAGAGAGGGTGGAAGG + Intergenic
1001235714 5:170027675-170027697 TGGAGTGCCCAGAGAGTGAAGGG - Intronic
1001411335 5:171514600-171514622 AAGAGTGGCCGGAGGGTAGGAGG + Intergenic
1001567762 5:172711572-172711594 GAGAGTGGCCCAAGGGAGAAAGG - Intergenic
1002329379 5:178430990-178431012 AAGAGATGCCAGAGGGAGACGGG + Intronic
1002741243 5:181437083-181437105 AAGGGTGGGCTCAGGGTGAAGGG - Intergenic
1003505701 6:6738464-6738486 GAGAGTGGCCACAGGATTAAAGG - Intergenic
1005835951 6:29709794-29709816 CACAGTTGCCAGAGGGTAAAAGG - Intergenic
1006055329 6:31379680-31379702 CATAGTTGCCAGAGGGTGGAAGG + Intergenic
1006263171 6:32894167-32894189 AAGAGGGGAAAGAGGGGGAAGGG - Intergenic
1008847136 6:55981363-55981385 AATCCTGGCCAGAGGGAGAAGGG - Intergenic
1009195826 6:60683354-60683376 GAGATGGGCCAGAGAGTGAAGGG + Intergenic
1009968699 6:70604248-70604270 AAGAGTGGCCAGAGGAGCAAGGG + Intergenic
1010524345 6:76881922-76881944 AAGAGTGGCTAAATGGTGAAAGG - Intergenic
1011382961 6:86762347-86762369 AAGAGAGGCCAGTTGATGAAGGG + Intergenic
1013485163 6:110589864-110589886 AAGAGTGGACAGTGGGGGAGTGG - Intergenic
1014744469 6:125183550-125183572 AAGAGTGCCCAGTCCGTGAAGGG + Intronic
1015506361 6:133992810-133992832 ATGAGTGGTTAGAGGGTGAGTGG + Intronic
1015723727 6:136276400-136276422 AAGGGAGGGCAGAGGGAGAATGG - Exonic
1016249888 6:142028158-142028180 AACTGGGGCCTGAGGGTGAAGGG + Intergenic
1016361307 6:143270208-143270230 AAGTGTGGGAAGAGGGGGAAAGG - Intronic
1017615428 6:156242200-156242222 AAGAGGGGCCAAAAAGTGAAAGG - Intergenic
1018176849 6:161184582-161184604 CAGAGAGGCCAGAGGATGACAGG - Intronic
1018208389 6:161456743-161456765 ATGGGTGGTCAGAGGGTGAAAGG + Intronic
1018693412 6:166368862-166368884 AGGAGTGGCAAGAGAGTAAACGG - Intronic
1018791699 6:167153707-167153729 AAGTGTGGACAGACGGTGAATGG - Intronic
1019068809 6:169325057-169325079 AAGTGTGGCCACAGGGGTAAAGG - Intergenic
1019471923 7:1225579-1225601 CAGAGTCCCCAGAGGGTGAGCGG - Intergenic
1020334371 7:7051342-7051364 AAGTGTGGCAAGAGGGAGGAGGG + Intergenic
1020917833 7:14218921-14218943 AATAGTGGACTGAGGGTGAGAGG - Intronic
1020920560 7:14258582-14258604 AAGAATTGCTAGAGGGTGAAAGG + Intronic
1021839691 7:24712636-24712658 CAGAGTGACCAGCGGGTGGAGGG + Intronic
1022138026 7:27467408-27467430 AAGAAAGGGCAGAGGATGAAGGG - Intergenic
1023020834 7:36010514-36010536 AAGAGATGCCAGAAGGTGGATGG - Intergenic
1023632376 7:42177185-42177207 GAGAGTGGCCAGAGGTGGAGAGG + Intronic
1024354769 7:48403238-48403260 GACAGTGGCCAGGGAGTGAAGGG + Intronic
1025021547 7:55484343-55484365 AAGACTGGCAAGGGGGTGGAAGG - Intronic
1025110740 7:56214097-56214119 AAGAGTGGGAAGGGGGTGAGGGG - Intergenic
1025139960 7:56454535-56454557 CAGAATTGCCAGAGGGTGATAGG + Intergenic
1026638061 7:72101627-72101649 AAGGGTGACCATATGGTGAATGG - Intronic
1027485952 7:78761906-78761928 AATAGTGGCTGGAGTGTGAAGGG + Intronic
1029216278 7:98952678-98952700 AAGAGTGGGCTGAAGGGGAACGG + Intronic
1030096502 7:105905347-105905369 AAGAGTGGGCAGAGGGGAAGGGG + Intronic
1030144191 7:106336061-106336083 GAGAGAGGCCAGAGTCTGAATGG - Intergenic
1030723223 7:112894139-112894161 TAGAGAGGCCTGGGGGTGAAGGG + Intronic
1030907011 7:115198021-115198043 AAATGTGGAGAGAGGGTGAATGG - Intergenic
1031462111 7:122064282-122064304 ACAACTGGCCAGAGGGTGAGGGG + Intergenic
1031880214 7:127189338-127189360 AGGACTGGCCAGAGGGGGATGGG + Intronic
1031989921 7:128190848-128190870 AGGAGGGGCCGGAGGGGGAAGGG - Intergenic
1032304617 7:130720902-130720924 AAGAGGGTGTAGAGGGTGAAGGG - Intergenic
1032963155 7:137063994-137064016 ATCAGTGGCCAGAGGGTGGAGGG + Intergenic
1033261144 7:139845044-139845066 AAGACTGGCCAGACTGTGGAGGG - Intronic
1033478691 7:141716460-141716482 AAGAGAGGGCAGAAGGAGAAGGG - Intronic
1033597263 7:142866742-142866764 AGTAGGGGCCAGAGGCTGAATGG + Intronic
1033695018 7:143779819-143779841 GAGAGTGGGCGGAGGGAGAAAGG + Intergenic
1034892820 7:154855602-154855624 TAGAGTGGGCAGAGGGTGGGTGG - Intronic
1036623347 8:10443862-10443884 CAGGGTGGCCAGAGAGAGAAAGG + Intergenic
1037209356 8:16366897-16366919 GAGAGTGGGAAGAGGGTGAAGGG + Intronic
1038340573 8:26682042-26682064 AGGAGTGGGAAGAGGGTGGAGGG - Intergenic
1039334369 8:36573759-36573781 AAGAGGAGCCAGTGGGTGAGTGG + Intergenic
1039390844 8:37179823-37179845 AAGAGAAGCCAGAGGGGGAAAGG - Intergenic
1039437937 8:37573513-37573535 AAGAGAGGGCAGTGGGAGAAAGG - Intergenic
1041534466 8:58910432-58910454 AAGAGTGGGTAGATGGTTAATGG + Intronic
1041553932 8:59131912-59131934 AAGAGAGGCTAGAGGATGACAGG - Intergenic
1041561784 8:59226448-59226470 AAAAGTGGCCAGAGTGTTACTGG + Intergenic
1042213533 8:66405340-66405362 AAGTGGGGCCAGATTGTGAAGGG - Intergenic
1042507239 8:69573688-69573710 AGAAGTGGAAAGAGGGTGAAAGG - Intronic
1045968745 8:108055992-108056014 CTGAGGGACCAGAGGGTGAATGG - Intronic
1045974845 8:108120659-108120681 AAGAATTGCCAGAGGGTGGATGG - Intergenic
1046578963 8:116067987-116068009 GAGAGAGGCCAGAGTCTGAATGG - Intergenic
1046611164 8:116427078-116427100 AAGAGTGAACAAAGGGTTAAGGG - Intergenic
1048492555 8:134907502-134907524 AAGGGTGGGAAGAGGGTGACAGG - Intergenic
1048571838 8:135663225-135663247 AGGCTGGGCCAGAGGGTGAAGGG - Intergenic
1048653599 8:136509884-136509906 AAAAGTGGTCAGAGTATGAATGG + Intergenic
1049698804 8:143997264-143997286 AAGTGGGTCCAGAGGGTGGAGGG - Intronic
1049702593 8:144021926-144021948 AAGAGGGTCCTGAGGGGGAAGGG - Intronic
1049702745 8:144022547-144022569 AAGAGGGTCCTGAGGGGGAAGGG - Intronic
1049766973 8:144359409-144359431 AAGAGCTTCCAGAGGGTGAGTGG + Exonic
1049773952 8:144396218-144396240 AGGAGTGTCCAGAGGGCGATGGG - Intronic
1050195202 9:3075537-3075559 ATGAGTGGCATGAGGGTGAAAGG - Intergenic
1050479982 9:6079303-6079325 TATGGTGGCCAGAGGGTGAGGGG + Intergenic
1053109826 9:35448794-35448816 AATAATGGTCAGATGGTGAAAGG + Intergenic
1054705934 9:68462169-68462191 AGGAAAGGCCAGAGTGTGAAGGG - Intronic
1055695634 9:78881167-78881189 GAGAGTGACTAGAGGCTGAAAGG - Intergenic
1056995258 9:91451205-91451227 AACAAAGGCCAGGGGGTGAAAGG - Intergenic
1057112018 9:92481446-92481468 AACAGTGGCCACATGGTGTAGGG - Intronic
1058071187 9:100602045-100602067 AAGAGGGGCCAGATGGTGCAGGG - Intergenic
1059457073 9:114406454-114406476 CTGGGTGGCCAGAGGGTGATGGG + Exonic
1060264850 9:122105661-122105683 ATGAAAGGCCAGAGGGTGTAGGG - Intergenic
1060980786 9:127790460-127790482 GAAAGTGGGCAGAGGGTGAAGGG + Exonic
1061304190 9:129723068-129723090 TAGACTGGCCAGAGGGTGTGTGG + Intergenic
1061371939 9:130202224-130202246 CAGGCTGGCCAGAGGGTAAAGGG - Intronic
1061755481 9:132809380-132809402 GAGGGAGGCCACAGGGTGAAGGG - Intronic
1061796891 9:133090859-133090881 ACGAGTGGCCACAGTGTGCAGGG + Intergenic
1061951838 9:133940569-133940591 AGGAGTGGCCTGAGGCAGAAGGG - Intronic
1062201595 9:135305816-135305838 GAGAGTAGCGAGAGGGAGAAGGG + Intergenic
1062738826 9:138154972-138154994 AAGGGTGGACATTGGGTGAATGG + Intergenic
1186174193 X:6907795-6907817 AGGATGGGCAAGAGGGTGAAGGG + Intergenic
1187754008 X:22500011-22500033 AAGAGAGGACAGAGAGAGAAAGG + Intergenic
1189214943 X:39314849-39314871 AGGAGTGGACAGATGGAGAAAGG - Intergenic
1189944616 X:46165225-46165247 AAGAAAGGCCAGAGGGTTCAGGG + Intergenic
1190510382 X:51168174-51168196 AAGAGTGGGCTTTGGGTGAATGG - Intergenic
1192502842 X:71664801-71664823 AAGACTCACCAGAGGGTGCATGG + Intergenic
1192736108 X:73850887-73850909 AAGAGGGGACAGAGGTGGAAAGG + Intergenic
1192819054 X:74624052-74624074 AAGAGGGGCAAGAGGTGGAAGGG - Intergenic
1195403128 X:104483394-104483416 GAGAGTGCCCAGAGGATGTAGGG + Intergenic
1196720511 X:118849327-118849349 AAGACTGGCCAGAAGGTAGAAGG + Intergenic
1200240898 X:154493022-154493044 AAAATTGGCCAGAGGGAGAAAGG + Intergenic
1200770848 Y:7124035-7124057 AGGAGTGGCCAGAGGGAGAATGG + Intergenic
1200901514 Y:8437129-8437151 AAGATTAGCCAAAGGATGAAAGG + Intergenic
1200943980 Y:8813639-8813661 AAGAGTGGTCAGACGGTGATAGG - Intergenic
1200966959 Y:9055654-9055676 AAGGGTGGGCACTGGGTGAATGG - Intergenic